CAPS (cleaved amplified polymorphic sequence) molecular marker for identifying homozygosity of lotus-shaped and coronal flower types or genotypes of marigold, detection primer and detection kit

Abstract

The invention discloses a CAPS (cleaved amplified polymorphic sequence) molecular marker, a detection primer and a detection kit for identifying homozygosity of lotus-shaped and coronal flower types or genotypes of marigold. According to the invention, a BSA-seq technology is utilized to obtain an SNP site closely linked with a marigold pattern to develop and obtain the CAPS molecular marker, and the sequences of the CAPS molecular marker in a lotus-shaped pattern marigold or a coronal pattern marigold are respectively shown as SEQ ID NO.1 or SEQ ID NO.2. The invention also provides a detection primer for detecting the CAPS molecular marker and a PCR (Polymerase Chain Reaction) detection kit for identifying the Tagetes erecta flower type. By applying the detection primer or the detection kit, the homozygosity of the lotus-shaped and coronal flower types and the genotype of the coronal flower type of the marigold can be accurately identified, and the detection efficiency in F2 segregation population of the marigold reaches 99% or above. The molecular marker can be used for carrying out molecular marking or identification on the pattern of the seedling of the marigold in the seedling stage, and has an application prospect in the aspect of assisted breeding of the marigold.

Description

Technical Field

[0001] The invention relates to molecular markers of plant quality traits, in particular to CAPS molecular markers, detection primers and detection kits for identifying marigold flower types and applications thereof, and belongs to the field of CAPS molecular markers of marigold flower types. Background Art

[0002] Marigold (Tagetes erecta) is an annual plant of the genus Tagetes in the Asteraceae family. It is widely used in flower beds, flower borders, cut flowers, etc. because of its large and colorful flowers, long flowering period, and high ornamental value. Marigold has a unique capitula structure, with bilaterally symmetrical ligulate florets on the periphery, which are unisexual flowers; in the middle are radially symmetrical tubular florets, which are bisexual flowers. According to the size of the corolla of the tubular florets, it is divided into lotus-shaped flower type and crown-shaped flower type. That is, the corolla of the florets does not expand or elongate to form a lotus-shaped flower type, while the corolla of the florets expands and elongates to form a crown-shaped flower type. Among them, the crown-shaped flower type is a relatively new flower type of marigold in recent years and is an important breeding target.

[0003] The rapid development of sequencing technology has provided technical support for molecular breeding of flowers. BSA-seq (Bulked segregant analysis sequencing), that is, the separation population grouping analysis method combined with whole genome sequencing technology to sequence the extreme mixed pool of target traits, can screen out a large number of SNP (single nucleotide polymorphism) markers to achieve rapid positioning of target genes, and at the same time, can develop linked molecular markers for molecular marker-assisted breeding. SNP, or single nucleotide polymorphism, belongs to the third generation of DNA molecular markers. It is mainly caused by mutations of single nucleotides (A, T, C, G) that lead to sequence changes at the DNA level. A large number of SNP sites can be screened by BSA-seq technology. There are many methods for SNP typing based on SNP sites, but each has its own advantages and disadvantages. Among them, the CAPS (Cleave amplified polymorphic sequence) marker is developed based on PCR amplification and enzyme digestion to digest the amplified product to distinguish and identify different individual plants with SNP site polymorphism. It is simple, rapid, and highly specific. It is a relatively economical and fast typing technology.

[0004] For marigolds, whose ornamental value is mainly concentrated on the flowers, the elongated and swollen crowns of tubular flowers are fuller and rounder than the lotus-shaped flowers, and have higher ornamental value. Although traditional breeding methods make it easy to distinguish between lotus-shaped flowers and crown-shaped flowers after marigold flowers are fully bloomed, a lot of manpower and material resources are required in the process of cultivating them from the seedling stage to full bloom. Using BSA-seq technology, molecular markers related to the lotus-shaped and crown-shaped flower types of marigolds have been developed, which can efficiently screen marigolds with lotus-shaped and crown-shaped flowers in the seedling stage, reduce the cost of later cultivation and management, greatly overcome the shortcomings of traditional breeding, and effectively improve the efficiency of breeding. Summary of the invention

