Application of PUB62 gene in regulating plant resistance to geminivirus and method for cultivating transgenic plants

Abstract

The present invention discloses an application of the PUB62 gene in regulating plant resistance to geminiviruses and a method for cultivating transgenic plants, wherein the geminiviruses are soybean yellow leaf curl virus, tomato yellow leaf curl virus, and Yunnan tomato leaf curl virus. In the present invention, the PUB62 gene of Nicotiana benthamiana is cloned and constructed into the NbPUB62-YFP vector carrying a yellow fluorescent protein. Through the agrobacterium-mediated transformation method, the NbPUB62-YFP vector is introduced into plant cells, and through cell and tissue culture techniques, NbPUB62 overexpressing transgenic plants are obtained. The NbPUB62 overexpressing transgenic plants can significantly inhibit the infection of soybean yellow leaf curl virus, and can also significantly inhibit the infection of tomato yellow leaf curl virus and Yunnan tomato leaf curl virus.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of the PUB62 gene in regulating plant resistance to geminiviruses and a method for cultivating transgenic plants. Background Art

[0002] Geminiviruses are single-stranded circular DNA viruses that occur widely worldwide and are the most numerous plant viruses to date, with more than 520 species. They can cause serious yield reduction or even crop failure in crops such as cassava, maize, and tomato. As single-stranded DNA viruses, geminiviruses replicate in the host cell nucleus through recombination-dependent replication or rolling circle replication. Research has shown that recombination is an important factor driving the evolution of geminiviruses. The newly generated viruses often have stronger pathogenicity, and once introduced or invaded into new countries and regions, they will pose new challenges to the prevention and control of diseases.

[0003] Soybean yellow leaf curl virus (SbYLCV), also known as soybean chlorosis-related geminivirus, is a newly identified type of recombinant geminivirus that seriously threatens soybean production in recent years. After being infected, soybean plants show upward curling of leaves. When the plants should mature, the leaves remain green and show symptoms such as empty pods or shrunken grains. This virus is currently widely distributed in the main soybean producing areas such as the Huang-Huai-Hai region of China, posing a serious threat to the stable production of soybeans. Planting disease-resistant varieties is the most economical and effective means to control geminiviruses, but no soybean varieties resistant to SbYLCV have been reported so far. Therefore, exploring host factors resistant to SbYLCV infection in plants and evaluating their resistance to several different types of geminiviruses are of great significance for accelerating the molecular breeding project of geminivirus resistance and effectively controlling geminivirus infection. Summary of the Invention

[0004] The first object of the present invention is to provide the application of the PUB62 gene in regulating plant resistance to geminiviruses.

[0005] The second object of the present invention is to provide a method for cultivating PUB62 gene transgenic plants.

[0006] Through previous experiments, the present invention discovered a host factor resistant to SbYLCV infection, and achieved efficient inhibition of SbYLCV and two other geminiviruses, tomato yellow leaf curl virus (TYLCV) and tomato leaf curl virus Yunnan (TLCYnV), by obtaining transgenic plants with stable overexpression, providing an important target for the prevention and control of multiple geminiviruses.

[0007] Specifically, the specific technical solutions adopted by the present invention are as follows:

[0008] Application of PUB62 gene in regulating plant resistance to geminiviruses, wherein the geminiviruses are soybean yellow leaf curl virus, tomato yellow leaf curl virus and Yunnan tomato leaf curl virus; the transcript sequence of the PUB62 gene is as shown in SEQ ID NO:1.

[0009] Specifically, by the method of Agrobacterium-mediated transformation, the NbPUB62-YFP vector with yellow fluorescent protein is introduced into the target plant, and the NbPUB62 overexpressing plant obtained can significantly reduce the infection of soybean yellow leaf curl virus, tomato yellow leaf curl virus and Yunnan tomato leaf curl virus.

[0010] A method for cultivating PUB62 transgenic plants resistant to multiple geminiviruses: by the method of Agrobacterium transformation, the PUB62 gene is introduced into the target plant to obtain N. benthamiana plants with high expression of PUB62 gene.

