Primer group and method for SMN1 and SMN2 gene amplification and sequence variation detection

Abstract

The invention relates to the field of molecular biology diagnosis, in particular to a detection kit for SMN1 and SMN2 gene sequence variation, and gene variation types mainly comprise SMN1 and SMN2 gene point variation, insertion and deletion variation in a gene range and the like. The kit provided by the invention can realize detection and diagnosis of SMN1 and SMN2 point variation, small insertion and deletion, sequence variation of SMN1-SMN2 partial transformation types, structural recombination in genes and the like.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological diagnosis, and in particular relates to a detection kit for SMA gene mutation. Background Art

[0002] Spinal muscular atrophy (SMA) is the most common autosomal recessive neuromuscular disease in children, with an incidence of approximately 1 / 6000 to 1 / 10,000. SMA is characterized by muscle weakness and atrophy caused by degeneration of the anterior horn motor neurons of the spinal cord. The progression of the disease leads to abnormalities in the skeletal system, respiratory system, digestive system and other systems, severe involvement of motor function, and gradual loss of independent living ability. Severe patients die of respiratory failure. According to the age of onset and clinical manifestations, it is divided into type I (severe), type II (intermediate), type III (mild) and type IV (adult). Clinical diagnosis is made based on the age of onset, clinical manifestations and degree of disease progression. At the same time, relevant auxiliary examination methods including electromyography, muscle enzymes and muscle biopsy can be used to confirm the diagnosis, combined with family history and SMN1 gene analysis.

[0003] SMA-related genes include survival motor neuron 1 (SMN1) and survival motor neuron 2 (SMN2). Both are located in a complex inverted segment duplication region - 5q13. The SMN1 gene located on the telomeric side of 5q13 is the pathogenic gene of SMA disease, with a total length of about 27Kb and 9 exons (1, 2a, 2b, 3-8). The SMN2 gene located on the centromere side is a disease-modifying gene, which is highly homologous to the SMN1 gene, and the sequence homology of the two genes on the genome is as high as 99.9%. With the development of SMA in treatment, clinical management and prognosis assessment, the role of the SMN2 gene has been further recognized.

[0004] The genotype of 90%-95% of SMA patients is caused by homozygous deletion of SMN1 biallelic exon 7 and / or 8, and about 5% is caused by compound heterozygous mutation of SMN1 gene, that is, one allele is completely deleted and the other allele has a minor pathogenic mutation. There are 4 positive modification sites in SMN2 gene: c.835-1897C>T, c.835-549A>G, c.835-44A>G and c.859G>C, which can modify the phenotype of the disease, which means that patients with the above SMN2 sequence variation have a relatively mild phenotype. Therefore, the sequence variation of SMN1 and SMN2 genes plays an extremely important role in the genetic diagnosis of SMA disease and its phenotypic prediction.

[0005] Since the sequences of SMN1 and SMN2 genes are highly homologous, it is challenging to accurately distinguish the sequences of the two genes. Currently, there are several main methods that have some defects: (1) RT-PCR combined with cloning sequencing is used to identify SMN1 gene point mutations, but RNA samples are relatively unstable, the detection range of cloning technology is limited, and the operation is cumbersome and time-consuming, so it is not easy to achieve a standardized detection process. (2) LR-PCR (Long Range PCR) mainly designs primers for the E8 differential site to specifically amplify the SMN1 gene, and then performs a second PCR amplification and sequencing on different exons to confirm the location of the SMN1 gene point mutation. Therefore, the current defect of this technology is that the amplification range of LR-PCR is limited to the 28Kb range of SMN1 and SMN2 genes, and it is difficult to clearly identify sequence problems outside the amplified gene range. Therefore, it is necessary to seek a new method for detecting SMN1 and SMN2 gene mutations to simultaneously and specifically amplify the two genes and simplify the operation process. (3) Both next-generation sequencing (NGS) and targeted third-generation sequencing require the construction of sequencing libraries for the SMN1 and SMN2 genes. The process is complicated and the cost is relatively high.

