Application of PsCLF gene in regulating endodormancy and growth of tree peony flower buds

Abstract

The present invention discloses PsCLF the application of a gene in regulating the endodormancy and growth of peony flower buds, belonging to the technical field of molecular biology. The PsCLF nucleotide sequence of the gene is shown as SEQ ID NO: 1. The application method is to promote the sprouting and growth of peony flower buds by overexpressing the PsCLF gene and inhibit the PsCLF gene to delay the sprouting and growth of flower buds. Research of the present invention shows that the PsCLF gene is related to the endodormancy of peony buds and is a candidate gene for breeding special varieties for forcing culture of peony.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to an PsCLF application of a gene in regulating endodormancy and growth of tree peony flower buds. Background Art

[0002] Tree peony ( Paeonia suffruticosa Andr.) is a traditional precious flower native to China, with high ornamental, oil, medicinal and edible values, and is the first choice for the national flower. After the tree peony blooms, buds gradually form in the axils of the leaves and flower bud differentiation occurs. By late September to mid-October, flower bud differentiation is basically completed, and the outside is covered with well-developed scales. As the day length shortens and the temperature drops, the flower buds gradually enter the dormant state, which is an endodormancy phenomenon. Under natural conditions, the bud dormancy can be induced to release after winter low temperature, and it germinates in the following spring, forms branches and blooms at the top. Research has found that the dormancy of tree peony 'Luhehong' can be completely released after 21 days of artificial low temperature at 0 - 4°C. The release of endodormancy is a prerequisite for bud germination and flowering in the following year. In warm winter years or when introducing tree peonies to the south, the flowering time and quality may be affected due to incomplete dormancy release, which affects the healthy development of the tree peony industry. At the same time, forcing cultivation (especially flower forcing during the Spring Festival) is one of the main contents of the tree peony industry, with an annual output value of about 300 million yuan. Premature release of bud dormancy is the key to successful off-season flower forcing. Exploring genes related to dormancy regulation can provide candidate genes for the breeding of special varieties for tree peony forcing cultivation, and also lay a foundation for deeply understanding the mechanism of endodormancy release and optimizing the artificial regulation technology of tree peony flowering.

[0003] Polycomb Group (PcG) proteins are a class of evolutionarily conserved epigenetic regulators, which usually modify histones of chromatin in the form of protein complexes, thereby regulating the transcription of genes in the corresponding regions and controlling development. It includes two major categories: PRC1 (Polycomb Repressive Complex 1) and PRC2.

[0004] CLF (CURLY LEAF) is an important component of the PRC2 protein complex, and is a methyltransferase with specificity for H3K27, which is involved in regulating the growth and development of plants. Through Arabidopsis clf mutant analysis, it is found that CLF it plays an important role in the process of plant growth and development, and its deletion affects the morphogenesis of flowers, fruits, leaves, etc. At present, it is not clear whether CLF regulates the release of endodormancy. Summary of the Invention

[0005] The present invention provides an PsCLF application of a gene in regulating endodormancy of tree peony flower buds.

[0006] The present invention is achieved through the following technical solutions:

[0007] PsCLF Use of a gene in regulating endodormancy and growth of tree peony flower buds, wherein PsCLF the nucleotide sequence of the gene is shown as SEQ ID NO: 1, and the application method is to promote the sprouting and growth of tree peony flower buds by overexpressing PsCLF the gene, or inhibit PsCLF the gene expression to delay the sprouting and growth of tree peony flower buds.

[0008] In the present invention, the H3K27me3 level in the flower buds of tree peony 'Luhehong' was measured during the low-temperature accumulation process. Along with the low-temperature accumulation, the H3K27me3 level gradually increased and reached the maximum value at 21 days (when endodormancy was released), suggesting that the PRC2 complex was involved in the regulation of endodormancy. Further, the expression patterns of the members of the PRC2 complex PsCLF genes were analyzed by quantitative PCR, and genetic analysis showed that PsCLF the overexpression of the gene promoted the release of endodormancy in tree peony buds, and it was a candidate gene for breeding special cultivars for forcing culture of tree peony. By silencing PsCLF the gene expression, the sprouting and growth of tree peony flower buds were delayed. Description of the Drawings

[0009] Figure 1 is a graph showing the change of H3K27me3 level during low-temperature accumulation;

[0010] Figure 2 is a phylogenetic tree diagram of PsCLF;