[0011] Specifically, it includes the following steps:

[0012] (1) Obtain N. benthamiana plants, extract RNA from the leaves of N. benthamiana plants by the Trizol method, and obtain cDNA by reverse transcription;

[0013] (2) Using N. benthamiana cDNA as a template, use the primer pair NbPUB62-F and NbPUB62-R, as shown in SEQ ID NO:2-3, for PCR amplification to obtain the NbPUB62 fragment. The primer sequences used are:

[0014] NbPUB62-F: CCTTAATTAACATGGCTTCTGAAGAAATGGG

[0015] NbPUB62-R: TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA

[0016] (3) Construct NbPUB62 onto a vector with a yellow fluorescent tag to obtain the NbPUB62-YFP recombinant plasmid;

[0017] (4) Mix 1 μg of the recombinant plasmid with 100 μL of Agrobacterium competent cells and transfer them into an electroporation cup. Transform Agrobacterium by the freeze-thaw method. After recovery culture for 2 hours, coat them on the corresponding resistant medium. After culturing at 28 °C for 48 hours, screen to obtain Agrobacterium with the NbPUB62-YFP recombinant plasmid;

[0018] (5) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus through differentiation culture, and then obtain T0 generation seedlings through rooting culture, and transfer them for continued culture;

[0019] (6) After the growth of the continuously cultured young seedlings became stable, DNA was extracted from plant leaves using the CTAB method; using the primer pair 35S-F and NbPUB62-R, as shown in SEQ ID NO:4 and SEQ ID NO:3, PCR amplification was performed with the extracted DNA as a template to determine whether the recombinant plasmid NbPUB62-YFP was successfully transformed; the primer sequences used were:

[0020] 35S-F: CCTTCGCAAGACCCTTCCTC

[0021] NbPUB62-R: TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA

[0022] Total protein was extracted from the above plant samples, SDS-PAGE gel electrophoresis was performed, and then GFP antibody was used for Western blot to determine that the plant expressed the NbPUB62-YFP recombinant protein, and T1 generation seeds were collected from the above positive tobacco plants.

[0023] (7) The infectious clones of soybean yellow leaf curl virus, tomato yellow leaf curl virus, and Yunnan tomato leaf curl virus were inoculated into NbPUB62-YFP transgenic tobacco using the Agrobacterium-mediated inoculation method to identify the disease resistance of the transgenic tobacco.

[0024] Compared with the prior art, the outstanding effect of the present invention lies in:

[0025] The present invention cloned the PUB62 gene in Nicotiana benthamiana, determined through bioinformatics analysis and molecular biology experiments that PUB62 has resistance to the infection of soybean yellow leaf curl virus, and through Agrobacterium-mediated genetic transformation, the PUB62 gene was introduced into the target plant to obtain PUB62 overexpressing transgenic plants. The obtained PUB62 transgenic plants can significantly inhibit the infection of soybean yellow leaf curl virus, and can also significantly inhibit the infection of tomato yellow leaf curl virus and Yunnan tomato leaf curl virus, which is beneficial to subsequent scientific research and field application.

[0026] The following further illustrates the application of the PUB62 gene in regulating plant resistance to geminiviruses and the method for cultivating transgenic plants according to the present invention in combination with the accompanying drawings and specific examples. Description of the Drawings

[0027] Figure 1For the construction and expression identification of the NbPUB62-YFP vector. Among them, (A) Schematic diagram of the construction of the NbPUB62-YFP vector. The CaMV 35S promoter is the cauliflower mosaic virus 35S promoter, which, as a constitutive promoter, initiates the expression of the downstream fusion gene NbPUB62 (the cloned target gene)-YFP (yellow fluorescent protein). NOS is the transcription termination site; (B) Agrobacterium tumefaciens infiltrated the RFP-H2B (the nucleus emits red light, used as a marker gene for nuclear localization) transgenic Nicotiana benthamiana with NbPUB62-YFP for 48 hours. The fluorescence of NbPUB62-YFP was observed by laser confocal microscopy. The Merge column is the overlay of YFP, RFP, and bright field; (C) Agrobacterium tumefaciens infiltrated Nicotiana benthamiana with NbPUB62-YFP. Total protein was extracted 48 hours later, and the expression level of NbPUB62-YFP in Nicotiana benthamiana leaves was analyzed by Western blot. The protein size is about 75 kDa. Mock is wild-type Nicotiana benthamiana, and Ponceau S is used to indicate the loading level.

