A method, apparatus, and application for simultaneously detecting aroA1, aroA2, and aroA3.

Abstract

This invention discloses a method, apparatus, and application for the simultaneous detection of aroA1, aroA2, and aroA3. A sample tube is simultaneously irradiated with an 808nm external coaxial reflective LED light source. The photosensitizer CsYF4@Yb2O3, phototriggered, provides photoelectrons and heat to the LAMP process. The target gene serves as a template to initiate the amplification reaction, yielding a large amount of double-stranded DNA product. Signal probes are obtained by modifying CsYF4@Yb2O3 with nucleic acid strands. The detection area of ​​the photothermal detection paper captures the amplification product and signal probes in a sandwich configuration, providing a photothermal temperature change signal positively correlated with the amplification product content. The aroA1, aroA2, and aroA3 in the sample are quantified based on this temperature change signal. This invention utilizes the photoactive properties of the photosensitizer CsYF4@Yb2O3 to generate photoelectrons and photothermal effects, enabling rapid temperature control and direct molecular-level contact with the amplification system before photothermal detection, significantly improving photothermal efficiency.

Description

Technical Field

[0001] This invention relates to a method, apparatus, and application for simultaneously detecting aroA1, aroA2, and aroA3, belonging to the field of testing and inspection technology. Background Technology

[0002] Herbicide resistance genes are those genes that enable plants to survive treatment with specific herbicides. These genes are typically introduced into crops using transgenic technology, conferring resistance to specific herbicides. This helps simplify field management and reduce labor costs. Detecting herbicide resistance genes helps verify whether transgenic crops have successfully acquired herbicide resistance traits, thereby ensuring their effectiveness and safety in field management. Furthermore, genetic testing can help breeders optimize breeding strategies and provide regulatory agencies with scientific evidence to assess the safety and compliance of transgenic crops.

[0003] Detection methods for herbicide resistance genes are mainly based on nucleic acid amplification, including polymerase chain reaction (PCR) and isothermal amplification. Because PCR amplification is time-consuming and dependent on professional personnel and equipment, it is not suitable for rapid on-site detection. Loop-mediated isothermal amplification (LAMP) technology can rapidly amplify the target nucleic acid under isothermal conditions (usually 60℃~65℃) using strand displacement DNA polymerase (such as Bst DNA polymerase) and a set of specific primers, through self-circulating strand displacement DNA synthesis. LAMP technology uses four specific primers designed for six specific regions of the target gene: FIP (forward inner primer), BIP (reverse inner primer), F3 (forward outer primer), and B3 (reverse outer primer). These primers play a crucial role in the amplification reaction, ensuring the specificity and efficiency of the amplification. The LAMP amplification process mainly consists of two stages: Initiation stage: In this stage, both the inner and outer primers participate in the reaction, binding to specific regions of the target DNA and extending under the action of DNA polymerase to form a double dumbbell DNA structure. This structure provides a template for subsequent cyclic amplification. Cyclic amplification phase: In this phase, only the inner primer participates in the reaction. The inner primer continuously generates new stem-loop DNA products through strand displacement DNA synthesis. These products can then serve as templates to participate in the reaction, thereby achieving exponential amplification of the target sequence.

[0004] Phototriggered amplification (LAMP) involves adding a photosensitizer to the amplification system and using a light-emitting diode (LED) or laser as the light source. The photothermal material is uniformly dispersed in the amplification system, and excitation by the LED can potentially provide energy for nucleic acid amplification. Currently, there are no reports of simultaneous LAMP amplification of multiple genes using phototriggered amplification technology. The challenges of using photosensitizer-mediated, phototriggered LAMP lie in the need for photosensitizers with higher activity, the operational difficulties in ensuring the photosensitizer is compatible with the LAMP system and does not interfere with the reaction, the need for precisely controllable light sources and phototriggered conditions to avoid affecting amplification stability, and the need to develop highly sensitive and specific detection methods.

[0005] External coaxial reflective LED light sources differ significantly from other LED light sources in several aspects, primarily in structural design, light characteristics, application scenarios, and optical efficiency. External coaxial reflective LED light sources mainly consist of a side-emitting light source and a beam splitter. The light emitted by the light source first passes through the beam splitter and is then reflected parallel to the object being measured. Other LED light sources, such as ring light sources, strip light sources, and linear light sources, have different structural designs, but typically do not include a beam splitter. For example, a ring light source directly illuminates the top of the object being measured, while a strip light source provides various illumination effects such as direct, oblique, and metering illumination. Due to its beam splitter design, the external coaxial reflective LED light source can uniformly illuminate the object's surface after passing through the beam splitter, reducing interference caused by shadows and reflections. Simultaneously, this type of light source usually has high brightness and uniformity, highlighting the object's shape and contours. While other LED light sources also possess their own light characteristics—for example, ring light sources can solve the problem of diagonal illumination shadows, and strip light sources offer adjustable illumination angles and installation—the external coaxial reflective LED light source has a significant advantage in terms of light uniformity and shadow reduction. The external coaxial reflective LED light source beam splitter design reduces light loss, thereby improving optical efficiency.

[0006] There are currently no reports on the simultaneous detection of herbicide resistance genes using external coaxial reflective LED light source excitation-phototriggered amplification combined with photothermal detection test paper technology. Summary of the Invention

[0007] Technical challenges: Existing loop-mediated isothermal amplification methods for herbicide resistance genes have the following limitations: agarose gel electrophoresis cannot distinguish products from multiple loop-mediated isothermal amplification; amplification time is long, and amplification efficiency needs improvement. Furthermore, light-triggered amplification technology has not yet been applied to simultaneously amplify multiple genes; while external coaxial reflective LED light sources offer advantages in light uniformity and reduced shading, they have not yet been combined with light-triggered amplification and photothermal detection paper technology for detecting herbicide resistance genes. The challenges and operational difficulties of using photosensitizer-mediated, light-triggered LAMP lie in the need for the photosensitizer to be compatible with the LAMP system and not interfere with the reaction; the requirement for precisely controllable light sources and light-triggered conditions to avoid affecting amplification stability; and the need to develop highly sensitive and specific detection methods.