[0005] One of the purposes of the present invention is to provide a CAPS molecular marker for identifying the lotus-shaped and crown-shaped flower types of marigold or the homozygosity of their genotypes;

[0006] The second object of the present invention is to provide PCR detection primers for detecting the CAPS molecular marker;

[0007] The third object of the present invention is to provide a detection kit for identifying the lotus-shaped and crown-shaped flower types of marigold or the homozygosity of their genotypes;

[0008] The fourth purpose of the present invention is to apply the CAPS molecular marker, PCR detection primer or detection kit to the identification of marigold lotus and crown flower types or their genotype homozygosity and other aspects.

[0009] In order to achieve the above object, the main technical solutions adopted by the present invention include:

[0010] One aspect of the present invention provides a CAPS molecular marker for identifying the lotus-shaped and crown-shaped flower types or the homozygosity of their genotypes in marigold, which is named Marker 9.61. The nucleotide sequence of the CAPS molecular marker Marker 9.61 in the lotus-shaped flower type marigold is shown in SEQ ID NO.1, and the nucleotide sequence of the CAPS molecular marker Marker 9.61 in the crown-shaped flower type marigold is shown in SEQ ID NO.2.

[0011] The CAPS molecular marker Marker 9.61 of the present invention has a SNP site difference located at 322bp in the sequences of crown flower type and lotus flower type marigolds, which is G in the crown flower type and A in the lotus flower type. The CAPS molecular marker Marker 9.61 is closely linked to the lotus flower type and crown flower type traits, indicating that the specific molecular marker Marker 9.61 provided by the present invention can be used to identify whether the flower type of marigold is lotus or crown.

[0012] In a preferred embodiment of the present invention, the detection primers consist of an upstream detection primer shown in SEQ ID NO.3 and a downstream detection primer shown in SEQ ID NO.4.

[0013] The above primer set can be used as a primer set for amplifying CAPS molecular markers, and then used to identify marigold flower types. Therefore, the use of the primer set in identifying marigold lotus flower types or crown flower types is within the protection scope of the present invention. Moreover, a kit comprising the above primer set for identifying marigold lotus flower types or crown flower types is also within the protection scope of the present invention.

[0014] Another aspect of the present invention is to provide a detection kit for identifying the lotus-shaped and crown-shaped flower types of marigold or the homozygosity of their genotypes, comprising: PCR Master Mix, PCR detection primers; wherein the PCR Master Mix includes: Taq enzyme, dNTP, Mg 2+ ; The detection primer is a PCR detection primer designed with CAPS molecular marker Marker 9.61 as the target; preferably, the PCR detection primer consists of two polynucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4.

[0015] Another aspect of the present invention is to apply CAPS molecular markers, PCR detection primers or detection kits to identify marigold lotus and crown flower types or their genotype homozygosity and other aspects.

[0016] A preferred specific embodiment of the present invention uses the CAPS molecular marker and PCR detection primers to identify the lotus-shaped and crown-shaped flower types of marigold, comprising: (1) designing PCR detection primers using the CAPS molecular marker Marker 9.61 as the target gene; (2) using the DNA of the marigold sample to be detected as a template and the PCR detection primers designed in step (1) as upstream and downstream primers to establish a PCR detection system to perform PCR amplification on the DNA sample of the marigold to be detected; (3) if a band of 491 bp is amplified, it is effective amplification; using restriction endonuclease XbaⅠ to digest the PCR amplification product, if the digestion product is an electrophoresis band of 491 bp, the marigold sample is a lotus-shaped flower type variety; if the digestion product is two electrophoresis bands of 318 bp and 173 bp, or three electrophoresis bands of 491 bp, 318 bp and 173 bp, the marigold sample is a crown-shaped flower type variety.