[0028] Figure 2 For the identification of NbPUB62-YFP transgenic plants. Among them, (A) Phenotypic comparison between T1 generation NbPUB62-YFP transgenic plants and wild-type Nicotiana benthamiana plants. WT is wild-type Nicotiana benthamiana, and NbPUB62-OE-5 and NbPUB62-OE-8 are two different lines of NbPUB62-YFP transgenic Nicotiana benthamiana; (B) Fluorescence of T1 generation NbPUB62-YFP transgenic plants was observed by laser confocal microscopy.

[0029] Figure 3 For the resistance analysis of NbPUB62-YFP transgenic plants to soybean yellow leaf curl virus (SbYLCV). Among them, (A) Symptom diagrams of wild-type Nicotiana benthamiana and different lines of NbPUB62-YFP transgenic plants inoculated with SbYLCV for 9 days; (B) qPCR analysis of the accumulation of viral DNA in systemic leaves of wild-type Nicotiana benthamiana and different lines of NbPUB62-YFP transgenic plants inoculated with SbYLCV for 9 days. The results show that NbPUB62-YFP transgenic plants can significantly reduce the accumulation of SbYLCV virus.

[0030] Figure 4Analysis of the resistance of NbPUB62 - YFP transgenic plants to Tomato yellow leaf curl virus (TYLCV) and Tomato leaf curl Yunnan virus (TLCYnV). Among them, (A) and (C) are the symptom pictures of wild - type Nicotiana benthamiana and different lines of NbPUB62 - YFP transgenic plants inoculated with TYLCV (A) and TLCYnV (C) for 10 days; (B) and (D) are the qPCR analysis of the accumulation of viral DNA in the systemic leaves of wild - type Nicotiana benthamiana and different lines of NbPUB62 - YFP transgenic plants inoculated with TYLCV (B) and TLCYnV (D) for 10 days. The results show that NbPUB62 - YFP transgenic plants can significantly reduce the accumulation of TYLCV and TLCYnV viruses. Detailed implementation mode

[0031] The examples provided by the present invention are all under conventional experimental conditions.

[0032] A method for cultivating PUB62 transgenic plants resistant to multiple geminiviruses, specifically including the following steps:

[0033] (1) Obtain Nicotiana benthamiana plants, extract RNA from the leaves of Nicotiana benthamiana plants using the Trizol method, remove genomic DNA, and obtain cDNA through reverse transcription.

[0034] (2) Using the above - mentioned cDNA as a template, use the primer pair NbPUB62 - F and NbPUB62 - R, as shown in SEQ ID NO:2 - 3, for PCR amplification. After purification of the PCR product, NbPUB62 is obtained. The primer sequences used are:

[0035] NbPUB62 - F: CCTTAATTAACATGGCTTCTGAAGAAATGGG

[0036] NbPUB62 - R: TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA

[0037] (3) As shown in Figure 1 A, construct the purified NbPUB62 fragment into a vector with a yellow fluorescent tag to obtain the NbPUB62 - YFP recombinant plasmid. This recombinant vector contains the CaMV 35S promoter: the cauliflower mosaic virus 35S promoter, which can initiate the expression of the downstream fusion gene NbPUB62 - YFP, and NOS is the transcription termination site.

[0038] (4) Mix 1 μg of the recombinant plasmid with 100 μL of Agrobacterium competent cells and transfer them into an electroporation cup. Transform Agrobacterium by the freeze - thaw method, recover and culture for 2 hours, then coat them on the corresponding resistant medium, and screen for Agrobacterium carrying the NbPUB62 - YFP recombinant plasmid after culturing at 28 °C for 48 hours.