[0006] LR-PCR technology takes advantage of long read length, can directly span the complete LR-PCR amplicon and retain phase information, and can more accurately identify two homologous genes. The present invention uses a primer combination of 9 primers + GAP primers for ultra-long fragment amplification using this method, and the primer combination can detect SMN1 and SMN2 gene point mutations and small insertions and deletions, SMN1-SMN2 partial conversion type sequence mutations and intragenic structural recombination. Summary of the invention

[0007] The present invention provides a primer set and method for detecting sequence variations of SMN1 and SMN2 genes. The method uses a primer combination of 9 primers for ultra-long fragment amplification + GAP primer. The primer combination can simultaneously detect point variations and small insertions and deletions of SMN1 and SMN2 genes, sequence variations of SMN1-SMN2 partial conversion types, and intragenic structural recombination.

[0008] Specifically, the present invention relates to a set of SMN1 and SMN2 gene long fragment LR-PCR primer combinations, and the primer combinations are as follows:

[0009] a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN1, including

[0010] SEQ ID No.1: TCAAGTGTCTGCTCACCTCAGCCTCTG,

[0011] SEQ ID No.2:GCATGAGTCACCACGCCTGGTTCACAAT,

[0012] SEQ ID No.3:TGGTGAGCGATGGTGGTAGGTAAAACC,

[0013] as well as

[0014] SEQ ID No.4: CCACCGTGCTGGCCTCCCACCCCCACAC;

[0015] b) Nested PCR primers SEQ ID No. 11-26.

[0016] On the other hand, the present invention also relates to a set of LR-PCR primer combinations for detecting sequence variations of SMN1-SMN2 partial conversion types, characterized in that the primer combination is as follows:

[0017] a) primers for amplifying the approximately 27 Kb gene segment of the SMN1-SMN2 partial conversion genotype, including

[0018] SEQ ID No.5:GTTGGGGGATCAAATATCTTCTAGTGTT;

[0019] SEQ ID No. 6: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGT;

[0020] SEQ ID No.7: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGTA;

[0021] as well as

[0022] SEQ ID No.8:GTATGTTTCTTCCACATAACCAACCAGTT;

[0023] b) Nested PCR primers SEQ ID No. 11-26.

[0024] On the other hand, the present invention also relates to a set of LR-PCR primer combinations for clearly amplifying the structural recombination of the SMN1 gene, characterized in that the primer combination is as follows:

[0025] a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN1, including

[0026] SEQ ID No.1: TCAAGTGTCTGCTCACCTCAGCCTCTG,

[0027] SEQ ID No.2:GCATGAGTCACCACGCCTGGTTCACAAT,

[0028] SEQ ID No.3:TGGTGAGCGATGGTGGTAGGTAAAACC,

[0029] as well as

[0030] SEQ ID No.4: CCACCGTGCTGGCCTCCCACCCCCACAC;

[0031] b) Nested PCR primers SEQ ID No.9 and SEQ ID No.10.

[0032] On the other hand, the present invention also relates to a set of LR-PCR primer combinations for detecting SMN2 gene sequence variation, characterized in that the primer combination is as follows:

[0033] a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN2, including

[0034] SEQ ID No.1: TCAAGTGTCTGCTCACCTCAGCCTCTG,

[0035] SEQ ID No.2:GCATGAGTCACCACGCCTGGTTCACAAT,

[0036] SEQ ID No.3:TGGTGAGCGATGGTGGTAGGTAAAACC,

[0037] as well as

[0038] SEQ ID No.27: CCACCGTGCTGGCCTCCCACCCCCACAT;

[0039] b) Nested PCR primers SEQ ID No. 11-26.

[0040] On the other hand, the present invention also relates to a set of nested PCR primer combinations for SMN1 and SMN2 genes, characterized in that the primer combinations are as follows:

[0041] a) Nested PCR primers SEQ ID No. 11-26, and / or

[0042] b) Nested PCR primers SEQ ID No. 9-10.

[0043] On the other hand, the present invention also relates to a set of SMN1 and SMN2 gene long fragment LR-PCR primer combinations, characterized in that it includes a combination of any two, three or four of the aforementioned primer combinations.

[0044] Furthermore, the present invention also relates to a kit, characterized in that the kit includes a detection kit, the components of which include an AS-LR-PCR reaction solution, an SMN1 primer mixture, an SMN2 primer mixture, and a DNA polymerase; the SMN1 and SMN2 primer mixtures contain any of the aforementioned primer combinations. The SMN1 primers are a primer combination of SEQ ID No. 1-4, 5-8, 9-10 and / or 11-26; preferably SEQ ID No. 1-4 and 11-26, or SEQ ID No. 5-8 and 11-26, or SEQ ID No. 1-4 and 9-10. The SMN2 primers are a primer combination of SEQ ID No. 1-3, 27 and 11-26.

