Primer, kit, detection method and application for simultaneous detection of duck and donkey meat-derived components

Abstract

The present invention belongs to the field of animal species origin identification, and specifically relates to primers, kits, detection methods, and applications for the simultaneous detection of duck or donkey meat-derived ingredients. The present invention designs a universal primer pair suitable for isothermal amplification and a CRISPR-Cas12a duck- or donkey-derived specific crRNA primer set. By utilizing the RPA / CRISPR-Cas12a detection system in conjunction with nucleic acid detection test strips, these two meat-derived ingredients can be rapidly identified. The embodiments of the present invention demonstrate that the product designed by the present invention is simple to use, does not require professional expertise, is low-cost, and produces readable reaction results, making it highly suitable for on-site testing.

Description

Technical Field

[0001] The present invention belongs to the field of animal species origin identification, and particularly relates to a primer, a kit, a detection method and an application for simultaneously detecting duck and donkey meat-derived components. Background Art

[0002] High-quality animal DNA testing plays an increasingly important role in animal forensic identification.

[0003] Meat source identification technology has evolved from morphological and protein-based methods to nucleic acid testing. my country has issued a series of national standards for nucleic acid testing of animal-derived ingredients, including PCR, real-time fluorescence PCR, and Sanger sequencing, providing a basis for the identification of animal-derived ingredients. However, these methods require high technical expertise and equipment, are expensive, time-consuming, and require specialized technicians, making them unsuitable for on-site analysis.

[0004] Therefore, the combination of RPA and CRISPR-Cas12a technology has gradually demonstrated its advantages of high efficiency, rapidity and specificity, providing a new method for on-site identification of meat-derived ingredients. Currently, the most widely used isothermal amplification technology includes loop-mediated isothermal amplification detection technology (LAMP). There have been some reports on the use of LAMP technology for animal meat source detection, such as the use of a constant temperature amplification primer set and its kit that can simultaneously detect pork and duck meat-derived ingredients (patent application number: 201610880177.4) and a rapid detection method and kit for donkey-derived ingredients in food (patent application number: 201910290775.X). However, the design of LAMP primer pairs is complex and contains six gene primers, which is not suitable for efficient multi-species identification.

[0005] Therefore, there is an urgent need in the market for a meat source identification method that is low-cost and can efficiently detect multiple species. Summary of the Invention

[0006] The purpose of the present invention is to provide a primer, a kit, a detection method and a reference for detecting duck or donkey meat-derived components. The method provided by the present invention can not only efficiently and rapidly detect duck or donkey meat-derived components specifically, but also has low detection cost and high sensitivity.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides a Cas12a-crRNA primer for detecting duck or donkey meat-derived components, wherein the Cas12a-crRNA primer for detecting duck meat-derived components is shown in the sequence listing SEQ ID NO.1; the Cas12a-crRNA primer for detecting donkey meat-derived components is shown in the sequence listing SEQ ID NO.2.

[0009] Preferably, the Cas12a-crRNA primer can specifically recognize the DNA sequences of duck and donkey; the DNA of the duck is shown in the sequence list SEQ ID NO.5; the DNA of the donkey is shown in the sequence list SEQ ID NO.6.

[0010] The present invention also provides an RPA isothermal amplification primer set for amplifying common poultry and livestock nucleic acids, comprising a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4.

[0011] The present invention also provides an RPA-CRISPR / Cas12a kit for detecting duck or donkey meat-derived components, wherein the kit comprises the Cas12a-crRNA primer and the primer set.

[0012] The present invention also provides the use of the above-mentioned Cas12a-crRNA primer or the above-mentioned primer or the above-mentioned kit in detecting duck or donkey meat-derived components.

[0013] The present invention also provides a method for detecting duck or donkey meat-derived components, which specifically comprises the following steps:

[0014] S1, extracting DNA from the sample to be tested;

[0015] S2, using the DNA obtained in step S1 as a template, performing RPA nucleic acid isothermal amplification reaction using RPA primers;

[0016] S3, adding the amplified product to the CRISPR-Cas12a reaction system; the CRISPR-Cas12a detection system includes the Cas12a-crRNA primer and reporter;

[0017] S4. Determine whether the sample contains duck or donkey meat-derived ingredients by detecting the reporter.