[0008] Purpose of the invention: To overcome the shortcomings and defects of the prior art, this invention provides a method, apparatus, and application for the simultaneous detection of aroA1, aroA2, and aroA3. It employs the photosensitizer CsYF4@Yb2O3 as a photothermal material, utilizing its photoactive properties to generate photoelectron and photothermal effects. Under irradiation with an 808nm external coaxial reflective LED light source, rapid temperature control is achieved, and direct contact with the amplification system at the molecular level is maintained, significantly improving photothermal efficiency. Then, photothermal test strip colorimetric detection is performed, thereby achieving integrated and efficient amplification and detection of both phototriggered amplification and photothermal test strip detection.

[0009] Technical solution: The present invention adopts the following technical solution.

[0010] The first objective of this invention is to provide a method for photo-triggered LAMP and detection of herbicide resistance genes aroA1, aroA2, and aroA3 using the photothermal effect of the photosensitizer CsYF4@Yb2O3. This method comprises two steps: photo-triggered amplification and photothermal detection using a test strip. An 808nm external coaxial reflective LED light source is used to irradiate the amplification system, exciting the photosensitizer CsYF4@Yb2O3 to generate photoelectrons and heat, providing energy for LAMP. This allows aroA1, aroA2, and aroA3 to act as templates, initiating the amplification reaction and yielding a large amount of double-stranded DNA amplification products. Then, the amplification products and signal probes are captured in a sandwich-like manner using a photothermal detection test strip, providing a photothermal temperature change signal positively correlated with the amplification product content, thus achieving quantitative detection of the target gene. The isothermal amplification system comprises the following components: primer set, photosensitizer CsYF4@Yb2O3, DNA template, Bst3.0 DNA polymerase, and isothermal amplification buffer.

[0011] Specifically, the present invention provides a method for simultaneously detecting aroA1, aroA2, and aroA3, comprising the following steps:

[0012] S1. Preparation of photosensitizer CsYF4@Yb2O3

[0013] S2, light-triggered LAMP amplification

[0014] Under the mediation of photosensitizer CsYF4@Yb2O3, and irradiated by an 808nm external coaxial reflective LED light source, the sample to be tested underwent an amplification reaction in a light-triggered LAMP system, yielding amplified products, among which...

[0015] The light-triggered LAMP system comprises the following components: photosensitizer CsYF4@Yb2O3 and DNA template, wherein the DNA template is herbicide resistance genes aroA1, aroA2, and aroA3.

[0016] S3, photothermal test strip detection

[0017] By immobilizing and capturing probes in the T and C regions of the test strip, a multi-target photothermal detection test strip targeting the phototriggered LAMP products of the target genes aroA1, aroA2, and aroA3 was obtained.

[0018] Photothermal signal probes were obtained by modifying the photosensitizer CsYF4@Yb2O3 with nucleic acid chains of aroA1, aroA2, and aroA3, respectively.

[0019] The amplification product is detected using the photothermal signal probe and the photothermal test paper. The detection area of ​​the photothermal test paper captures the amplification product and the photothermal signal probe in a sandwich configuration, and provides a photothermal temperature change signal that is positively correlated with the content of the amplification product under illumination by an 808nm coaxial reflective LED light source. Based on this temperature change signal, aroA1, aroA2, and aroA3 in the sample to be tested are qualitatively and / or quantitatively determined.

[0020] As an optional implementation, in the light-triggered LAMP system, the concentration of each DNA template is 3%-5% v / v.

[0021] As an optional implementation, the light-triggered LAMP system also includes primers. The primer set includes three sets of primers, each set including two outer primers F3 and B3, two inner primers FIP and BIP, and two loop primers loopF and loop B.

[0022] As an optional implementation, in the light-triggered LAMP system, the concentrations of the two outer primers F3 and B3 in each primer set are 4%-6% v / v, the concentrations of the two inner primers FIP and BIP are 2%-6% v / v, and the concentrations of the two loop primers loopF and loop B are 0%-4% v / v.

[0023] As an optional implementation, the light-triggered LAMP system further includes the following components: BSA, dNTPs, betaine, Bst3.0 DNA polymerase, ddH2O, and isothermal amplification buffer.

[0024] As an optional implementation, the isothermal amplification buffer includes Tris-HCl, (NH4)2SO4, KCl, MgSO4, and Tween-20.

[0025] As an alternative implementation, the photothermal signal probe can be used independently of the photothermal test paper body, or it can be dropped and dried on the conjugate pad and the conjugate pad can be integrated into the photothermal test paper.

[0026] As an optional implementation, the irradiation parameters of the 808nm external coaxial reflective LED light source are 4.5-6W power and 10-60min irradiation time.

[0027] As an optional implementation, the preparation method of the photosensitizer CsYF4@Yb2O3 includes the following steps:

[0028] (1) Add 140-160 mg of EDTA to 20-30 mL of ultrapure water and stir for 5-10 min to obtain a mixed solution;

[0029] (2) Add Y(NO3)3 and Yb2O3 with a concentration of 0.6-0.8M to the mixed solution and stir rapidly for 30-40 minutes;

[0030] (3) Add 0.8-1.2M of NH4F and CsF to the above mixed solution, stir for 30-40 min, and then heat in a reactor at 180-220℃ for 23-25 ​​h. After the reaction is completed, the initial product is obtained.

[0031] (4) After cooling, washing and drying, the primary product yields photosensitizer CsYF4@Yb2O3.

[0032] As an optional implementation, the volume of Y(NO3)3 used in step (2) is 0.8-1.0 mL, and the volume of Yb2O3 used is 0.1-0.3 mL. Preferably, it is 1 mL of Y(NO3)3 and 0.2 mL of Yb2O3.

[0033] As an optional implementation, the volume of NH4F and CsF used in step (3) is 2-4 mL. Preferably, it is 3 mL.

[0034] As an optional implementation, the drying process includes drying at 65-75°C for 2-3 hours in an oven, preferably at 70°C for 2 hours.