[0017] A preferred specific embodiment of the present invention uses the CAPS molecular marker and PCR detection primers to identify the homozygosity of the genotype of the crown flower type of marigold, comprising: (1) designing PCR detection primers using the CAPS molecular marker Marker 9.61 as the target gene; (2) using the DNA of the sample to be detected as a template and using the PCR detection primers designed in step (1) to establish a PCR detection system to perform PCR amplification on the sample to be detected; (3) if a 491 bp band is amplified, it is effective amplification; using restriction endonuclease XbaⅠ to digest the PCR amplification product, if the digestion product is two electrophoresis bands of 318 bp and 173 bp, the flower type of the marigold sample to be detected is a crown flower type, and the genotype of the crown flower type is homozygous; if the digestion product is three electrophoresis bands of 491 bp, 318 bp and 173 bp, the flower type of the marigold sample to be detected is a crown flower type, and the genotype of the crown flower type is heterozygous.

[0018] As a preferred specific embodiment of the present invention, the reaction system of PCR amplification is: PCR Master Mix (including Taq enzyme, dNTP, Mg 2+ )12.5μL, DNA template 1μL, upstream primer 1μL, downstream primer 1μL, deionized water 9.5μL.

[0019] As a preferred specific embodiment of the present invention, the reaction procedure of PCR amplification is: 94°C for 4 min; 94°C for 30 sec, 55°C for 30 sec, 72°C for 1 min, a total of 35 cycles; 72°C for 10 min; and insulation at 20°C for 5 min.

[0020] In the nucleotide sequences of crown-shaped and lotus-shaped marigolds, the specific CAPS molecular marker Marker 9.61 of the present invention has a SNP site change (G→A), and the DNA amplification product of the homozygous lotus-shaped marigold cannot be digested by XbaⅠ, showing a band of 491bp in length; the DNA amplification product of the homozygous crown-shaped marigold is completely digested by XbaⅠ, showing two bands of 318bp and 173bp in length; the DNA amplification product of the heterozygous crown-shaped marigold is digested by XbaⅠ and shows three bands of 491bp, 318bp and 173bp in length. Therefore, the above-mentioned specific CAPS molecular marker Marker 9.61 can also be used to detect the homozygosity of the genotype of the crown-shaped marigold material trait, and the application of the specific CAPS molecular marker Marker 9.61 of the present invention in identifying the purity of the genotype of the lotus-shaped or crown-shaped marigold trait is within the protection scope of the present invention.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] The present invention constructs an F2 segregation population of lotus-shaped marigold S5 and crown-shaped marigold V02, selects 8 SNP sites that can be digested by conventional restriction endonucleases for SNPs screened out in a BSA-seq candidate interval, and designs a total of 8 pairs of primers. The gDNA of marigold S5 and V02 are PCR amplified using the 8 pairs of primers, and digested using corresponding endonucleases. Ten individual plants in two extreme pools of the F2 generation are used for preliminary verification, and the results show that the molecular marker Marker9.61 can effectively distinguish the flower types of marigolds, the lotus-shaped marigold can retain the 491bp band of the original amplification product, and the crown-shaped marigold is completely digested to present 2 bands (318bp and 173bp) or 3 bands (318bp, 173bp and 491bp). This marker can be used to screen marigolds for lotus-shaped and crown-shaped flower types at the seedling stage, thereby improving breeding efficiency and reducing the input of manpower, material resources, etc. in the later cultivation process.

[0023] Definitions of key terms and abbreviations

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods, devices and materials are now described.

[0025] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions can be achieved by generating sequences in which position 3 of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Cassol et al., (1992); Rossolini et al., Mol Cell. Probes 8:91-98 (1994)).

[0026] CAPS: digested amplified polymorphic sequences.