[0018] Preferably, the CRISPR-Cas12a detection system in step S3 further comprises the RPA reaction product of step S1 and the CRISPR / Cas12a protein, and the reporter sequence is TTATTT, the 5' end of the sequence is labeled with modified fluorescein FAM, and the 3' end is labeled with biotin.

[0019] Preferably, the RPA nucleic acid isothermal amplification reaction conditions in step S2 are a constant temperature of 39° C. for 20 minutes, and then the reaction is terminated; the CRISPR-cas12a reaction conditions in step S3 are a constant temperature of 45° C. for 10 minutes, and then the reaction is terminated.

[0020] Preferably, the reporter detection method in step S4 may be fluorescence detection or test strip detection.

[0021] The colloidal gold nucleic acid test strip used in the colloidal gold nucleic acid test strip detection method of the present invention includes: a sample pad, a binding pad containing a complex of colloidal gold nanoparticles Au-NP-fluorescein FAM-labeled antibody, a T line coated with streptavidin for capturing biotin, a C line coated with goat anti-mouse IgG for capturing colloidal gold nanoparticles, and an absorption pad for attracting liquid through the test strip.

[0022] More preferably, the test result of the colloidal gold nucleic acid test strip is determined as follows: if the quality control C line has a band and the test T line has no band, the target gene is contained; if both the test T line and the quality control C line have red bands, the target gene is not contained.

[0023] Beneficial effects of the present invention:

[0024] 1. It is beneficial to construct universal primers with specific sequences in the middle of the mitochondria at both ends of common poultry and livestock, facilitating rapid isothermal amplification of multiple species.

[0025] 2. The selected sequence fragments are short, about 230bp, which are suitable for fresh, processed, and slightly degraded duck and donkey-derived ingredients, and are more suitable for real-world situations.

[0026] 3. RPA isothermal amplification has a fast reaction speed, simple primer design, and low reaction temperature, making it more suitable for on-site use.

[0027] 4. Construct the CRISPR-Cas12a system primer crRNA based on the mitochondrial intermediate-specific sequence to specifically identify duck and donkey meat-derived ingredients.

[0028] 5. The present invention combines the respective advantages of RPA isothermal amplification and CRISPR-Cas12a system to construct a method for rapid on-site detection of animal-derived components, exploring new approaches for the detection of other animal-derived components. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0030] Figure 1 This is the colloidal gold nucleic acid test strip test result for ducks;

[0031] Figure 2 This is the test result of donkey's colloidal gold nucleic acid test strip. DETAILED DESCRIPTION

[0032] The present invention utilizes RPA technology and mainly relies on three enzymes: recombinase that can bind to single-stranded nucleic acids (oligonucleotide primers), single-stranded DNA binding protein (SSB) and chain displacement DNA polymerase. The mixture of these three enzymes is also active at room temperature. Generally, a detectable level of amplification product is obtained in about 20 minutes, with the advantages of simple primer design, naked eye reading results, and low reaction temperature. Combined with the specific recognition binding and nucleic acid cleavage ability of the CRISPR-Cas12a system, the target nucleic acid sequence can be cut by the cis and trans cleavage activity of the Cas12a protein, thereby improving detection specificity and avoiding interference from non-specific amplification products; improving detection sensitivity and secondary amplification of the detection signal.

[0033] The present invention provides an RPA / CRISPR-cas12a primer set for detecting duck or donkey meat-derived components.

[0034] The crRNA sequence of Cas12a is composed of two parts: a repeat sequence at the 5' end and a complementary sequence spacer of the target gene sequence at the 3' end. Its fixed stem-loop structure sequence (epeat) is 5'-UAAUUUCUACUAAGUGUAGAU-3'.

[0035] Using the benchling platform constructed by Zhang Feng's team, specific crRNA was designed on the 12s rDNA screening gene sequence on duck or donkey mitochondria, with a PAM sequence (TTTV) upstream.

[0036] crRNA primer for detecting duck meat-derived components (crRNA 1): UAAUUUCUACUAAGUGUAGAU-GGUGCAUCUUGUGCUUGCGACA (SEQ ID NO. 1)

[0037] According to the sequence listing rules ST.26, U in the sequence listing file is represented by T.

[0038] crRNA primers for detecting donkey meat-derived ingredients (crRNA2):

[0039] UAAUUUCUACUAAGUGUAGAU-GUAUGGGUCUUUGACACGCU(SEQ ID NO.2)

[0040] According to the sequence listing rules ST.26, U in the sequence listing file is represented by T.