[0035] The second objective of this invention is to provide a device for simultaneously detecting aroA1, aroA2, and aroA3, enabling a combined and convenient operation of the aforementioned methods. Specifically, the device includes an 808nm external coaxial reflective LED light source, a light-triggered LAMP device, and a photothermal detection test paper assembly.

[0036] The light-triggered LAMP device includes: a light-shielding and heat-insulating outer shell, and a light-triggered LAMP component disposed inside the light-shielding and heat-insulating outer shell, wherein...

[0037] The light-triggered LAMP assembly 8 includes a sample holder with N through-holes for holding PCR tubes, where N≥1; the PCR tubes are used to hold the light-triggered LAMP system, which contains a primer set, photosensitizer CsYF4@Yb2O3, DNA template, Bst3.0 DNA polymerase, and isothermal amplification buffer; the DNA template is herbicide resistance genes aroA1, aroA2, and aroA3.

[0038] The front of the light-shielding and heat-insulating shell has a horizontally arranged sample channel, and the light-triggered LAMP assembly is inserted into and fixed in the sample channel; the 808nm external coaxial reflective LED light source is located at the rear of the light-shielding and heat-insulating shell, facing the light-triggered LAMP assembly and the photothermal test paper assembly;

[0039] The photothermal detection test paper assembly includes photothermal detection test paper arranged vertically or horizontally. The photothermal signal probes are obtained by modifying the photosensitizer CsYF4@Yb2O3 with nucleic acid chains of aroA1, aroA2, and aroA3, respectively.

[0040] When the photothermal test paper is set vertically, specifically, a vertical test paper groove is provided at the bottom of the front side of the light-proof and heat-insulating shell, and the photothermal test paper is vertically inserted into and fixed in the test paper groove;

[0041] When the photothermal test strip is arranged horizontally, the photothermal test strip assembly includes a test strip holder and a photothermal test strip. The test strip holder is inserted into and fixed in the sample channel. The test strip holder has a rectangular groove, and the photothermal test strip is fixed in the rectangular groove.

[0042] As an optional implementation, the 808nm external coaxial reflective LED light source includes an LED light source, a beam splitter, and a plano-convex cylindrical lens. The plano-convex cylindrical lens is vertically disposed inside the light-shielding and heat-insulating shell with its flat side facing forward. The LED light source is horizontally placed at the bottom rear side of the plano-convex cylindrical lens. The beam splitter is tilted at 45° between the plano-convex cylindrical lens and the LED light source. After passing through the beam splitter and the plano-convex cylindrical lens, the LED light source is focused into a linear light spot, forming an external coaxial reflective LED light source.

[0043] As an optional implementation, the wavelength of the LED light source is in the range of 800-810nm.

[0044] As an optional implementation, the illumination parameters of the LED light source are 4.5-6W power and 10-60min illumination time.

[0045] As an optional implementation, the light-shielding and heat-insulating outer shell has a beam splitter channel and a plano-convex cylindrical lens channel on both sides, which are used to insert the beam splitter and the plano-convex cylindrical lens, respectively.

[0046] As an optional implementation, the top of the light-shielding and heat-insulating shell is provided with an observation channel located on the front side of the plane of the plano-convex cylindrical lens, for observing the light-triggered LAMP assembly and / or photothermal test paper.

[0047] Beneficial effects

[0048] The amplification method provided by this invention utilizes the photoactive properties of the photosensitizer CsYF4@Yb2O3 to generate photoelectron and photothermal effects. This allows for rapid temperature control and direct molecular-level contact with the amplification system, resulting in a faster heating rate than traditional water baths or metal baths. Furthermore, using CsYF4@Yb2O3 as a signal probe in the photothermal detection test paper provides a sensitive and quantifiable signal. The entire method can rapidly achieve efficient amplification and detection of various target DNAs. Attached Figure Description

[0049] Figure 1 This is a schematic diagram of the workflow of the present invention;

[0050] Figure 2 This is a schematic diagram of the device of the present invention;

[0051] Figure 3 This is a schematic diagram of the self-assembly device of the present invention.

[0052] Figure 4 This describes the photothermal heating condition of the photothermal material of the present invention.

[0053] Figure 5 This serves as a verification of the light-triggered multiplex LAMP primers of the present invention;

[0054] Figure 6 Electrophoretic photographs, colorimetric and photothermal detection test strips of the phototriggered single and multiple LAMP products of the present invention;

[0055] Figure 7 This invention enables photothermal quantification by combining a light-triggered LAMP with a side-flow chromatography test strip;

[0056] Figure 8 Electrophoretic images of the products from photo-triggered LAMP of aroA using this device and using a diffused LED, respectively, according to the present invention.

[0057] Figure 9 This invention utilizes photo-triggered multiplex LAMP and water bath LAMP amplification products for gel electrophoresis. Detailed Implementation

[0058] The present invention can be better understood from the following embodiments. However, the specific material ratios, process conditions, and results described in the embodiments are for illustrative purposes only and should not, and will not, limit the invention as described in detail in the claims.

[0059] The challenges and operational difficulties of using photosensitizer-mediated, phototriggered LAMP lie in the need for the photosensitizer to be compatible with the LAMP system and not interfere with the reaction; the requirement for precisely controllable light sources and phototriggered conditions to avoid affecting amplification stability; and the need to develop a highly sensitive and specific detection method that matches phototriggered multiplex LAMP. Based on these technical challenges, this invention discloses an analytical method, apparatus, and application for the simultaneous detection of herbicide resistance genes aroA1, aroA2, and aroA3 using phototriggered loop-mediated isothermal amplification (LAMP) combined with photothermal detection strips. This method includes two steps: phototriggered LAMP and photothermal detection strip detection. N sample tubes are simultaneously irradiated with an 808nm external coaxial reflective LED light source. The photosensitizer CsYF4@Yb2O3 in the tubes provides photoelectrons and heat to the LAMP through phototriggered activation. The target gene in the positive sample serves as a template to initiate the amplification reaction, yielding a large amount of double-stranded DNA amplification products. CsYF4@Yb2O3 was modified with three nucleic acid chains, aroA1, aroA2, and aroA3, to obtain three corresponding signal probes. The detection areas of the three photothermal test strips were sandwiched to capture the amplification products and signal probes, providing a photothermal temperature change signal positively correlated with the amplification product content. Based on this temperature change signal, aroA1, aroA2, and aroA3 in the original sample were further quantified. This invention utilizes the photoactive properties of the photosensitizer CsYF4@Yb2O3 to generate photoelectronic and photothermal effects, achieving rapid temperature control and direct molecular-level contact with the phototriggered LAMP system before photothermal test strip colorimetric detection, significantly improving photothermal efficiency.