[0027] SNP: single nucleotide polymorphism. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Marigolds with lotus-shaped and crown-shaped flowers;

[0029] Figure 2 This is a Manhattan result diagram based on the ED method; the horizontal axis is the chromosome length (Mb); the vertical axis is the ED value; the points in the figure represent the position corresponding to each SNP and the result value calculated by the ED method; the red line in the figure represents the threshold line;

[0030] Figure 3 This is a Manhattan result diagram based on the G'value method. The horizontal axis is the chromosome position information of the marker; the vertical axis is the G'value statistical value; a point in the figure represents a SNP marker; the black line in the figure represents the fitted curve; the red line represents the threshold line;

[0031] Figure 4 This is the restriction electrophoresis diagram of the molecular marker Marker 9.61 applied to individual plants of marigold with lotus and crown flower types. DETAILED DESCRIPTION

[0032] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0033] Example 1 Screening and identification of linked molecular markers associated with marigold flower type

[0034] 1Construction of segregating populations for lotus-shaped and crown-shaped flower types in marigold

[0035] In this embodiment, Figure 1 The two flower types shown were hybridized, that is, the lotus-shaped flower type marigold inbred line S5 was used as the female parent and the crown-shaped flower type marigold V02 was used as the male parent to obtain F1, and the F1 was self-pollinated to obtain the F2 segregating population.

[0036] 2 Analysis on the genetic rules of lotus-shaped and crown-shaped flower populations of marigold

[0037] The traits of the F2 population of marigold lotus and crown were counted. There were 191 crown-shaped plants and 60 lotus-shaped plants. According to the chi-square test, the ratio of crown to lotus was 3:1, which was consistent with Mendel's law of inheritance. It was speculated that the lotus and crown of marigold were controlled by a pair of alleles, in which the crown was a dominant trait and the lotus was a recessive trait.

[0038] 3. Pool construction and BSA-seq sequencing

[0039] Using the BSA method, we constructed a mixed pool of marigold S5 and V02 parents and two extreme trait mixed pools in the F2 population: 6 individual plants were selected from each parent S5 and V02, 3 leaflets were collected from each plant, and mixed to construct a S5 and V02 mixed pool (S5-pool and V02-pool); 30 lotus-shaped flower-type plants were selected from the F2 segregation population, 3 leaflets were collected from each plant to form a lotus-shaped pool (F2-S5-pool), and 30 crown-shaped flower-type plants were selected, 3 leaflets were collected from each plant to form a crown pool (F2-V02-pool). The samples were sent to the company for Illumina NovaSeq TMThe platform was used for sequencing, low-quality data were filtered, high-quality data (CleanData) were obtained, and CleanData was aligned to the marigold reference genome (Xin et al 2023). The specific data are shown in Table 1. The number of clean reads obtained from the four samples ranged from 45387924 to 124886862, the sequencing quality Q30 was 94.99% to 95.99%, and the GC content obtained by sequencing was 36.05% to 36.95%. This indicates that the sequencing quality is high and can be used for subsequent analysis.

[0040] Table 1 BSA-seq sequencing quality statistics

[0041]

[0042]

[0043] 4 Development of molecular markers linked to marigold flower type

[0044] The Euclidean distance (ED) algorithm was used to find the SNP markers with significant differences between the mixed pools and evaluate the regions associated with the traits. The candidate regions were screened using the quantile 99.9% as the threshold, and the target gene was located at 8.24Mb-8.84Mb ( Figure 2 ). At the same time, the G statistical method was used to take the G value corresponding to the 0.999 quantile as the screening threshold, and the candidate region containing at least 10 variant sites above the threshold line was selected. The screening candidate interval was located at 7.52Mb-10.79Mb on chromosome 2 of marigold ( Figure 3 ). Combining the ED algorithm and the G algorithm, the candidate interval was determined to be 7.52Mb-10.79Mb. For the SNPs screened out in the BSA-seq candidate interval, 8 SNP sites that can be digested by conventional restriction endonucleases were selected. The marker names of the 8 SNP sites, the mutation positions in the marigold genome, the base changes, and the corresponding restriction endonucleases are shown in Table 2. 8 pairs of primers were designed to perform PCR amplification on the gDNA of marigold S5 and V02, respectively, and digested with the corresponding endonucleases. Ten single plants in each of the two extreme pools of the F2 generation were used for preliminary verification, and all 8 pairs of primers can be further verified in the F2 generation population.