[0045] The AS-LR-PCR reaction solution contains an enhancer, which includes one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.

[0046] Furthermore, the present invention also relates to the use of any one of the aforementioned primer combinations or any one of the aforementioned kits in the preparation of a spinal muscular atrophy-related gene nucleic acid detection kit.

[0047] More specifically, the present invention relates to a set of SMN1 and SMN2 gene long fragment LR-PCR primer combinations, as follows:

[0048] SEQ ID No.1: TCAAGTGTCTGCTCACCTCAGCCTCTG,

[0049] SEQ ID No.2:GCATGAGTCACCACGCCTGGTTCACAAT,

[0050] SEQ ID No.3:TGGTGAGCGATGGTGGTAGGTAAAACC,

[0051] SEQ ID No.4: CCACCGTGCTGGCCTCCCACCCCCACAC;

[0052] SEQ ID No.5:GTTGGGGGATCAAATATCTTCTAGTGTT;

[0053] SEQ ID No. 6: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGT;

[0054] SEQ ID No.7:GCTCTTTATTGTGAAAGTATGTTTCTTCCACGTA;

[0055] SEQ ID No.8:GTATGTTTCTTCCACATAACCAACCAGTT;

[0056] SEQ ID No.9:TATTTGAGAGACTGAGGCAGGAGAA;

[0057] SEQ ID No.10:CACCTGTTCTAACCCCATCCCAATA

[0058] SEQ ID No.11:GCGAGGCTCTGTCTCAAAAACA

[0059] SEQ ID No.12:GATCGACTTGATGCTGTCCCGA

[0060] SEQ ID No.13:CACATAACCTCTAACCAGGTAA

[0061] SEQ ID No.14:GGAGGATATCACCTGATTTAACT

[0062] SEQ ID No.15:GGTGTATGATGCCTTTAAGAGCAGTTT

[0063] SEQ ID No.16:CTTCTCCCTGCCTTCCATTCACA

[0064] SEQ ID No.17:GCACCATACGCATTTTATCTC

[0065] SEQ ID No.18:GAAACTTGGCTTTCATTTTCATTC

[0066] SEQ ID No.19:TTCAATTTCTGGAAGCAGAGA

[0067] SEQ ID No.20:CAAAAGTTTCATGGGAGAGC

[0068] SEQ ID No.21:GACTTCAGGATTTGGTACATGA

[0069] SEQ ID No.22:CCCAAGGGATGTTCTACAATGAC

[0070] SEQ ID No.23: CAACATAGCAAGACCTCGTCT

[0071] SEQ ID No.24: TGCAAGAGTAATTTAAGCCTCAGA

[0072] SEQ ID No.25: GCTCCAGGTCTCAAGTGAT

[0073] SEQ ID No.26: GTGCAGTATGCCTAGGTTAT

[0074] SEQ ID No.27: CCACCGTGCTGGCCTCCCACCCCCACAT;

[0075] in,

[0076] SEQ ID No.1 / 2 / 3 and SEQ ID No.4 amplified a genomic fragment (>31Kb) covering the full length of SMN1. On this basis, nested PCR was performed using SEQ ID No.11-26 primers to detect sequence variations within the amplified range of the gene, including point variations, small insertions and deletions, etc. The characteristic of SEQ ID No.4 primer is that mismatched bases are introduced at the penultimate position of the 3' end, and the GC content is increased at the 5' end, making the amplification more specific.

[0077] SEQ ID No.5 and SEQ ID No.6 / 7 / 8 can amplify the gene segment (about 27Kb) of the SMN1-SMN2 partial conversion genotype. On this basis, nested PCR is performed using SEQ ID No.11-26 primers to detect sequence variations of the SMN1-SMN2 partial conversion type.

[0078] Based on the amplification of SEQ ID No.1 / 2 / 3 and SEQ ID No.4, SEQ ID No.9 and SEQ ID No.10 can be used to nestedly amplify the region where the SMN1 gene has a large fragment deletion, so as to clarify the structural recombination of the SMN1 gene within the amplification range (such as the 8978bp del mediated by the Alu element, etc.).

[0079] SEQ ID No.1 / 2 / 3 and SEQ ID No.27 amplified a genomic fragment (>31Kb) covering the full length of SMN2. On this basis, nested PCR was performed using primers SEQ ID No.11-26 to detect sequence variations within the amplified range of the gene, including point variations, small insertions and deletions.