[0011] Figure 3 is a graph showing the expression pattern of PsCLF during low-temperature accumulation;

[0012] Figure 4 is a schematic diagram for constructing a vector for gene function analysis, a: TRV vector; b: overexpression vector;

[0013] Figure 5 PsCLF amplification and colony PCR identification, a: ORF amplification; b: colony PCR identification of overexpression vector; c: amplification of PsCLF fragment for TRV vector; d: colony PCR identification of TRV vector;

[0014] Figure 6 is a graph for PsCLF function identification, a: overexpression analysis; b: TRV silencing analysis;

[0015] Figure 7 is a graph for relative growth amount analysis, a: effect of overexpression on relative growth width; b: effect of overexpression on relative growth height, c: effect of TRV silencing on relative growth width, d: effect of TRV silencing on relative growth height;

[0016] Figure 8 It is the analysis chart of PsCLF expression level. a: TRV silencing; b: overexpression;

[0017] Figure 9 It is the analysis chart of the expression pattern of Marker gene. a: TRV silencing; b: overexpression. Specific implementation mode

[0018] Next, the technical solution of the present invention will be further explained through examples, but the protection scope of the present invention is not limited by any form of the examples.

[0019] Example 1

[0020] 1 Materials and methods

[0021] 1.1 Test materials:

[0022] Paeonia suffruticosa 'Lühehong' after low-temperature treatment for 5 - 10 days, and the apical buds were cut for gene expression and function analysis.

[0023] Escherichia coli DH5a; Agrobacterium tumefaciens EHA105.

[0024] Plasmids: TRV1, TRV2, pSuper 1300 - GFP vector or pBI121 vector.

[0025] Kan (kanamycin): Weigh 1 g of powder, dissolve it in ddH2O and make the volume up to 20 mL, filter and dispense, the concentration is 50 mg / mL.

[0026] Rif (rifampicin): Weigh 500 mg of powder, dissolve it in DMSO and make the volume up to 25 mL, filter and dispense, the concentration is 50 mg / mL.

[0027] LB medium: (10 g / L of peptone, 5 g / L of yeast extract, 10 g / L of NaCl, pH = 7.0, 1.5% agar is added to the solid medium).

[0028] 1 / 2MS medium: (825 mg / L of NH4NO3, 950 mg / L of KNO3, 220 mg / L of CaCl2·2H2O, 185 mg / L of MgSO4·7H2O, 85 mg / L of KH2PO4, 0.83 mg / L of KI, 6.2 mg / L of H3BO3, 16.9 mg / L of MnSO4·H2O, 8.6 mg / L of ZnSO4·7H2O, 0.25 mg / L of Na2MoO4·2H2O 0.25 mg / L, 0.025 mg / L of CuSO4·5H2O, 0.025 mg / L of CoCl2·6H2O, 27.8 mg / L of FeSO4·7H2O, 37.3 mg / L of Na2-EDTA, 100 mg / L of inositol, 0.5 mg / L of nicotinic acid, 0.1 mg / L of thiamine hydrochloride, 0.5 mg / L of pyridoxine hydrochloride, 2 mg / L of glycine, 30 g / L of sucrose, 7 g / L of agar, pH 5.8 - 6.0).

[0029] 1.2 Gene cloning

[0030] The AtCLF sequence was obtained using the Arabidopsis TAIR website (https: / / www.arabidopsis.org / cgi-bin / Blast / TAIRblast.pl) and blasted in the peony genome to screen for the PsCLF sequence. According to the obtained sequence information, specific PCR primers were designed, CLF-F: 5'-ATGGCGTCAACGGTCTCGC-3' (SEQ ID NO.17), CLF-R: 5'-TTATGCTAGCTTCTTAGCACGACC-3' (SEQ ID NO.18), and amplified from the buds of 'Lühehong' to obtain the PsCLF sequence. The full-length cDNA is 2679 bp, and the nucleotide sequence is shown in SEQ ID NO.1.

[0031] The amino acid sequence of PsCLF was obtained by translation using DNAMAN, and the sequence is shown in SEQ ID NO:2. Multiple sequence alignment of CLF from different species showed that PsCLF has the conserved Set domain of CLF. Furthermore, a phylogenetic tree was constructed, and PsCLF had the highest similarity with ZjCLF from jujube (as Figure 2 shown), and it was named PsCLF.