[0041] Universal primer pairs for amplifying sequences from poultry and livestock:

[0042] The upstream primer sequence (12s rDNA F) is: 5'-AGGGTTGGTAAATCTCGTGCCAGCCACCG-3'; (SEQ ID NO. 3)

[0043] The downstream primer sequence (12s rDNA R) is: 5'-TTTAGGGCCAGGCATAGTGGGGTATCTAATC-3'; (SEQ ID NO. 4)

[0044] The present invention extracts 12s rDNA from the mitochondria of 11 animals (real-time mitochondrial screening is carried out in 11 animals with interspecies conservation at both ends and species-specific sequences in the middle) and undergoes RPA reaction to obtain the RPA product (target), which is then combined with the designed crRNA, Cas12aProtein and Reporter to form a CRISPR / Cas12a reaction system.

[0045] In the CRISPR / Cas12a detection system, the sequence of the Cas12a cleavage substrate (Reporter) is TTATTT, the 5' end is labeled with modified fluorescent FAM, and the 3' end is labeled with biotin.

[0046] The Cas12a protein first binds to the crRNA to form a Cas12a-crRNA complex, which recognizes and binds to the target DNA through the PAM sequence (TTTV). The crRNA spacer region performs base-pairing with the target DNA sequence. The crRNA-target DNA hybridization triggers a huge conformational change in Cas12a, resulting in the activation of single-stranded cleavage of the Cas12a protein, which can then cut single-stranded DNA. When the reporter is cut, FAM separates from biotin.

[0047] The reaction product was mixed with the test strip assay diluent at a ratio of 1:10 and applied dropwise to the sample pad. The reaction system contained a mixture of the Au-NP-anti-FAM-FAM complex, Au-NP-anti-FAM, and biotin. Streptavidin was unable to capture the Au-NP-anti-FAM-FAM complex and Au-NP-anti-FAM, resulting in no band at the T line. However, goat anti-mouse IgG was able to capture the Au-NP-anti-FAM-FAM complex and Au-NP-anti-FAM, resulting in a band at the C line.

[0048] In negative samples, since there is no reporter DNA cleavage, the reaction system contains the Au-NP-anti-FAM-FAM-biotin complex and Au-NP-anti-FAM. When the reaction system flows to the T line, the Au-NP-anti-FAM-FAM-biotin complex is captured by streptavidin to form a band, while at the C line, the Au-NP-anti-FAM is captured by goat anti-mouse IgG to form a band.

[0049] The specific DNA sequence for a duck or donkey is as follows:

[0050] Duck (DNA 1):

[0051] AGGGTCCGGTAAATCTTGTGCCAGCCACCGCGGTCATACAAGAGACCCA

[0052] AATCAACTGTCCTACAAGCGGCGTAAAGAGTGGTAAGATGCCTATCCT

[0053] ACCTAACTAAGATCAAAATGCAACTAAGCTGTCGCAAGCACAAGATGC

[0054] ACCTAAACACACCATCAAGATGATCTTAGAAACTAGCGATTAATTTGAA

[0055] CCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAA(SEQ IDNO.5)

[0056] Donkey (DNA2):

[0057] AGGGTTGGTAAAATTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAATTAATAAACCCTCCGGCGTAAAGCGTGTCAAAGACCCATACTAAAATAAAGTTAAAACCCAGTTAAGCTGTAAAAAGCTACAACCAAAGTAAAATAAACTACGAAAGTGACTTTAATATCTCTGACCACACGATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAA (SEQ ID NO. 6)

[0058] In an embodiment of the present invention, a colloidal gold nucleic acid test strip is used to detect duck or donkey meat-derived components in a sample. The test strip includes: a sample pad, a binding pad (containing a complex of colloidal gold nanoparticles (Au-NP) and a fluorescein FAM-labeled antibody), a T line (coated with streptavidin for capturing biotin-labeled DNA), a C line (coated with goat anti-mouse IgG for capturing colloidal gold nanoparticles), and an absorption pad (for attracting liquid through the test strip).