[0080] Furthermore, the present invention also relates to a kit, which includes a detection kit, and its components include AS-LR-PCR reaction solution, SMN1 primer mixture, SMN2 primer mixture, and DNA polymerase; the SMN1 and SMN2 primer mixtures contain primer combinations of SEQ ID No.1-4, 5-8, 9-10 and / or 11-26; preferably, SEQ ID No.1-4 and 11-26, or SEQ ID No.5-8 and 11-26, or SEQ ID No.1-4 and 9-10. The SMN2 primers are primer combinations of SEQ ID No.1-3, 27 and 11-26.

[0081] Furthermore, the present invention also relates to the use of the SMN1 and SMN2 gene AS-LP-PCR primer combination in the preparation of a spinal muscular atrophy-related gene nucleic acid detection kit, characterized in that: the detection kit comprises components including AS-LR-PCR reaction solution, SMN1 and SMN2 primer mixture, and DNA polymerase;

[0082] The SMN1 and SMN2 primer mixtures contain primer combinations of SEQ ID No. 1-10, 27;

[0083] The AS-LR-PCR reaction solution contains an enhancer, and the enhancer includes one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.

[0084] In summary, the present invention has verified, through primer effect verification and clinical sample verification, that it can specifically amplify gene fragments of SMN1 and SMN2, effectively eliminate the interference of homologous genes, and realize the detection of point mutations, small insertions and deletions, sequence mutations of SMN1-SMN2 partial conversion types, and intragenic structural recombination of SMN1 and SMN2 genes.

[0085] Based on the embodiments of the present invention, it is shown that the primer set, kit, and method of the present invention have at least achieved the following obvious beneficial technical effects:

[0086] (1) Wide detection range. The present invention can detect all point mutations, small deletions and insertions of SMN1 and SMN2 genes within the amplification range; can detect sequence mutations of the SMN1-SMN2 partial conversion type; and can detect intragenic structural recombination, such as Alu-mediated large fragment deletions.

[0087] (2) A single kit can detect multiple mutation types. Traditional methods require a detection system for each mutation type, while the primer system of the present invention can simultaneously detect multiple mutations, including point mutations, small deletions and insertions, and intragenic recombination, etc., which is a convenient, fast, and low-cost method.

[0088] (3) The sample is more stable. The template used for PCR can be genomic DNA extracted from peripheral blood, etc. The collection process and sample storage are easier and more stable than RNA, which can ensure the smooth progress of the experiment.

[0089] (4) Higher accuracy. The two full-length genes are amplified for the specific sites of SMN1 and SMN2, and the sequences of both are sequenced. The sequence results obtained can verify each other, ultimately making the test results more reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] Figure 1 This indicates that in normal individuals (SMN1:SMN2=2:2), the SMN1 gene and SMN2 gene can be specifically amplified after AS-LR-PCR of SMN1 and SMN2.

[0091] Note: The base peaks in the red boxes in the upper and lower figures are the specific sites of exon 7 of SMN1 and SMN2 genes (c.840C and c.840T) respectively.

[0092] Figure 2 It showed that in patients with SMN1 compound heterozygous mutations (SMN1:SMN2=1:2), the two genes could be specifically amplified after AS-LR-PCR of SMN1 and SMN2, and point mutations (c.835G>C; p.Gly279Arg) were simultaneously detected to occur in the SMN1 gene, but not the SMN2 gene.

[0093] Note: The first red box in the above and below figures indicates that the base change c.835G>C (p.Gly279Arg) occurs in the SMN1 gene, not the SMN2 gene; the base peaks shown in the second red box in the above and below figures are the specific sites of exon 7 of the SMN1 and SMN2 genes (c.840C and c.840T), respectively.

[0094] Figure 3 It showed that in patients with SMN1 compound heterozygous mutations (SMN1:SMN2=1:2), the two genes could be specifically amplified after AS-LR-PCR of SMN1 and SMN2, and the deletion mutation (c.835-17_835-14del) was simultaneously detected to occur in the SMN1 gene, but not the SMN2 gene.

[0095] Note: The first red vertical and horizontal lines in the upper and lower figures indicate that the c.835-17_835-14del deletion mutation occurs in the SMN1 gene, not the SMN2 gene; the base peaks shown in the two red boxes in the upper and lower figures are the specific sites of exon 7 of the SMN1 and SMN2 genes (c.840C and c.840T), respectively.