[0032] PsCLF Nucleotide sequence of the gene cDNA (SEQ ID NO.1):

[0033]

[0034] PsCLF Amino acid sequence of the gene-encoded protein (SEQ ID NO.2):

[0035] MASTVSPSVSGSDLLKDLQMKVPQDTSPTSTEILSVIDSLKEQVAANRCVFIKKRMEENRKKLANVTSHLYKSSVERKNDKPFDSDNSVDLLTKRQKDAIDMQNGVGVSNGDKDSNSSQDDGHASSAVLLGSSIAVKNTVRPIKLIEVNKLPPYTAWIFLERNQRMTEDQSVVGRRRIYYDQNGGEALICSDSEEEVIDDEEDKREFAESEDYILRMTIDEVGSSNAVLESLAHCFSRKTSEVKARYEVLIKGEKAVEDASQTLNLDKDLDAALDSFDNLFCRRCLVFDCRLHGCSQDLVFPAEKQHARSLPDEVNAPCGLHCYRLALKSENAATTSFPDNDLEDNPASLSGGAGEQISSTKKSDPSVRREKSSHSESSSSNLSDSSDSETRPSQDAISTHLSSSTPKTKLVGRSENPKRNSKRFAERVLVSKRKKQKKMTTSDSEDASSSSQKKTRSPTVGRPRRKDSSTDDNTRRLLPGDVPEGLSNVKIRDPLAFSHDDSLRKDERVDENMCKQVSSEGKSWRTIEKGLFEKGVEIFGRNSCLIARNLLSGMKTCAEVYQYMKRFENKLSGRGGGDGNSLVEGYSKGDFSETKGNEIRRRSKFLRRRGKVRRLKYSWKSAGYHSFRKRISERKDQPCRQYNPCNCQSACGKECSCHLSGTCCEKYCGCPKTCKNRFRGCHCAKSQCRSRQCPCFAANRECDPDVCRNCWIGCGDGTLGVPYQRGDNYECRNMKLLLKQQQRVLLGRSDVSGWGAFLKNNVSKHEYLGEYTGELISHREADKRGKIYDRENSSFLFNLNDQFVLDAYRKGDKLKFANHSPDPNCYAKVIMVAGDHRVGIFAKERICAGEELFYDYRYEPDRAPAWARKPEAPGTKKEDAAPSTGRAKKLA。

[0036] 1.3 Expression analysis

[0037] Extract the RNA of flower buds using the TaKaRa MiniBEST Plant RNA Extraction Kit (TaKaRa, Dalian), and synthesize the first strand of cDNA using the TaKaRa PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Dalian). Dilute the reverse-transcribed cDNA template 2.5 times as the cDNA for qRT-PCR reaction, set 3 biological replicates and 3 technical replicates, and use Actin as the internal reference (PsActin-real-F: GAGAGATTCCGTTGCCCTGA, PsActin-real-R: CTCAGGAGGAGCAACCACC), and use 2 -△△Ct methods to calculate the relative expression level. Perform quantitative analysis using the qRT-PCR kit, and analyze the expression pattern of the PsCLF gene in different low-temperature accumulation stages of peony buds ( Figure 3 ).

[0038] According to the qPCR SYBR Green Premix Pro Taq HS qPCR Kit Ⅱ (Aikerui, Hunan) kit, prepare a 20 μL reaction system. SYBR Premix Ex TaqⅡ 10 μL, forward primer (PsCLF-real-F: TGTGCGAAAAGTCAATGCCG) 10 μM 0.6 μL, reverse primer (PsCLF-real-R: AGCTCCCCACCCAGATACAT) 10 μM 0.6 μL, ddH2O 6.4 μL, cDNA 2 μL, ROX II Dye (50×) 0.4 μL. Reaction conditions: 95℃ for 10 s; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 40 cycles. The reaction is run on an Applied Biosystems QuantStudioTM 5 fluorescence quantitative PCR instrument.