[0059] Positive reaction: Upon detecting the target nucleotide amplified by RPA, Cas12a initiates single-strand cleavage, cleaving the reporter DNA labeled with FAM and biotin. When the reporter is cleaved, FAM dissociates from biotin, resulting in a mixture of the Au-NP-anti-FAM-FAM complex, Au-NP-anti-FAM, and biotin in the reaction system. At line T, streptavidin cannot capture the Au-NP-anti-FAM-FAM complex and Au-NP-anti-FAM, resulting in no band at line T. However, goat anti-mouse IgG captures the Au-NP-anti-FAM-FAM complex, forming a band at line C. In a negative sample, since no reporter DNA is cleaved, the reaction system contains the Au-NP-anti-FAM-FAM-biotin complex and Au-NP-anti-FAM. When the reaction system reaches line T, the Au-NP-anti-FAM-FAM-biotin complex is captured by streptavidin, forming a band, while at line C, the Au-NP-anti-FAM is captured by goat anti-mouse IgG, forming a band.

[0060] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0061] In the present invention, chickens (Gallus Gallus), ducks (Anas platyrhynchos), geese (Anser cygnoides), cattle (Bos taurus), pigs (Sus scrofa), sheep (Ovis aries), horses (Equus caballus), rabbits (Oryctolagus cuniculus), and donkeys (Equus asinus) were purchased from Guangzhou farmers' markets. Cats (Felis catus) and dogs (Canis lupus familiaris) were provided by Guangzhou Pet Hospital.

[0062] Unless otherwise specified, the production processes, experimental methods or detection methods involved in the embodiments of the present invention are all conventional methods in the prior art, and their names and / or abbreviations are conventional names in the field and are very clear and unambiguous in the relevant fields of use. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment to implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0063] The various instruments, equipment, raw materials or reagents used in the embodiments of the present invention are not particularly limited in their sources and are all conventional products that can be purchased through regular commercial channels or prepared according to conventional methods well known to those skilled in the art.

[0064] Example 1 Design of universal primers

[0065] Mitochondrial genome information for donkeys and ducks was searched in NCBI. The target genomes were downloaded and saved in .FASTA format. Mitochondrial genome information was analyzed and sequence alignment was performed using MegAlign. Finally, the 12s rDNA gene was selected as the target gene sequence for RPA / CRISPR-Cas12a detection of duck and donkey-derived components.

[0066] The 12s rDNA genes of 11 species of chicken (Gallus Gallus), duck (Anas platyrhynchos), goose (Anser cygnoides), cattle (Bos taurus), pig (Sus scrofa), sheep (Ovis aries), horse (Equus caballus), rabbit (Oryctolagus cuniculus), donkey (Equus asinus), cat (Felis catus), and dog (Canis lupus familiaris) were imported into MegAlign for multiple sequence alignment, and sequences with interspecies conservation at both ends and species-specificity in the middle were selected.

[0067] PrimerPremier5 software was used to design amplification primers for the conserved regions at both ends of the 12s rDNA gene screening sequence on the above-mentioned meat mitochondria.

[0068] The universal primer sequences used to amplify species sequences are:

[0069] The upstream primer sequence was: 5′-AGGGTTGGTAAATCTCGTGCCAGCCACCG-3′;

[0070] The downstream primer sequence was: 5′TTTAGGGCCAGGCATAGTGGGGTATCTAATC-3′;

[0071] Oligo7 software and NCBI-Blast were used to verify the designed primers for amplifying the conserved regions at both ends of mitochondrial 12S rDNA.

[0072] 1. Primer structure analysis: Reduce the formation of dimers between primers, keep ΔG less than 4.8 kcal / mol, and keep the 3-dimer less than 2; do not combine more than 3 base pairs;

[0073] 2. Prevent the formation of hairpin structures (△G) not exceeding 4.5kcal / mol (preferably <2), and the number of combined base pairs should not exceed 3;

[0074] 3. The GC content is generally between 40% and 60%, and the GC content of upstream and downstream primers should not differ too much;

[0075] 4. Tm is generally between 59 and 68°C, with similar values ​​between upstream and downstream. The Tm of the product is < 94.

[0076] Design of Example 2crRNA sequence

[0077] The crRNA sequence of Cas12a is composed of two parts: the repeat sequence (stem-loop structure) at the 5' end and the complementary sequence spacer of the target gene sequence at the 3' end.

[0078] Using the benchling platform constructed by Zhang Feng's team, specific crRNA was designed on the 12s rDNA screening gene sequence on duck or donkey mitochondria, with a PAM sequence (TTTV) upstream.

[0079] A fixed stem-loop structure sequence was added upstream of the designed crRNA: 5'-UAAUUUCUACUAAGUGUAGAU-3'.