[0096] Figure 4 It showed that in patients with SMN1 compound heterozygous mutations (SMN1:SMN2=1:2), the two genes could be specifically amplified after AS-LR-PCR of SMN1 and SMN2, and the insertion mutation (c.651-652dupAC) was simultaneously detected to occur in the SMN1 gene, but not the SMN2 gene.

[0097] Note: The first red horizontal and vertical lines in the upper and lower figures indicate that the c.651-652dupAC insertion mutation occurred in the SMN1 gene, not the SMN2 gene; the base peaks shown in the two red boxes in the upper and lower figures are the specific sites of exon 7 of the SMN1 and SMN2 genes (c.840C and c.840T), respectively.

[0098] Figure 5 It showed that in patients with compound heterozygous mutations accompanied by partial SMN1-SMN2 transformation (SMN1:SMN2=1:2), the SMN1 gene could not be specifically amplified after LR-PCR in previous reports; after amplification with this set of primers, the SMN1 gene could be specifically amplified, and the SMN1 point mutation (c.683T>A, p.Leu228*) was clarified.

[0099] Note: The two red boxes in the upper figure show that the SMN1 gene exons 5 and 7 showed non-specific heterozygous peaks after LR-PCR in previous reports, and the two red boxes in the lower figure show that the SMN1 gene exons 5 and 7 showed point mutations (c.683T>A, p.Leu228*) and their specific difference sites (c.840C) after SMN1-AS-LR-PCR in this group.

[0100] Figure 6 It showed that the SMN1 gene could be specifically amplified in patients with SMN1 gene deletion (SMN1:SMN2=1:3) after SMN1-AS-LR-PCR, and a large fragment deletion of the gene (chr5:70936243-70954220,8978bp-Del) was detected simultaneously.

[0101] Note: The red line on the left is the breakpoint region of the large deletion of the SMN1 gene, and the base peak shown in the red box on the right is the specific site of exon 7 of the SMN1 gene (c.840C).

[0102] Figure 7 It showed that the control individuals (SMN1:SMN2=2:2) could specifically amplify both SMN2 and SMN1 genes after AS-LR-PCR, and simultaneously detected the c.632G>A mutation occurring in the SMN2 gene, but not the SMN1 gene.

[0103] Note: The red boxes on the left side of the above and below figures indicate that the mutation occurs in the SMN2 gene, not the SMN1 gene; the base peaks shown in the red boxes on the right side of the above and below figures are the specific sites of exon 7 of the SMN2 and SMN1 genes (c.840T and c.840C), respectively.

[0104] Figure 8 It was shown that this individual (SMN1:SMN2=1:2) could specifically amplify both SMN1 and SMN2 genes after AS-LR-PCR, and simultaneously detected the c.*3+183C>T mutation occurring in the SMN2 gene, but not the SMN1 gene, ultimately ruling out the genetic diagnosis of SMA.

[0105] Note: The base peaks shown in the red boxes on the left side of the above and below figures are the specific sites of exon 7 of the SMN1 and SMN2 genes (c.840C and c.840T), respectively. The red boxes on the right side of the above and below figures indicate that the mutation did not occur in the SMN1 gene, but in the SMN2 gene. DETAILED DESCRIPTION

[0106] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0107] Example 1: Primer design and effect verification

[0108] The present invention designs a group of new AS-LR-PCR primer combinations, as follows:

[0109] SEQ ID No.1: TCAAGTGTCTGCTCACCTCAGCCTCTG,

[0110] SEQ ID No.2:GCATGAGTCACCACGCCTGGTTCACAAT,

[0111] SEQ ID No.3:TGGTGAGCGATGGTGGTAGGTAAAACC,

[0112] SEQ ID No.4: CCACCGTGCTGGCCTCCCACCCCCACAC;

[0113] SEQ ID No.5:GTTGGGGGATCAAATATCTTCTAGTGTT;

[0114] SEQ ID No.6:GCTCTTTATTGTGAAAGTATGTTTCTTCACACGT;

[0115] SEQ ID No.7:GCTCTTTATTGTGAAAGTATGTTTCTTCCACGTA;

[0116] SEQ ID No.8:GTATGTTTCTTCCACATAACCAACCAGTT;

[0117] SEQ ID No.9:TATTTGAGAGACTGAGGCAGGAGAA;