[0039] 1.4 Overexpression gene function analysis

[0040] 1.4.1 Vector construction

[0041] The vector construction structure is as Figure 4 shown. Use seamless cloning primer design software to design PsCLFPrimers (Super1300-PsCLF-F: atacaccaaatcgactctagaATGGCGTCAACGGTCTCGC, Super1300-PsCLF-R: gcccttgctcaccatggtaccTTATGCTAGCTTCTTAGCACGACC) (Table 1), the open reading frame of PsCLF was amplified using Takara high-fidelity amplification enzyme Prime star, and the Super1300 vector (or pBI121 vector) was digested with restriction enzymes Xba I and Kpn I. The ORF of PsCLF was ligated to the Super1300 vector using homologous recombination enzyme, and the recombinant plasmid was transformed into Escherichia coli DH5α (Shanghai, Weidi). It was cultured overnight at 37°C, single colonies were picked for colony PCR identification, the positive strains were sent to the company (Shanghai, Sangon) for sequencing, the correct recombinant plasmid was transformed into Agrobacterium tumefaciens EHA105 (Shanghai, Weidi), cultured at 28°C for 48 h, and colony PCR identification was carried out to obtain the target strain, which was stored at -80°C with glycerol for later use ( Figure 5 );

[0042] Table 1 Primer sequence information used in the present invention

[0043] .

[0044] 1.4.2 Preparation of peony flower buds

[0045] From November 15th to 30th, healthy, consistent, plump and firm terminal flower buds were cut from the dormant peony 'Lühehong' plants as materials. The outer 1 - 2 layers of bud scales were removed, and the buds were rinsed with tap water for 40 - 60 min. Then transferred to 0.1% dishwashing liquid solution and soaked for 10 min, rinsed with running water for 15 min to remove the remaining dishwashing liquid. Then transferred to a laminar flow hood for further disinfection. First, disinfected with 75% alcohol for 20 s, rinsed once with sterile distilled water, then disinfected with 0.1% mercuric chloride for 10 min, and rinsed 4 - 5 times with sterile distilled water for later use.

[0046] 1.4.3 Preparation of infection solution

[0047] Single colonies of Super1300 and Super1300- PsCLF were picked and inoculated into 50 mL tubes containing 10 mL LB liquid medium (added with antibiotics Kan + Rif), and shaken at 200 rpm and 28°C overnight. Diluted 1:50 or 1:100 into 100 mL LB liquid medium containing Kan + Rif antibiotics (500 mL Erlenmeyer flask), and shaken at 200 rpm and 28°C overnight until the OD value reached 1.0 - 1.2.

[0048] Centrifuge at 5000 rpm for 10 min, discard the supernatant, suspend the precipitate in infection buffer (10 mM MgCl2, 10 mM MES and 100 mM acetosyringone, pH = 5.6), adjust OD600≈1.0, and let it stand at 25 °C for 3 h for infecting the peony flower buds.

[0049] 1.4.4 Infecting flower buds

[0050] On the ultra-clean workbench, immerse the treated peony flower buds into the prepared infection solution. Place the beaker in the vacuum pump, connect the vacuum pump, evacuate to -0.07 MPa, hold for 5 min, and slowly release the air; repeat 3 times.

[0051] After infection, rinse the flower buds with sterilized distilled water 2 - 3 times, inoculate them onto the co-culture medium (1 / 2MS + 100 mM acetosyringone), and culture them in the dark at 8 °C for 3 d. Then transfer the flower buds to the selection medium (1 / 2MS + ticarcillin), and culture them under light at 25 °C (16 h light / 8 h dark). Extract RNA after 5 days of light culture, and detect the gene expression level by qRT-PCR. Observe and record the flower bud growth parameters from 10 - 30 days ( Figure 6 , Figure 7 ).

[0052] 1.4.5 Gene expression analysis and phenotypic identification

[0053] Dormancy release and sprouting status were evaluated by relative growth amount ( Figure 7 ). Measure the height (H PsCLF ) and width (W x ) of the flower buds of the control Super1300 (Mock) and Super1300- x (OE-CLF) respectively, where x represents the number of days of light culture after infection, and the relative growth amount R width = (W x - W0) / W0; R height = (H x - H0) / H0. At 14 d, the relative growth width of Super1300- PsCLF was 2.83 times that of the control, and at 28 d it was 3.05 times that of the control; at 14 d, the relative growth height was 1.61 times that of the control, and at 28 d it was 1.7 times that of the control. It can be seen that overexpression of PsCLF promoted the sprouting and growth of flower buds.