[0039] (5) Pick the positive single colony and transfer it into the liquid medium with the corresponding resistance. Incubate it overnight at 28 °C with shaking. After centrifugation of the bacterial solution, collect the thalli and resuspend the thalli with the infiltration buffer (containing 10 mM MgCl2, 10 mM MES (pH 5.6) and 100 mM acetosyringone). Adjust the bacterial solution concentration to about OD 600 = 1.0, and place it in the dark at room temperature for 2 hours. Inoculate the RFP-H2B (the nucleus emits red light and is used as a marker gene for nuclear localization) transgenic Nicotiana benthamiana plants. After 48 hours, observe the subcellular localization of NbPUB62-YFP using a laser confocal microscope. As Figure 1 shown in B, NbPUB62-YFP is localized in the nucleus. RFP-H2B is used as a marker gene for nuclear localization, and the Merge column is the overlay of YFP, RFP and bright field. Infiltrate the Nicotiana benthamiana leaves with the Agrobacterium containing the NbPUB62-YFP plasmid. After 48 hours, sample and extract the total protein, and analyze the expression level of NbPUB62-YFP in the Nicotiana benthamiana leaves by Western blot. As Figure 1 shown in C, Mock is wild-type Nicotiana benthamiana, and Ponceau S is used to indicate the loading level.

[0040] (6) Infect the tobacco leaves with the Agrobacterium carrying the recombinant plasmid, obtain callus through differentiation culture, and then obtain T0 generation seedlings through rooting culture, and transfer them for continuous culture.

[0041] (7) After the seedlings in continuous culture grow stably, take leaf samples and extract DNA using the CTAB method; use the primer pair 35S-F and NbPUB62-R, as shown in SEQ ID NO:4 and SEQ ID NO:3, and perform PCR amplification using the extracted DNA as a template to determine the transcription of the exogenous NbPUB62-YFP in the transgenic plants.

[0042] (8) Observe the NbPUB62-YFP transgenic plants positive by PCR through confocal microscopy, and observe the fluorescence of the NbPUB62-YFP transgenic plants by laser confocal microscopy. As Figure 2 shown in B, yellow fluorescence can be observed in the nuclei of both NbPUB62-OE-5 and NbPUB62-OE-8, proving the stable expression of the NbPUB62-YFP protein in the transgenic plants.

[0043] (9) Sow the wild-type Nicotiana benthamiana and the NbPUB62-YFP transgenic plant lines NbPUB62-OE-5 and NbPUB62-OE-8 of Nicotiana benthamiana, and observe that there is no obvious difference in the growth state between the transgenic PUB62 Nicotiana benthamiana and the wild-type Nicotiana benthamiana. When the plants grow to the 4-5 leaf stage, as Figure 2As shown in A, SbYLCV was inoculated respectively. The viral symptoms were observed 9 days after inoculation. For example, Figure 3 As shown in A, compared with the control, the two lines of NbPUB62-YFP transgenic plants showed milder viral symptoms. The total DNA of the systemically infected leaves was extracted, and the viral accumulation was detected by qPCR. The viral accumulation in the two transgenic lines was significantly lower than that in wild-type Nicotiana benthamiana, as Figure 3 shown in B.

[0044] (10) To test whether the NbPUB62-YFP transgenic plant lines NbPUB62-OE-5 and NbPUB62-OE-8 were resistant to other geminiviruses, the seeds were sown and the plants were grown to the 4-5 leaf stage, and then TYLCV and TLCYnV were inoculated respectively. The viral symptoms were observed 10 days after inoculation. For example, Figure 4 as shown in A and Figure 4 C, compared with the control, the two lines of NbPUB62-YFP transgenic plants showed milder viral symptoms. The total DNA of the systemically infected leaves was extracted, and the viral accumulation was detected by qPCR. The viral accumulation in the two transgenic lines was significantly lower than that in wild-type Nicotiana benthamiana, as Figure 4 shown in B and

[0045] The above experimental results showed that the Nicotiana benthamiana PUB62 overexpressing plants obtained by the Agrobacterium-mediated genetic transformation method could significantly reduce the infection of soybean yellow leaf curl virus, inhibit the diseases caused by soybean yellow leaf curl virus, and at the same time, the NbPUB62 overexpressing plants had broad-spectrum resistance to a variety of geminiviruses including tomato yellow leaf curl virus and tomato leaf curl virus in Yunnan.