[0118] SEQ ID No.10:CACCTGTTCTAACCCCATCCCAATA

[0119] SEQ ID No.11:GCGAGGCTCTGTCTCAAAAACA

[0120] SEQ ID No.12:GATCGACTTGATGCTGTCCCGA

[0121] SEQ ID No.13:CACATAACCTCTAACCAGGTAA

[0122] SEQ ID No.14:GGAGGATATCACCTGATTTAACT

[0123] SEQ ID No.15:GGTGTATGATGCCTTTAAGAGCAGTTT

[0124] SEQ ID No.16:CTTCTCCCTGCCTTCCATTCACA

[0125] SEQ ID No.17:GCACCATACGCATTTTATCTC

[0126] SEQ ID No.18:GAAACTTGGCTTTCATTTTCATTC

[0127] SEQ ID No.19:TTCAATTTCTGGAAGCAGAGA

[0128] SEQ ID No.20:CAAAAGTTTCATGGGAGAGC

[0129] SEQ ID No.21:GACTTCAGGATTTGGTACATGA

[0130] SEQ ID No.22: CCCAAGGGATGTTCTACAATGAC

[0131] SEQ ID No.23: CAACATAGCAAGACCTCGTCT

[0132] SEQ ID No.24: TGCAAGAGTAATTTAAGCCTCAGA

[0133] SEQ ID No.25: GCTCCAGGTCTCAAGTGAT

[0134] SEQ ID No.26: GTGCAGTATGCCTAGGTTAT

[0135] SEQ ID No.27: CCACCGTGCTGGCCTCCCACCCCCACAT;

[0136] in,

[0137] SEQ ID No.1 / 2 / 3 and SEQ ID No.4 amplified a genomic fragment (>31Kb) covering the full length of SMN1. On this basis, nested PCR was performed using SEQ ID No.11-26 primers to detect sequence variations within the amplified range of the gene, including point variations, small insertions and deletions, etc. The characteristic of SEQ ID No.4 primer is that mismatched bases are introduced at the penultimate position of the 3' end, and the GC content is increased at the 5' end, making the amplification more specific.

[0138] SEQ ID No.5 and SEQ ID No.6 / 7 / 8 can amplify the gene segment (about 27Kb) of the SMN1-SMN2 partial conversion genotype. On this basis, nested PCR is performed using SEQ ID No.11-26 primers to detect sequence variations of the SMN1-SMN2 partial conversion type.

[0139] Based on the amplification of SEQ ID No.1 / 2 / 3 and SEQ ID No.4, SEQ ID No.9 and SEQ ID No.10 can be used to nestedly amplify the region where the SMN1 gene has a large fragment deletion, so as to clarify the structural recombination of the SMN1 gene within the amplification range (such as the 8978bp del mediated by the Alu element, etc.).

[0140] SEQ ID No.1 / 2 / 3 and SEQ ID No.27 amplified a genomic fragment (>31Kb) covering the full length of SMN2. On this basis, nested PCR was performed using primers SEQ ID No.11-26 to detect sequence variations within the amplified range of the gene, including point variations, small insertions and deletions.

[0141] The present invention uses normal individual DNA with a copy number of SMN1 and SMN2 of 2:2 to specifically amplify the full-length SMN1 and SMN2 genes, and then further performs secondary nested PCR on the amplified products, and sequences the E7 sequence. By observing the specific amplified bases of the E7 differential sites, the primers and amplification conditions for the long-fragment PCR amplification of the SMN1 and SMN2 genes are finally determined. The amplification conditions are as follows: the reaction system is prepared according to the following Table 1 to amplify the genomic DNA sample extracted from peripheral blood:

[0142]

[0143] On the PCR instrument, amplification was performed according to the conditions shown in Table 2 below:

[0144]

[0145] After amplification, the results showed that the SMN1 and SMN2 genes were effectively amplified using different samples as templates. Using normal samples (SMN1:SMN2=2:2) as the object, the gene segments covering the full-length SMN1 and SMN2 genes were successfully amplified using LR-PCR specific primers. Among them, the base peaks shown in the red boxes in the upper and lower figures are the specific sites of exon 7 of the SMN1 and SMN2 genes (c.840C and c.840T) ( Figure 1 ).