[0045] Table 2 Information on SNP loci associated with marigold crown flower shape

[0046]

[0047]

[0048] The PCR reaction system is 25 μL, including 1 μL of 100 ng / μL template DNA, PCR Master Mix (including Taq enzyme, dNTP, Mg 2+ ) 12.5μL, 10μmol / L upstream primer and downstream primer 1μL each, deionized water 9.5μL. The PCR reaction program was 94℃ pre-denaturation for 4min; 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 1min, 35 cycles; 72℃ total extension for 10min; 20℃ incubation for 5min. The amplified product was detected by 1% agarose gel electrophoresis.

[0049] The enzyme digestion system was 14 μL in total, including 4 μL of PCR amplification product, 8.5 μL of deionized water, 0.5 μL of restriction endonuclease, and 1 μL of 10×FastDigest Green Buffer. The enzyme digestion reaction conditions were incubation at 37°C for 1-1.5 hours. The enzyme digestion products were detected using 1.5% agarose gel.

[0050] The gDNA of 64 F2 population plants was amplified and digested with 8 pairs of primers. The results showed that Marker 9.61 could distinguish the flower types of marigolds well. That is, after digestion, there was only one electrophoresis band of 491 bp, which was a lotus-shaped flower type; after digestion, there were two electrophoresis bands of 318 bp and 173 bp, or three electrophoresis bands of 491 bp, 318 bp and 173 bp, which indicated that the marigold sample was a crown-shaped flower type ( Figure 4 ).

[0051] The nucleotide sequence of Marker 9.61 in lotus-shaped marigold is shown below: TCTCGCCTCACGAAAAAGATCTCTAACTCTAGCAGCACCTCTACCAACAAAAACCTCAACCAATTCACTACCAGATATTGAGAAAAACGACATTCCAGCTTCTCCAGCAACAGCACGAGCCAACAATGTCTTCCCGGTTCCTGGTGGACCGGCTAACAGGACACCTTTTGGCGGCTTTGCCCCAAGTTTTATGTATTTGCTGTCTCCTTTCATGCACAACACAATCTACAAAAGTCAAAGTGCAAGATTCATCATGTCAAAATTCAATATGATAATAAGCAAGTAAGCGTTTTAATAACTAGTATAACAGCATTACCTCTAAAAGTTCAGTTTTGGCAGCATCAACACCTTTTACATCATCAAATGTTACTAATGATTGCTTCTTACTTGGTTTTTTCTTAGTCATTTTCCCAAGATCATGTTGAAGGTTAAGCTGGTAAAAAGTAAGCATCACCATGATCCAAAAAGGAGCCACTTGAAAGAAAACAAAC(SEQ ID NO.1).

[0052] The nucleotide sequence of marker 9.61 in crown-flowered marigold is as follows: TCTCGCCTCACGAAAAAGATCTCTAACTCTAGCAGCACCTCTACCAACAAAAACCTCAACCAATTCACTACCAGATATTGAGAAAAACGACATTCCAGCTTCTCCAGCAACAGCACGAGCCAACAATGTCTTCCCGGTTCCTGGTGGACCGGCTAACAGGACACCTTTTGGCGGCTTTGCCCCAAGTTTTATGTATTTGCTGTCTCCTTTCATGCACAACACAATCTACAAAAGTC AAAGTGCAAGATTCATCATGTCAAAATTCAATATGATAATAAGCAAGTAAGCGTTTTAATAACTAGTATAACAGCATTACCTCTAGAAGTTCAGTTTTGGCAGCATCAACACCTTTTACATCATCAAATGTTACTAATGATTGCTCTTACTTGGTTTTTTCTTAGTCATTTTCCCAAGATCATGTTGAAGGTTAAGCTGGTAAAAAGTAAGCATCACCATGATCCAAAAAGGAGCCACTTGAAAGAAAACAAAC (SEQ ID NO.2).

[0053] Experimental Example 1: Using the common CTAB method to extract DNA and using the marigold flower type linked molecular marker Marker 9.61 to identify the lotus and crown flower types of marigold

[0054] 1 Test method

[0055] (1) Take 3-5 fresh marigold leaves, extract their genomic DNA using the 2×CTAB method, detect the DNA quality using 1% agarose gel, and detect the DNA purity using an ultraviolet spectrophotometer. Then dilute the extracted DNA to 100 ng / μL for later use.