[0060] Example

[0061] The following embodiments of this application disclose a method for achieving a photo-triggered multiplex LAMP system for resistance genes aroA1, aroA2, and aroA3 using the photothermal effect of the photosensitizer CsYF4@Yb2O3, comprising the following steps:

[0062] (1) Primer sequence design:

[0063] Based on the LAMP principle, taking a target gene sequence as an example, a set of amplification primers is designed for six different regions of the target gene sequence. The primer set includes two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (loop F and loop B).

[0064] (2) Plasmid DNA extraction:

[0065] Microorganisms collected from the samples or preserved bacterial strains containing the target genes (aroA1, aroA2, aroA3) were cultured in LB medium for 24 hours, and plasmid DNA was extracted. The specific method was as follows: plasmid DNA was extracted using a DNA extraction kit, which included RNase A, Buffer S, Solution I, Solution II, Solution III, Wash Solution, Solution Buffer, EZ-10 Column, and Collection Tube.

[0066] As an optional implementation, the plasmid DNA extraction method in step (2) can also be any one of the following: adsorption column method, magnetic bead method, CTAB method, etc.

[0067] (3) Preparation of photosensitizer CsYF4@Yb2O3:

[0068] Add 140-160 mg of EDTA to a 50 mL beaker, add 25 mL of ultrapure water, and stir rapidly for 5 minutes. Then add 0.8-1.0 mL of Y(NO3)3 (0.6-0.8 mol / L) and 0.1-0.3 mL of Yb2O3 (0.6-0.8 mol / L), and stir rapidly for 30 minutes. Subsequently, add 2-4 mL of NH4F (0.8-1.2 mol / L) and 2-4 mL of CsF (0.8-1.2 mol / L), and stir continuously for 30 minutes until a milky white solution is produced. Transfer the solution to a 200℃ high-pressure reactor and react for 24 hours. After cooling to room temperature, wash 2-3 times alternately with ultrapure water and alcohol, and then dry at 70℃ for 2 hours to obtain CsYF4@Yb2O3 nanocomposite material.

[0069] (4) Construction of a light-triggered multi-LAMP system:

[0070] Using aroA1, aroA2, and aroA3 from the extracted plasmid DNA as templates, a light-triggered multiplex LAMP system was constructed. The amplification system included the following components: primer set, photosensitizer CsYF4@Yb2O3 (i.e., the photosensitizer CsYF4@Yb2O3 solution prepared in step (3)), BSA, MgSO4, isothermal amplification buffer (Tris-HCl, (NH4)2SO4, KCl, MgSO4, Tween-20), dNTPs, betaine, Bst 3.0 DNA polymerase, ddH2O, and DNA template.

[0071] (5) Excitation by external coaxial reflective LED light source:

[0072] The LAMP system was triggered by irradiation with an 808nm external coaxial reflective LED. The excitation light in the LAMP system provided the energy required for multiple LAMP processes.

[0073] In this embodiment of the invention, a device for simultaneously detecting aroA1, aroA2, and aroA3 is also provided. This device integrates the two stages of light-triggered LAMP and photothermal test paper detection, along with the light source, into a single combined device, further enhancing the portability of the detection system of this invention. Figure 2 As shown, the device includes an 808nm external coaxial reflective LED light source, a light-triggered LAMP device, and a photothermal detection test paper assembly 9, wherein...

[0074] The light-triggered LAMP device includes: a light-shielding and heat-insulating housing 3, and a light-triggered LAMP component 8 disposed inside the light-shielding and heat-insulating housing 3, wherein...

[0075] The light-triggered LAMP assembly 8 includes a sample holder with N through-holes for holding PCR tubes, where N≥1; the PCR tubes are used to hold the light-triggered LAMP system, which contains a primer set, photosensitizer CsYF4@Yb2O3, DNA template, Bst3.0 DNA polymerase, and isothermal amplification buffer;

[0076] The front of the light-shielding and heat-insulating shell 3 has a horizontally arranged sample channel 1, and the light-triggered LAMP assembly 8 is inserted into and fixed in the sample channel 1; the 808nm external coaxial reflective LED light source is located at the rear of the light-shielding and heat-insulating shell 3, facing the light-triggered LAMP assembly 8 and the photothermal test paper assembly 9, and provides a light source for them;

[0077] The photothermal test paper assembly 9 includes photothermal test papers 12 arranged vertically or horizontally, wherein...

[0078] When the photothermal test paper 12 is set vertically, specifically, a vertical test paper groove 5 is provided at the bottom of the front side of the light-proof and heat-insulating outer shell 3, and the photothermal test paper 12 is vertically inserted into and fixed in the test paper groove 5.

[0079] When the photothermal test strip 12 is arranged horizontally, the photothermal test strip assembly 9 includes a test strip holder and a photothermal test strip 12. The test strip holder is inserted into and fixed in the sample channel 1. The test strip holder has a rectangular groove, and the photothermal test strip 12 is fixed in the rectangular groove.

[0080] In one example, such as Figure 2 As shown in d, the 808nm external coaxial reflective LED light source is provided by the existing 808nm external coaxial reflective LED light source 14. It is not specifically limited in this invention, and all of them are within the protection scope of this invention.