[0080] The crRNA primers used to detect duck meat-derived ingredients are:

[0081] UAAUUUCUACUAAGUGUAGAU-GGUGCAUCUUGUGCUUGCGACA

[0082] The crRNA primers used to detect donkey meat-derived ingredients are:

[0083] UAAUUUCUACUAAGUGUAGAU-GUAUGGGUCUUUGACACGCU

[0084] Verify sequence specificity: Input the designed duck and donkey PAM and spacer into NCBI-Blast. First, match the target species, duck and donkey, and then the non-target species. Observe the identity of the match. If the match is less than 18 nt, the non-target species can be excluded. (A mismatch of at least three bases with the non-target region is preferred.)

[0085] Verify the stability of the sequence: Enter the crRNA and its upstream stem-loop structure in the RNAWebSuite website to ensure that the stem-loop structure is not destroyed and the spacer region is easy to open; detect the GC content of the crRNA sequence in the sg.idtdna website, preferably 40-60%, to ensure stability.

[0086] Example 3 Design of colloidal gold nucleic acid test strips

[0087] Sample pad

[0088] The conjugate pad contains a complex of colloidal gold nanoparticles (Au-NP) and fluorescein FAM-labeled antibody.

[0089] T-wires coated with streptavidin for capturing biotinylated DNA

[0090] Line C is coated with goat anti-mouse IgG for capturing colloidal gold nanoparticles

[0091] The absorbent pad is used to draw liquid through the test strip.

[0092] Example 4 DNA extraction

[0093] Use the Kit Purification of Total DNA from Animal Tissues (Spin-Column Protocol) from Qiagen to add 180ul ATL and 20ul proteinase K to 0.025g of tissue, mix well, lyse at 56°C, add 200ul AL and mix well, and add 200ul ethanol and mix well.

[0094] Add all the mixed materials to a DNeasy Mini spin column in a 2ml collection tube. Centrifuge at high speed for 1 minute. Discard the liquid and collection tube. Place the tube in a new 2ml collection tube and add 500µl of AW1. Centrifuge at high speed for 1 minute, then discard the liquid and collection tube. Place the tube in a new 2ml collection tube and add 500µl of AW2. Centrifuge at high speed for 3 minutes, then discard the liquid and collection tube. Add 200µl of AE, incubate at room temperature for 1 minute, centrifuge at high speed for 1 minute, place the tube in a new 1.5ml centrifuge tube, add 200µl of AE, incubate at room temperature for 1 minute, and centrifuge at high speed to obtain the DNA extract.

[0095] The OD260 / OD280 value of the DNA extract was determined by UV spectrophotometer to be 1.8-2.1.

[0096] Example 5 RPA reaction

[0097] For RPA reaction, operate the reagents on ice, mix well and centrifuge before use. The amount of RPA system reagents used in the experiment should be prepared according to Table 1:

[0098] Table 1 RPA reaction system

[0099]

[0100] Add 10X Starter to the tube cap. Add the above liquid to the recombinase, single-stranded DNA binding protein (SSB), and strand-displacing DNA polymerase freeze-dried solution containing the single-stranded nucleic acid (oligonucleotide primer) required for the RPA reaction. After a quick centrifugation, place the tube in a 39°C PCR instrument and allow to react for 20 minutes. After 5 minutes, remove the 8-tube strip, invert completely 8-10 times to mix, and briefly centrifuge. Then, return the tube to the PCR instrument and continue the reaction until complete.

[0101] Example 6 CRISPR-Cas12a reaction

[0102] The RPA product (target) obtained in Example 1 was added to the CRISPR-Cas12a reaction system, and the amounts of CRISPR-Cas12a reaction system experimental reagents were proportioned according to Table 2:

[0103] Table 2 CRISPR-Cas12a reaction system

[0104]

[0105]

[0106] Centrifuge the CRISPR-Cas12a system thoroughly to mix. Place the tube in a PCR instrument at 45°C and allow to react for 10 minutes.

[0107] After the reaction, centrifuge thoroughly and combine with colloidal gold nucleic acid test strips for detection: Mix the detection diluent and CRISPR-Cas12a system reaction product in a 10:1 ratio and centrifuge. Add more than 50 μL of the diluted reaction solution dropwise onto the sample pad and read the result within five minutes.