[0056] (2) Using the marigold genomic DNA to be detected as a template and Marker 9.61 as a target, upstream and downstream primers were designed, and their base sequences were:

[0057] Marker 9.61-F (upstream primer): TCTCGCCTCACGAAAAAGATCTCT (SEQ ID NO. 3);

[0058] Marker 9.61-R (downstream primer): GTTTGTTTTCTTTCAAGTGGCTCCT (SEQ ID NO. 4).

[0059] (3) PCR reaction system: 1 μL of 100 ng / μL DNA template, PCR Master Mix (containing Taq enzyme, dNTP, Mg 2+ )12.5μL, upstream primer 1μL, downstream primer 1μL, deionized water 9.5μL.

[0060] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 35 cycles; 72°C for 10 min; and insulation at 20°C for 5 min.

[0061] (4) Detect the amplified product by 1% agarose gel electrophoresis. If a 491bp band appears, it indicates effective amplification. Then, the PCR product is digested with restriction endonuclease XbaⅠ. The digestion system is 14μL: 4μL of PCR amplified product, 8.5μL of deionized water, 0.5μL of restriction endonuclease XbaⅠ, and 1μL of 10×FastDigest Green Buffer. The digestion reaction conditions are incubation at 37℃ for 1-1.5h. Detect the digestion product by 1.5% agarose gel. If only one electrophoresis band of 491bp is detected, the marigold sample is a lotus-shaped flower type; if two electrophoresis bands of 318bp and 173bp are detected, or three electrophoresis bands of 491bp, 318bp and 173bp are detected, the marigold sample is a crown-shaped flower type.

[0062] 2 Test results

[0063] Marker 9.61 was used to verify the F2 segregation population of 251 marigolds, of which 60 were lotus-shaped plants and 191 were crown-shaped plants. After restriction digestion of the 60 lotus-shaped plants, 59 of them had only one amplification band of 491bp, and one had three bands of 491bp, 318bp and 173bp, which was an exchange plant. Two electrophoresis bands of 318bp and 173bp or three bands of 491bp, 318bp and 173bp were detected in 191 crown-shaped plants, and there was no exchange plant. The detection efficiency of 251 plants reached 99.60%.

[0064] Experimental Example 2: Using NaOH to extract DNA quickly and applying marigold flower type linked molecular marker Marker9.61 to identify marigold lotus and crown flower types

[0065] 1 Test method

[0066] (1) Take 2-3 fresh marigold leaves, extract their genomic DNA using the NaOH rapid extraction method, and detect the DNA quality using 1% agarose gel.

[0067] (2) The upstream and downstream primers of Marker 9.61 are the same as those in Experimental Example 1;

[0068] (3) PCR reaction system: DNA template 1 μL, PCR Master Mix (containing Taq enzyme, dNTP, Mg 2+ )12.5μL, upstream primer 1μL, downstream primer 1μL, deionized water 9.5μL.

[0069] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 35 cycles; 72°C for 10 min; and insulation at 20°C for 5 min.

[0070] (4) Detect the amplified product by 1% agarose gel electrophoresis. If a 491bp band appears, it indicates effective amplification. Then, the PCR product is digested with restriction endonuclease XbaⅠ. The digestion system is 14μL: 4μL of PCR amplified product, 8.5μL of deionized water, 0.5μL of restriction endonuclease XbaⅠ, and 1μL of 10×FastDigest Green Buffer. The digestion reaction conditions are incubation at 37℃ for 1-1.5h. Detect the digestion product by 1.5% agarose gel. If only one electrophoresis band of 491bp is detected, the marigold sample is a lotus-shaped flower type; if two electrophoresis bands of 318bp and 173bp are detected, or three electrophoresis bands of 491bp, 318bp and 173bp are detected, the marigold sample is a crown-shaped flower type.