[0081] In one example, the present invention also provides a self-assembled 808nm external coaxial reflective LED light source, such as... Figure 3 As shown, the self-assembled 808nm external coaxial reflective LED light source includes an LED light source 7, a beam splitter 11, and a plano-convex cylindrical lens 10. The plano-convex cylindrical lens 10 is vertically disposed inside the light-shielding and heat-insulating shell 3 with its flat side facing forward. The LED light source 7 is horizontally placed at the bottom rear side of the plano-convex cylindrical lens 10. The beam splitter 11 is inclined at 45° between the plano-convex cylindrical lens 10 and the LED light source 7. After passing through the beam splitter 11 and the plano-convex cylindrical lens 10, the LED light source 7 is focused into a linear light spot, forming an external coaxial reflective LED light source 13.

[0082] The diffused light emitted by the LED light source is filtered by a beam splitter to obtain uniform parallel light. The parallel light is then focused into a transverse linear light spot after passing through a plano-convex cylindrical mirror. By adjusting the power of the LED light source, the energy required for light-triggered LAMP and photothermal test strip detection under different room temperature conditions can be met. By adjusting the distance between the light-triggered LAMP component, the photothermal test strip component, and the plano-convex cylindrical mirror, the size of the light spot on the amplification container (0.2mL PCR tube) and the test strip can be adjusted to accommodate different volumes of light-triggered LAMP systems and different T regions on the test strip.

[0083] In one example, the LED light source 7 has a wavelength range of 800-810nm.

[0084] In one example, the illumination parameters of the LED light source 7 are 4.5-6W power and 10-60min illumination time.

[0085] In one example, the light-shielding and heat-insulating outer shell 3 has a beam splitter channel 6 and a plano-convex cylindrical lens channel 4 on opposite sides, which are used to insert a beam splitter 11 and a plano-convex cylindrical lens 10, respectively.

[0086] In one example, the top of the light-shielding and heat-insulating outer shell 3 is provided with an observation channel 2, located on the front side of the plane of the plano-convex cylindrical lens 10, for observing the light-triggered LAMP assembly 8 and / or the photothermal test paper 12.

[0087] In one example, the diameter of the PCR tube channel is 5.38 mm, and the center-to-center distance between adjacent PCR tube channels is 9 mm.

[0088] In one example, N ≥ 2 of the N through-hole PCR tubes.

[0089] In one example, the PCR tube is a 200 μL single PCR tube and / or a 200 μL eight-tube strip.

[0090] In one example, the distances between the bottom of the beam splitter and the bottom of the LED light source and the plano-convex cylindrical lens are 1 cm and 15 cm, respectively.

[0091] In one example, the beam splitter is made of AR glass and has dimensions of length × width × thickness = 141mm × 104mm × 2mm.

[0092] In one example, the plano-convex cylindrical lens is made of N-SF11, with dimensions of length × width × center thickness = 100mm × 104mm × 50mm, a focal length of 60mm, and an edge thickness of 0mm.

[0093] In one example, the sample channel is 45 mm from the plane of the plano-convex cylindrical lens and 60 mm from the inner bottom of the light-shielding and heat-insulating outer shell.

[0094] In one example, the depth of the rectangular groove on the test strip holder is 3 mm.

[0095] (6) Photothermal test strip testing:

[0096] Three photothermal signal probes were obtained by modifying the photosensitizer CsYF4@Yb2O3 with three nucleic acid chains. The probes were immobilized and captured in the T and C regions of the test strip to obtain a multi-target photothermal detection test strip targeting the light-triggered LAMP products of the target genes aroA1, aroA2, and aroA3. The amplification products were detected using the photothermal detection test strip, and the temperature signal was read by a smartphone for quantification.

[0097] The principle of this invention is as follows Figure 1As shown. This method is characterized by high efficiency, convenience, and accuracy, and is suitable for the detection of aroA1, aroA2, and aroA3. This invention can achieve efficient on-site amplification of aroA1, aroA2, and aroA3, using an 808nm external coaxial reflective LED to excite the photosensitizer CsYF4@Yb2O3 for phototriggered amplification.

[0098] The following examples use aroA1, aroA2, and aroA3 as examples of resistance genes to illustrate the entire amplification method in full detail.

[0099] Example 1:

[0100] A method for driving multiple LAMP using the photothermal effect of the photosensitizer CsYF4@Yb2O3, the method comprising the following steps:

[0101] (1) Primer sequence design:

[0102] Based on the principle of loop-mediated isothermal amplification, a primer set was designed for six different regions of the target gene sequence. The primer set includes two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers (loop F and loop B). The sequences of the outer primers are shown in Table 1.

[0103] Table 1 Primer sequences of the optically triggered multiple LAMP system of this invention.

[0104]

[0105] (2) Plasmid DNA extraction:

[0106] The preserved bacterial strains containing the target genes (aroA1, aroA2, aroA3) were cultured in LB medium for 24 hours, and plasmid DNA was extracted. The specific method was as follows: plasmid DNA was extracted using a DNA extraction kit, which included RNase A, Buffer S, Solution I, Solution II, Solution III, Wash Solution, Solution Buffer, EZ-10 Column, and Collection Tube.

[0107] (3) Preparation of photosensitizer CsYF4@Yb2O3:

[0108] 140 mg of EDTA was added to a 50 mL beaker, followed by 25 mL of ultrapure water and rapid stirring for 5 minutes. Then, 0.8 mL of Y(NO3)3 (0.6 mol / L) and 0.1 mL of Yb2O3 (0.6 mol / L) were added, and the mixture was rapidly stirred for 30 minutes. Subsequently, 2 mL of NH4F (0.8 mol / L) and 2 mL of CsF (0.8 mol / L) were added, and the mixture was stirred continuously for 30 minutes until a milky white solution was produced. The solution was transferred to a 200 °C autoclave and reacted for 24 hours. After cooling to room temperature, the mixture was washed three times alternately with ultrapure water and alcohol, and then dried at 70 °C for 2 hours to obtain the CsYF4@Yb2O3 nanocomposite material.