[0146] Figure 2 The results showed that patients with compound heterozygous SMN1 mutations (SMN1:SMN2=1:2) could specifically amplify the two genes after AS-LR-PCR of SMN1 and SMN2, and simultaneously detected point mutations (c.835G>C; p.Gly279Arg) in the SMN1 gene, but not in the SMN2 gene. Among them: the first red box in the upper and lower figures indicates that the base change of c.835G>C (p.Gly279Arg) occurs in the SMN1 gene, but not in the SMN2 gene; the base peaks shown in the second red box in the upper and lower figures are the specific sites of exon 7 of the SMN1 and SMN2 genes (c.840C and c.840T), respectively.

[0147] Figure 3The results showed that patients with compound heterozygous SMN1 mutations (SMN1:SMN2=1:2) could specifically amplify the two genes after AS-LR-PCR of SMN1 and SMN2, and simultaneously detected the deletion mutation (c.835-17_835-14del) in the SMN1 gene, but not the SMN2 gene. Among them: the first red vertical line and horizontal line in the upper and lower figures indicate that the c.835-17_835-14del deletion mutation occurs in the SMN1 gene, but not the SMN2 gene; the base peaks in the two red boxes in the upper and lower figures are the specific sites of exon 7 of the SMN1 and SMN2 genes (c.840C and c.840T), respectively.

[0148] Figure 4 The results showed that the SMN1 compound heterozygous mutation patients (SMN1:SMN2=1:2) could specifically amplify the two genes after AS-LR-PCR of SMN1 and SMN2, and simultaneously detected the insertion mutation (c.651-652dupAC) in the SMN1 gene, but not in the SMN2 gene. Among them: the first red horizontal and vertical lines in the upper and lower figures indicate that the c.651-652dupAC insertion mutation occurred in the SMN1 gene, but not in the SMN2 gene; the base peaks in the two red boxes in the upper and lower figures are the specific sites of exon 7 of the SMN1 and SMN2 genes (c.840C and c.840T), respectively.

[0149] Figure 5 The results showed that the patients with compound heterozygous mutations with partial SMN1-SMN2 conversion (SMN1:SMN2=1:2) failed to specifically amplify the SMN1 gene after LR-PCR in previous reports; after amplification with this group of primers, the SMN1 gene could be specifically amplified, and the SMN1 point mutation (c.683T>A, p.Leu228*) was identified. Among them: the two red boxes in the upper figure show that the SMN1 gene exons 5 and 7 showed non-specific heterozygous peaks after LR-PCR in previous reports, and the two red boxes in the lower figure show that the SMN1 gene exons 5 and 7 showed the SMN1 gene point mutation (c.683T>A, p.Leu228*) and its specific difference site (c.840C) after SMN1-AS-LR-PCR in this group.

[0150] Figure 6 The results showed that the SMN1 gene could be specifically amplified in patients with SMN1 gene deletion (SMN1:SMN2=1:3) after SMN1-AS-LR-PCR, and a large deletion of the gene (chr5:70936243-70954220,8978bp-Del) was detected simultaneously. The red line on the left is the breakpoint of the large deletion of the SMN1 gene, and the base peak in the red box on the right is the specific site of exon 7 of the SMN1 gene (c.840C).

[0151] Figure 7 The results show that the control individuals (SMN1:SMN2=2:2) can specifically amplify the two genes after AS-LR-PCR of SMN2 and SMN1, and simultaneously detect that the c.632G>A mutation occurs in the SMN2 gene, but not the SMN1 gene. The red boxes on the left of the upper and lower figures indicate that the mutation occurs in the SMN2 gene, not the SMN1 gene; the base peaks in the red boxes on the right of the upper and lower figures are the specific sites of exon 7 of the SMN2 and SMN1 genes (c.840T and c.840C), respectively.

[0152] Figure 8 It shows that this individual (SMN1:SMN2=1:2) can specifically amplify two genes after AS-LR-PCR of SMN1 and SMN2, and simultaneously detect that the c.*3+183C>T mutation occurs in the SMN2 gene, not the SMN1 gene, and finally excludes the genetic diagnosis of SMA. Among them: the base peaks shown in the red boxes on the left side of the upper and lower figures are the specific sites of exon 7 of the SMN1 and SMN2 genes (c.840C and c.840T), respectively, and the red boxes on the right side of the upper and lower figures indicate that the mutation does not occur in the SMN1 gene, but in the SMN2 gene.

[0153] Example 2 Clinical sample detection

[0154] The peripheral blood genomic DNA of 32 subjects was collected as validation samples, and various variations of SMN1 and SMN2 genes were detected by the method (and kit) of the present invention combined with Sanger sequencing, referring to Example 1. The results of RT-clone sequencing or third-generation sequencing were used as controls, and the results obtained by the present invention were compared with the control results. The results are shown in Table 3 below, and the results of the 32 samples are completely consistent.