[0071] 2 Test results

[0072] Marker 9.61 was used to verify the F2 segregation population of 239 marigold lotus and crown flower types, of which 44 were lotus-shaped plants and 195 were crown-shaped plants. After restriction digestion, all 44 lotus-shaped plants had only one amplified band of 491bp, while 195 crown-shaped plants were detected with two electrophoresis bands of 318bp and 173bp or three bands of 491bp, 318bp and 173bp, with a detection efficiency of up to 100%.

Claims

1. CAPS molecular marker Marker 9.61 for identifying lotus-shaped and crown-shaped flower types of marigold, characterized in that: The nucleotide sequence of the CAPS molecular marker Marker 9.61 in lotus-shaped marigold is shown as SEQ ID NO.1, and the nucleotide sequence of the CAPS molecular marker Marker 9.61 in crown-shaped marigold is shown as SEQ ID NO.

2.

2. PCR detection primers for detecting the CAPS molecular marker Marker 9.61 described in claim 1.

3. The PCR detection primer according to claim 2, characterized in that The PCR detection primers consist of an upstream primer whose nucleotide sequence is shown in SEQ ID NO.3 and a downstream primer whose nucleotide sequence is shown in SEQ ID NO.

4.

4. A PCR detection kit for identifying lotus-shaped and crown-shaped flower types of marigold, comprising: PCRMasterMix, PCR detection primers; characterized in that the PCR Master Mix includes: Taq enzyme, dNTP, Mg 2+ ; The PCR detection primer is the PCR detection primer described in claim 2 or 3.

5. Use of the CAPS molecular marker Marker 9.61 described in claim 1 in the identification or detection of lotus-shaped and crown-shaped flower types of marigold, or use of the PCR detection primers described in claim 2 or 3 in the identification or detection of lotus-shaped and crown-shaped flower types of marigold.

6. Use of the CAPS molecular marker Marker 9.61 described in claim 1 in the identification or detection of the homozygosity of the crown flower type genotype of marigold, or use of the PCR detection primers described in claim 2 or 3 in the identification or detection of the homozygosity of the crown flower type genotype of marigold.

7. The use according to claim 5, characterized in that: include: (1) Designing PCR detection primers using the CAPS molecular marker Marker 9.61 described in claim 1 as the target gene; (2) using the DNA of the marigold sample to be tested as a template and the PCR detection primers designed in step (1) as upstream and downstream primers to establish a PCR detection system to perform PCR amplification on the DNA sample of the marigold to be tested; (3) if a 491 bp band is amplified, it is effective amplification; using restriction endonuclease XbaⅠ to digest the PCR amplification product, if the digestion product is a 491 bp electrophoresis band, the marigold sample is a lotus-shaped flower type variety; If the enzyme cleavage products are two electrophoretic bands of 318 bp and 173 bp, or three electrophoretic bands of 491 bp, 318 bp and 173 bp, then the marigold sample is a crown-flower type variety.

8. The use according to claim 6, characterized in that: include: (1) Designing PCR detection primers using the CAPS molecular marker Marker 9.61 described in claim 1 as the target gene; (2) using the DNA of the sample to be tested as a template and the PCR detection primers designed in step (1) to establish a PCR detection system to perform PCR amplification on the sample to be tested; (3) If a band of 491 bp is amplified, it is effective amplification; the PCR amplification product is digested with restriction endonuclease XbaⅠ. If the digestion product is two electrophoretic bands of 318 bp and 173 bp, the flower type of the marigold sample to be tested is a crown flower type, and the genotype of the crown flower type is homozygous; if the digestion product is three electrophoretic bands of 491 bp, 318 bp and 173 bp, the flower type of the marigold sample to be tested is a crown flower type, and the genotype of the crown flower type is heterozygous.

9. The use according to claim 7 or 8, characterized in that: The reaction system of the PCR amplification is: PCR Master Mix 12.5μL, DNA template 1μL, upstream primer 1μL, downstream primer 1μL, deionized water 9.5μL.

10. The use according to claim 7 or 8, characterized in that The reaction procedure of the PCR amplification is: 94°C for 4 min; 94°C for 30 sec, 55°C for 30 sec, 72°C for 1 min, for a total of 35 cycles; 72°C for 10 min; and 20°C for 5 min.

Images