[0109] The photosensitizer CsYF4@Yb2O3 solution was irradiated with an 808nm external coaxial reflective LED light source in the combined device, and compared with solutions of CsYF4 and Yb2O3 of the same concentration. The photothermal heating curves of the three are as follows: Figure 4 As shown, the CsYF4@Yb2O3 composite exhibits significantly improved heating efficiency compared to the single substance, which is beneficial for enhancing its efficiency as a photosensitizer.

[0110] (4) Construction of a light-triggered multi-LAMP system:

[0111] The light-triggered multiplex LAMP system includes the following components: primer set, photosensitizer CsYF4@Yb2O3 (referring to the photosensitizer CsYF4@Yb2O3 solution prepared in step (3)), BSA, MgSO4, isothermal amplification buffer (Tris-HCl, (NH4)2SO4, KCl, MgSO4, Tween-20), dNTPs, betaine, Bst 3.0 DNA polymerase, ddH2O and DNA template.

[0112] While maintaining a final volume of 25 μL, the concentrations of each component and the reaction volume of the phototriggered multiplex LAMP system are shown in Table 2 below.

[0113] Table 2. Concentrations and reaction volumes of each component in the phototriggered multiple LAMP system of this embodiment.

[0114]

[0115]

[0116] (5) LED light source excitation:

[0117] In this embodiment, the light-triggered multiplex LAMP and photothermal test paper detection processes, along with the light source, are integrated into a combined device to study the detection effect of the combined device on three target genes: aroA1, aroA2, and aroA3. Figure 2, 3 As shown, the device includes an 808nm external coaxial reflective LED light source, a light-triggered LAMP device, and a photothermal detection test paper assembly 9, wherein...

[0118] The light-triggered amplification device includes: a light-shielding and heat-insulating housing 3, and a light-triggered LAMP component 8 disposed inside the light-shielding and heat-insulating housing 3, wherein...

[0119] The light-triggered LAMP assembly 8 includes a sample holder with 10 through-hole PCR tubes for holding PCR tubes. The PCR tubes are 200 μL each, with a diameter of 5.38 mm and a center-to-center distance of 9 mm between adjacent PCR tubes.

[0120] The PCR tube is used to hold the light-triggered LAMP system, as described in the steps above. The light-triggered LAMP system contains a primer set, photosensitizer CsYF4@Yb2O3, DNA template, Bst3.0 DNA polymerase, and isothermal amplification buffer.

[0121] The front of the light-shielding and heat-insulating shell 3 has a horizontally arranged sample channel 1, into which the light-triggered LAMP assembly 8 is inserted and fixed; the 808nm external coaxial reflective LED light source is located at the rear of the light-shielding and heat-insulating shell 3, facing the light-triggered LAMP assembly 8 and the photothermal test paper assembly 9, to provide light source for them;

[0122] The photothermal test paper assembly 9 includes a photothermal test paper 12 arranged vertically or horizontally. The top of the light-proof and heat-insulating shell 3 is provided with an observation channel 2, located on the front side of the plane of the plano-convex cylindrical lens 10, for observing the light-triggered LAMP assembly 8 and / or the photothermal test paper 12.

[0123] In one example, when the photothermal test paper 12 is set vertically, it specifically includes a vertical test paper groove 5 provided at the bottom of the front side of the light-proof and heat-insulating outer shell 3, and the photothermal test paper 12 is vertically inserted into and fixed in the test paper groove 5.

[0124] In another example, when the photothermal test strip 12 is arranged horizontally, the photothermal test strip assembly 9 includes a test strip holder and a photothermal test strip 12. The test strip holder is inserted into and fixed in the sample channel 1. The test strip holder has a rectangular groove with a depth of 3 mm, and the photothermal test strip 12 is fixed in the rectangular groove.

[0125] like Figure 3As shown, the self-assembled 808nm external coaxial reflective LED light source of this embodiment includes an LED light source 7, a beam splitter 11, and a plano-convex cylindrical lens 10. The plano-convex cylindrical lens 10 is vertically disposed inside the light-shielding and heat-insulating shell 3, with its flat side facing forward. The LED light source 7 is horizontally placed at the bottom rear side of the plano-convex cylindrical lens 10. The beam splitter 11 is tilted at 45° between the plano-convex cylindrical lens 10 and the LED light source 7. After passing through the beam splitter 11 and the plano-convex cylindrical lens 10, the LED light source 7 is focused into a linear light spot, forming an external coaxial reflective LED light source 13. The light-shielding and heat-insulating shell 3 has beam splitter channels 6 and plano-convex cylindrical lens channels 4 on opposite sides, for inserting the beam splitter 11 and the plano-convex cylindrical lens 10, respectively. The beam splitter is made of AR glass and has dimensions of length × width × thickness = 141mm × 104mm × 2mm. The plano-convex cylindrical lens is made of N-SF11 material, with dimensions of length × width × center thickness = 100mm × 104mm × 50mm, a focal length of 60mm, and an edge thickness of 0mm. The distances between the bottom of the beam splitter and the LED light source and the bottom of the plano-convex cylindrical lens are 1cm and 15cm, respectively.

[0126] One of the challenges and operational difficulties of using photosensitizer-mediated, phototriggered multiplex LAMP lies in the need for precisely controllable light sources and phototriggered conditions to avoid affecting amplification stability. To solve this technical problem, this invention utilizes a self-assembled device that cleverly filters the diffused light emitted by the LED light source through a beam splitter to obtain uniform parallel light. The parallel light is then focused into a transverse linear spot by a plano-convex cylindrical mirror. By adjusting the power of the LED light source, the energy required for phototriggered LAMP and photothermal detection strips under different room temperature conditions can be met. By adjusting the distance between the phototriggered LAMP component, the photothermal detection strip component, and the plano-convex cylindrical mirror, the size of the spot on the amplification container (0.2 mL PCR tube) and the test strip can be adjusted to accommodate different volumes of phototriggered LAMP systems and different T regions on the test strip.

[0127] A combined device utilizes an 808nm external coaxial reflective LED to trigger a LAMP system. The excitation light triggers the photothermal material in the LAMP system to provide the energy required for multiple LAMP processes, achieving amplification and obtaining the amplified products. In this embodiment, the excitation power of the 808nm external coaxial reflective LED is 4.5W, and the excitation time is 15 minutes.