[0108] Example 7 Colloidal Gold Nucleic Acid Test Paper Result Interpretation

[0109] Positive reaction: Cas12a initiates transcriptional cleavage upon detecting the target nucleotide amplified by RPA, cleaving the reporter labeled with FAM and biotin. As a CRISPR / Cas12a detection system, the Cas12a cleavage substrate sequence is TTATTT, with the 5' end labeled with modified fluorescein FAM and the 3' end labeled with biotin.

[0110] When the reporter is cleaved, FAM separates from biotin, resulting in a mixture of the Au-NP-anti-FAM-FAM complex, Au-NP-anti-FAM, and biotin in the reaction system. Streptavidin cannot capture the Au-NP-anti-FAM-FAM complex and Au-NP-anti-FAM at the T line, resulting in no band at the T line. However, goat anti-mouse IgG can capture the band at the C line.

[0111] In negative samples, since there is no reporter DNA cleavage, the reaction system contains the Au-NP-anti-FAM-FAM-biotin complex and Au-NP-anti-FAM. When the reaction system flows to the T line, the Au-NP-anti-FAM-FAM-biotin complex is captured by streptavidin to form a band, while at the C line, the Au-NP-anti-FAM is captured by goat anti-mouse IgG to form a band.

[0112] (1) Interpretation of duck-derived results Figure 1-2 As shown:

[0113] The negative control (water) had C and T lines developed;

[0114] Negative control: Other samples (chicken, goose, cattle, pig, sheep, horse, rabbit, donkey, cat, dog) have C and T line color development;

[0115] Positive result: Duck-derived components only show color on the C line.

[0116] (2) Interpretation of donkey-derived results:

[0117] The negative control (water) had C and T lines developed;

[0118] Negative control: Other samples (chicken, duck, goose, cattle, pig, sheep, horse, rabbit, cat, dog) have C and T line color development;

[0119] Positive result: Donkey-derived components only show color on line C.

[0120] This shows that duck-derived components and donkey-derived components can be specifically detected.

[0121] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. An RPA-CRISPR / Cas12a kit for detecting duck and donkey meat-derived ingredients, characterized in that: The kit includes Cas12a-crRNA and RPA nucleic acid isothermal amplification primer sets for detecting duck and donkey meat-derived components; The Cas12a-crRNA for detecting duck meat-derived components is shown in the sequence list as SEQ ID NO. 1; the Cas12a-crRNA for detecting donkey meat-derived components is shown in the sequence list as SEQ ID NO. 2; The RPA nucleic acid isothermal amplification primer set includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.

4.

2. Use of the kit according to claim 1 in detecting duck and donkey meat-derived components.

3. A method for detecting duck and donkey meat-derived ingredients, characterized in that: The specific steps include: S1, extracting DNA from the sample to be tested; S2. Using the DNA obtained in step S1 as a template, perform an RPA nucleic acid isothermal amplification reaction using the RPA nucleic acid isothermal amplification primer set according to claim 1; S3. Adding the amplified product to a CRISPR / Cas12a detection system; the CRISPR / Cas12a detection system comprises the Cas12a-crRNA and reporter for detecting duck and donkey meat-derived components according to claim 1; S4. Determine whether the sample contains duck and donkey meat-derived ingredients by detecting the reporter.

4. The method according to claim 3, characterized in that The CRISPR / Cas12a detection system in step S3 further includes CRISPR / Cas12a protein; the reporter sequence is TTATTT, the 5' end of the sequence is labeled with modified fluorescein FAM, and the 3' end is labeled with biotin Biotin.

5. The method according to claim 3, characterized in that: The reaction conditions for the RPA nucleic acid isothermal amplification in step S2 are: constant temperature at 39° C. for 20 minutes; the reaction conditions for the CRISPR / Cas12a detection system in step S3 are: constant temperature at 45° C. for 10 minutes.

6. The method according to claim 4, characterized in that: The method for detecting the reporter in step S4 is colloidal gold nucleic acid test strip detection; the colloidal gold nucleic acid test strip includes: a sample pad, a binding pad containing a complex of colloidal gold nanoparticles Au-NP-fluorescein FAM-labeled antibody, a detection T line coated with streptavidin for capturing biotin, a quality control C line coated with goat anti-mouse IgG for capturing colloidal gold nanoparticles, and an absorption pad for attracting liquid through the test strip.

7. The method according to claim 6, characterized in that The test results are judged as follows: if there is a band on the quality control C line but no band on the test T line, it is a positive sample; if both the test T line and the quality control C line have red bands, it is a negative sample.

Images