[0054] RNA extraction, reverse transcription, and qPCR analysis of the transformed flower buds were the same as in 1.3. Using the transformed flower buds of Super1300 as the control, the relative expression levels of the Super1300- PsCLF middle PsCLF gene ( Figure 8 ) were detected using a qRT-PCR kit (SYBR Green Premix Pro Taq HS qPCR Kit Ⅱ, Hunan, Aikerui) to calculate the transformation efficiency. PsCLF-OE-1, OE-2, OE-3 The expression levels were significantly higher than those of the control, and overexpression was successful. Three of these lines were selected for further analysis of the expression changes of marker genes related to dormancy release, CYCD , EBB3 , BG9 . The expressions of all three genes were significantly higher than those of the control (quantitative primers: PsCYCD-real-F: GAGGCCGTGGATTGGATTCT, PsCYCD-real-R: AAAAGGGGCACTTGGGTCTC; PsEBB3-real-F: GGTGAGATTACTCCGCCACC, PsEBB3-real-R: CGACCCTGAATCTGAGACCG; PsBG9-real-F: TCATCTTCGCTCCGATGCTC, PsBG9-real-R: TCGGCCACAACTATGTCCAC.) ( Figure 9 ). It can be seen that PsCLF is a positive regulatory gene for dormancy release.

[0055] Example 2: Analysis of the function of silenced genes

[0056] 1.1 Vector construction

[0057] According to the gene-specific sequence retrieved from the SGN VIGS Tool (https: / / vigs.solgenomics.net / ?tdsourcetag=s_pctim_aiomsg), specific primers were designed (PsCLF-TRV2-F: gtgagtaaggttaccgaattcATTGATTC TTTGAAGGAACAAGTTGC, PsCLF-TRV2-R: cgtgagctcggtaccggatccGACAGCA ATACTAGATCCTAGAAGAACTG) (Table 1) to amplify the specific sequence of PsCLF . Using Eco R I and BamHI linearized TRV2 and performed a ClonExpress® II recombination reaction (ClonExpress® II One Step Cloning Kit) with the amplified band to obtain recombinant plasmid DNA. According to the vector construction and transformation steps in 1.4.1, construct TRV2- PsCLF vector and transform it into Agrobacterium tumefaciens EHA105.

[0058] Amplify the PsCLF fragment using specific primers and detect whether the band size meets the expectation by gel electrophoresis ( Figure 5 ). According to the seamless cloning method, recombine the target band with the TRV2 vector, transform the recombinant plasmid into Escherichia coli DH5ɑ strain, and identify the target monoclonal by colony PCR combined with sequencing. Extract the recombinant plasmid TRV2- PsCLF and transform it into Agrobacterium tumefaciens EHA105. Spread the transformed bacteria on LB medium containing Kan and Rif to identify the target clone for standby ( Figure 5 ).

[0059] 1.2 Preparation and infection of peony flower buds

[0060] The preparation of peony flower buds, the preparation of the infection solution, the infection of flower buds, gene expression analysis and phenotypic identification were the same as those in 1.4.2 - 1.4.5 of Example 1.

[0061] qPCR analyzed the PsCLF expression changes in the transformed flower buds. Among the 8 flower buds detected, 6 PsCLF showed a significant decrease in expression level, and the silencing effect was better ( Figure 8 ). The growth of the transformed flower buds was observed. Silencing PsCLF led to a slowdown in the germination and growth of flower buds ( Figure 6 , Figure 7 ). At 14 days of cultivation, the flower buds elongated slightly, the small leaves did not expand. The height growth of the flower buds with PsCLF silencing was 45.3% of the control, and the width growth was 38.9% of the control; at 28 days, the expansion of the small leaves of the flower buds was still not obvious, the height growth was 63.8% of the control, and the width growth was 37.8% of the control. It can be seen that silencing PsCLF delayed the dormancy release and growth of peony flower buds.

[0062] Select 3 lines with better silencing effects, PsCLF - TRV - 3, PsCLF - TRV - 4, PsCLF - TRV - 6, and analyze the expression levels of dormancy release - related genes using real - time quantitative PCR. As Figure 9 shown, it was found that silencing PsCLF significantly inhibited the dormancy release - related genes CYCD , EBB3 , BG9expressions such as. Further proved that PsCLF is a positive regulator of dormancy release.

Claims

1. A gene that regulates dormancy and growth in peony flower buds, characterized in that: The gene is PsCLF,PsCLF The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. Use of the gene according to claim 1 in regulating internal dormancy and growth of peony flower buds, characterized in that: The method of application is through overexpression PsCLF Gene, promotes the germination and growth of peony flower buds.

Images