[0128] (6) Analysis of light-triggered LAMP results:

[0129] Three photothermal signal probes were obtained by modifying the photosensitizer CsYF4@Yb2O3 with three nucleic acid chains. The specific method was as follows: 20 μL of each of the three nucleic acid chains aroA1, aroA2, and aroA3 were added to 2 mL of the photosensitizer CsYF4@Yb2O3, vortexed and mixed, and then 50 μL of sodium citrate buffer was added. The mixture was incubated at 37°C for 30 min, and then 100 μL of HEPES buffer was added. The mixture was incubated at 37°C for 30 min, centrifuged, and then dissolved in 150 μL of photothermal reconstitution solution. This yielded the three photothermal signal probes modified with the photosensitizer CsYF4@Yb2O3.

[0130] By immobilizing the capture probes in the T and C regions of the test strip, a multi-target photothermal test strip targeting the light-triggered LAMP products of the target genes aroA1, aroA2, and aroA3 was obtained.

[0131] The probe sequences for detecting amplification products using the photothermal detection test strip are shown in Table 3 below.

[0132] Table 3. Probe sequences for detecting amplification products using the photothermal detection test paper in this embodiment.

[0133]

[0134] The photothermal detection test paper assembly 9 of the combined device is used to detect the amplification product obtained in the above steps. The specific method is as follows: In this embodiment, the photothermal detection test paper 12 is inserted laterally and fixed in the sample channel 1, as shown below. Figure 3 As shown in f; the LED light source 7 is turned on, and the LED light source is focused into a linear light spot after passing through the beam splitter 11 and the plano-convex cylindrical lens 10, forming an external coaxial reflective LED light source 13, which illuminates the photothermal test paper 12 in front, providing it with photothermal energy, thereby stimulating the photothermal effect of the photosensitizer CsYF4@Yb2O3 in the photothermal signal probe, realizing the detection function of the photothermal test paper; the photothermal signal of the T area on the photothermal test paper 12 is read by a smartphone equipped with infrared thermal imaging accessories, and the presence or absence of the target object is determined according to the photothermal signal change phenomenon, and a qualitative test is performed; further quantitative tests can be performed based on the intensity of the temperature change signal, wherein the standard curve used in the quantitative test can be characterized and plotted according to the concentration gradient method.

[0135] (7) Specificity verification

[0136] After adding all reagents except primers and templates to six light-triggered LAMP tubes, add [the following to each tube]...

[0137] ① aroA1 template, aroA2 primer, aroA3 primer;

[0138] ② aroA1 template, aroA1 primer, aroA2 primer, aroA3 primer;

[0139] ③ aroA2 template, aroA3 primer;

[0140] ④ aroA2 template, aroA2 primer, aroA3 primer;

[0141] ⑤ aroA3 template, aroA2 primer;

[0142] ⑥ aroA3 template, aroA2 primer, aroA3 primer;

[0143] Figure 5 The electrophoresis images showed diffuse bands when primers and templates of the same gene coexisted, indicating that the method has good selectivity for aroA1, aroA2, and aroA3.

[0144] Figure 6 Electrophoresis images show that the coexisting primers and templates do not interfere with the amplification of other target genes. Test strip images show that the test strip can specifically detect the amplification products of specific target genes in the multiplex LAMP system in both colorimetric and photothermal modes.

[0145] Figure 7 This study describes a concentration gradient detection experiment targeting three target genes: aroA1, aroA2, and aroA3. Quantitative curves were plotted based on the photothermal signal from the test strip for each of the three target genes. The results demonstrate that this invention can successfully amplify and quantify the three target genes aroA1, aroA2, and aroA3. Experimental verification showed that the detection limits for the three target genes sul1, sul2, and sul3 all reached 10 copies / μL.

[0146] Furthermore, using scattered light LEDs and external coaxial reflective LEDs as light-triggered LAMP sources, their amplification effects were compared, such as... Figure 8 As shown, only external coaxial reflective LEDs can produce bright diffuse stripes, i.e., high-efficiency amplification, while diffuse LEDs do not induce effective amplification. This may be because diffuse LEDs generate not only light energy but also heat energy during operation. Some of this heat energy may be absorbed by the scattering material or structure and converted into other forms of energy (such as internal energy), thus reducing heat dissipation efficiency. In contrast, external coaxial reflective LEDs primarily convert electrical energy into light energy, generating relatively less heat energy, which can be dissipated more efficiently.

[0147] Comparative Example 1: Water Bath LAMP

[0148] This embodiment compares the photothermal effect of the photosensitizer CsYF4@Yb2O3 to achieve photo-triggered multiplex LAMP with the effect of traditional water bath LAMP, in order to verify the advancement of the method of the present invention in terms of amplification effect.

[0149] The water bath loop-mediated isothermal amplification method includes the following steps:

[0150] (1) Primer sequence design:

[0151] Same as Example 1

[0152] (2) Plasmid DNA extraction:

[0153] Same as Example 1

[0154] (3) Construction of isothermal amplification system:

[0155] Construct a water bath LAMP system. The water bath loop-mediated amplification system includes the following components: primer set, MgSO4, isothermal amplification buffer (Tris-HCl, (NH4)2SO4, KCl, MgSO4, Tween-20), dNTPs, betaine, Bst 3.0 DNA polymerase, ddH2O, and DNA template.

[0156] While maintaining a final volume of 25 μL, the concentrations of each component and the reaction volume of the water bath LAMP system are shown in Table 4 below:

[0157] Table 4. Concentrations and reaction volumes of components in the water bath LAMP system.

[0158]

[0159] (4) The amplification process is carried out:

[0160] Add each component of the water bath LAMP system to a 1.5 mL centrifuge tube and place in a 65 °C water bath for 60 min.

[0161] (5) Analysis of amplification products:

[0162] The amplification products were analyzed by agarose gel electrophoresis.