[0155] Table 3.

[0156]

[0157]

[0158] Therefore, the results detected by the method of the present invention can reach 100% consistency after comparison with the results of RT-cloning sequencing or third-generation sequencing. The exact location of the point mutation of all samples was determined by the method of the present invention.

[0159] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A set of LR-PCR primer combinations for detecting SMN1 gene sequence variation, characterized in that: The primer combination for detecting SMN1 gene sequence variation is characterized in that the primer combination is as follows: a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN1, including SEQ ID No.1: TCAAGTGTCTGCTCACCTCAGCCTCTG, SEQ ID No.2: GCATGAGTCACCACGCCTGGTTCACAAT, SEQ ID No.3:TGGTGAGCGATGGTGGTAGGTAAAACC, as well as SEQ ID No.4: CCACCGTGCTGGCCTCCCACCCCCACAC; b) Nested PCR primers SEQ ID No. 11-26.

2. A set of LR-PCR primer combinations for detecting sequence variations of SMN1-SMN2 partial conversion types, characterized in that: The primer combinations are as follows: a) primers for amplifying the approximately 27 Kb gene segment of the SMN1-SMN2 partial conversion genotype, including SEQ ID No.5:GTTGGGGGATCAAATATCTTCTAGTGTT; SEQ ID No. 6: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGT; SEQ ID No.7: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGTA; as well as SEQ ID No.8:GTATGTTTCTTCCACATAACCAACCAGTT; b) Nested PCR primers SEQ ID No. 11-26.

3. A set of LR-PCR primer combinations for clearly amplifying the structural recombination of the SMN1 gene within the range, characterized in that: The primer combinations are as follows: a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN1, including SEQ ID No.1: TCAAGTGTCTGCTCACCTCAGCCTCTG, SEQ ID No.2: GCATGAGTCACCACGCCTGGTTCACAAT, SEQ ID No.3:TGGTGAGCGATGGTGGTAGGTAAAACC, as well as SEQ ID No.4: CCACCGTGCTGGCCTCCCACCCCCACAC; b) Nested PCR primers SEQ ID No.9 and SEQ ID No.

10.

4. A set of LR-PCR primer combinations for detecting SMN2 gene sequence variation, characterized in that: The primer combinations are as follows: a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN2, including SEQ ID No.1: TCAAGTGTCTGCTCACCTCAGCCTCTG, SEQ ID No.2: GCATGAGTCACCACGCCTGGTTCACAAT, SEQ ID No.3:TGGTGAGCGATGGTGGTAGGTAAAACC, as well as SEQ ID No.27: CCACCGTGCTGGCCTCCCACCCCCACAT; b) Nested PCR primers SEQ ID No. 11-26.

5. A set of nested PCR primer combinations for SMN1 and SMN2 genes, characterized in that: The primer combinations are as follows: a) Nested PCR primers SEQ ID No. 11-26, and / or b) Nested PCR primers SEQ ID No. 9-10.

6. A set of SMN1 and / or SMN2 gene long fragment LR-PCR primer combinations, characterized in that: It comprises a combination of any two, three or four of the primer combinations of claims 1-5.

7. A kit, characterized in that: The kit comprises a detection kit, the components of which include AS-LR-PCR reaction solution, SMN1 primer mixture, SMN2 primer mixture, and DNA polymerase; the SMN1 and SMN2 primer mixtures contain the primer combination of any one of claims 1-6.

8. The kit according to claim 6, characterized in that The AS-LR-PCR reaction solution contains an enhancer.

9. A kit according to any one of claims 6-7, characterized in that The enhancer includes one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.

10. The kit according to any one of claims 6-7, characterized in that The SMN1 primers are a primer combination of SEQ ID No. 1-4, 5-8, 9-10 and / or 11-26; preferably SEQ ID No. 1-4 and 11-26, or SEQ ID No. 5-8 and 11-26, or SEQ ID No. 1-4 and 9-10, and the SMN2 primers are a primer combination of SEQ ID No. 1-3, 27 and 11-26.

11. Use of the primer combination according to any one of claims 1 to 6 or the kit according to any one of claims 7 to 10 in preparing a nucleic acid detection kit for spinal muscular atrophy-related genes.

Images