[0046] The above-described embodiments are only for describing the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Overexpression PUB62 Application of the gene in positively regulating tobacco resistance to geminivirus, characterized in that: The PUB62 transcript sequence of the gene is shown in SEQ ID NO: 1; the geminivirus is soybean yellow leaf curl virus, tomato yellow leaf curl virus, and Yunnan tomato leaf curl virus; By the method of Agrobacterium-mediated genetic transformation, PUB62 the gene was constructed into a vector and introduced into tobacco for genetic transformation to obtain PUB62 transgenic tobacco with overexpression; the obtained PUB62 transgenic tobacco with overexpression can significantly inhibit the infection of soybean yellow leaf curl virus, tomato yellow leaf curl virus and Yunnan tomato leaf curl virus.

2. Method for cultivating transgenic tobacco resistant to multiple geminiviruses, characterized in that: PUB62 By means of Agrobacterium-mediated transformation, PUB62 the gene is introduced into the target plant to obtain PUB62 a transgenic Nicotiana benthamiana plant with high expression; wherein, PUB62 the transcript sequence of the gene is as shown in SEQ ID NO: 1; the geminivirus is soybean yellow leaf curl virus, tomato yellow leaf curl virus and Yunnan tomato leaf curl virus. ​ 3. The method for cultivating transgenic tobacco resistant to multiple geminiviruses according to claim 2, characterized in that PUB62 including the following steps: (1) Obtain Nicotiana benthamiana plants, extract RNA from the leaves of Nicotiana benthamiana plants using the Trizol method, and obtain cDNA by reverse transcription; (2) Using Nicotiana benthamiana cDNA as a template, use the primer pair NbPUB62-F and NbPUB62-R for PCR amplification to obtain the full-length PUB62 gene. The primer sequences used are: NbPUB62-F: CCTTAATTAACATGGCTTCTGAAGAAATGGG NbPUB62-R: TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA (3) Construct the full-length PUB62 gene onto a vector with a yellow fluorescent tag to obtain the NbPUB62-YFP recombinant plasmid; (4) Mix 1 μg of the recombinant plasmid with 100 μL of Agrobacterium competent cells, transform Agrobacterium by the freeze-thaw method, recover and culture for 2 hours, then spread on the corresponding resistant medium, and screen for Agrobacterium carrying the NbPUB62-YFP recombinant plasmid after culturing at 28°C for 48 hours; (5) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus through differentiation culture, and then obtain T0 generation seedlings through rooting culture, and transfer them for continuous culture; (6) After the growth of the continuously cultured seedlings is stable, extract DNA from tobacco leaves using the CTAB method; use the primer pair 35S-F and NbPUB62-R, and perform PCR amplification using the extracted DNA as a template to determine that the recombinant plasmid NbPUB62-YFP has been transferred into tobacco. The primer sequences used are: 35S-F: CCTTCGCAAGACCCTTCCTC NbPUB62-R: TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA Extract total protein from the above tobacco samples, perform SDS-PAGE gel electrophoresis, and determine that tobacco expresses the NbPUB62-YFP recombinant protein through Western blot. Collect T1 generation seeds from the above positive tobacco plants; (7) Use the Agrobacterium-mediated inoculation method to inoculate the infectious clones of soybean yellow leaf curl virus, tomato yellow leaf curl virus, and Yunnan tomato leaf curl virus into NbPUB62-YFP transgenic tobacco, and identify the disease resistance of the transgenic tobacco.

Images