[0163] Gel electrophoresis images as follows Figure 9 As shown, the negative group without template DNA only shows the primers and no diffuse bands in the image, while the positive group containing template DNA shows diffuse bands in the image of successful amplification. Meanwhile, the water bath LAMP group in Comparative Example 1 only showed bright diffuse bands after 60 minutes of amplification, while the light-triggered LAMP group showed clear and bright diffuse bands after only 20 minutes, indicating that the amplification efficiency of the light-triggered LAMP group was superior to that of the water bath LAMP group.

[0164] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for simultaneous detection aroA1 , aroA2 and aroA3 The method is characterized by, Includes the following steps: S1. Preparation of photosensitizer CsYF4@Yb2O3 S2, light-triggered LAMP amplification Under the mediation of photosensitizer CsYF4@Yb2O3, and irradiated by an 808nm external coaxial reflective LED light source, the sample to be tested underwent an amplification reaction in a light-triggered LAMP system, yielding amplified products. The light-triggered LAMP system includes a photosensitizer CsYF4@Yb2O3, primers, and a DNA template, wherein the DNA template is a herbicide resistance gene. aroA1 , aroA2 and aroA3 ; The primer sequences in the light-triggered LAMP system are as follows: aroA1 -F3:ACGTGCTCGAACGCATG aroA1 -B3:CGGTCGGTCTCCTTGTACC aroA1 -FIP:GACAGCTCGGACCGCTGTAC TGCCGACATCGACTGGGA aroA1 -BIP:GGACCTCCTGCCGACGATTG TCGGCGTCCGTGATGC aroA2 -F3:AGCTCTTTGTCTGGGTAGCA aroA2 -B3:CAGTGCGGTGAGGAATTGG aroA2 -FIP:TAAGTGATCTTCGCCCCGCC TGAGCCGCGTATGAAAGAAC aroA2 -BIP:TATCCGCCGTTGCGTTTACAGG CTGGAAACGGAGCCATCAA aroA3 -F3:GGTGACTACTCATTGGCT aroA3 -B3:TTAGGTCCCCGACTGATG aroA3 -FIP:TGCCCTATCCCTATGTAGATTTGTT ACTACACAACTCTCTCTGTAC aroA3 -BIP: GAGTGAGTACGCATTCATTAGGTAT CTTGACAATTACCGAGCCT; S3, photothermal test strip detection The probe was immobilized and captured in the T and C regions of the test strip to obtain a target gene. aroA1 , aroA2 and aroA3 Multi-target photothermal test paper for light-triggered LAMP products; respectively aroA1 , aroA2 and aroA3 Nucleic acid chains were modified with photosensitizer CsYF4@Yb2O3 to obtain photothermal signal probes; The amplification product is detected using the photothermal signal probe and the photothermal test paper. The detection area of ​​the photothermal test paper captures the amplification product and the photothermal signal probe in a sandwich configuration, and provides a photothermal temperature change signal positively correlated with the amplification product content under illumination from an 808 nm external coaxial reflective LED light source. Based on this temperature change signal, the content of the amplification product in the test sample is determined. aroA1 , aroA2 and aroA3 Qualitative and / or quantitative; The probe sequence for detecting the amplification product is as follows: aroA1 -T probe: CCGAGCTGTC-Biotin aroA2 -T probe: GAGATCACTTA-Biotin aroA3 -T probe: AGGGATAGGGCA-Biotin aroA1 -Signal probe: AAAAAAAAAAAAAAA-GGCAGGAGGTCC aroA2 -Signal probe: AAAAAAAAAAAAAAA -CAACGGCGGATA aroA3 -Signal probe: AAAAAAAAAAAAAAA -GCGTACTCACTC C-capture probe: Biotin-ACACCGGTCTCTA C signal probe: AAAAAAAAAAAAAAA - TAGAGACCGTGT.

2. The method according to claim 1, characterized in that, In the light-triggered LAMP system, the concentration of each DNA template is 3%-5% v / v.

3. The method according to claim 1, characterized in that, In the light-triggered LAMP system, the concentrations of the two external primers F3 and B3 in each primer set are 4%-6% v / v, and the concentrations of the two internal primers FIP and BIP are 2%-6% v / v.

4. The method according to claim 1, characterized in that, The light-triggered LAMP system also includes the following components: BSA, dNTPs, betaine, Bst3.0 DNA polymerase, ddH2O, and isothermal amplification buffer.

5. The method according to claim 4, characterized in that, The isothermal amplification buffer includes Tris-HCl, (NH4)2SO4, KCl, MgSO4, and Tween-20.

6. The method according to claim 1, characterized in that, The illumination parameters of the external coaxial reflective LED light source are: power 4.5-6 W and illumination time 10-60 min.

7. The method according to claim 1, characterized in that, The photothermal signal probe can be used independently of the photothermal test paper body, or it can be dropped and dried on the conjugate pad and the conjugate pad can be integrated into the photothermal test paper.

8. The method according to claim 1, characterized in that, The preparation method of the photosensitizer CsYF4@Yb2O3 includes the following steps: (1) Add 140-160 mg of EDTA to 20-30 mL of ultrapure water and stir for 5-10 min to obtain a mixed solution; (2) Add Y(NO3)3 and Yb2O3 with a concentration of 0.6-0.8 M to the mixed solution and stir rapidly for 30-40 min; (3) Add 0.8-1.2 M of NH4F and CsF to the above mixed solution, stir for 30-40 min, and then heat in a reactor at 180-220°C for 23-25 ​​h. After the reaction is completed, the initial product is obtained. (4) After cooling, washing and drying, the primary product yields photosensitizer CsYF4@Yb2O3.

9. The method according to claim 8, characterized in that, In step (2), the volume of Y(NO3)3 used is 0.8-1.0 mL, and the volume of Yb2O3 used is 0.1-0.3 mL.

10. The method according to claim 8, characterized in that, The volume of NH4F and CsF used in step (3) is 2-4 mL.

11. The method according to claim 8, characterized in that, The drying process described in step (4) includes drying at 65-75°C in an oven for 2-3 hours.

Images