A 10K liquid-phase chip for Porphyra yezoensis, its design method and application

Abstract

The present invention relates to the field of molecular detection technology, and specifically discloses a 10K liquid-phase chip for Pyropia yezoensis, its design method and application; the genotyping sites of the 10K liquid-phase chip for Pyropia yezoensis include 12,942 SNP sites; the physical positions of the 12,942 SNP sites are determined based on the whole-genome sequence alignment of the reference genome of Pyropia yezoensis, and the version number of the whole-genome sequence of the reference genome of Pyropia yezoensis is GCA_009829735.1. The present invention can achieve population structure analysis and genome-wide association analysis of Pyropia yezoensis.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular detection, and particularly relates to a 10K liquid chip for Porphyra yezoensis, and a design method and application thereof. Background Art

[0002] Porphyra yezoensis is an important large economic seaweed in China and Asia. Resequencing it and developing high-density SNP markers are helpful for performing association analysis of important economic traits of Porphyra yezoensis at the whole-genome level and population structure analysis, and providing support for genome-wide selection breeding. Therefore, it is essential to establish an effective, rapid, stable, high-throughput and low-cost genotype identification method.

[0003] Currently, SNP-based gene chips have been developed in multiple crops, but there is still a blank in large seaweeds. Summary of the Invention

[0004] The purpose of the present invention is to provide a 10K liquid chip for Porphyra yezoensis, and a design method and application thereof, so as to realize population structure analysis and genome-wide association analysis of Porphyra yezoensis.

[0005] The present invention is realized through the following technical solutions:

[0006] A 10K liquid chip for Porphyra yezoensis, the genotyping sites of the 10K liquid chip for Porphyra yezoensis include 12,942 SNP sites; the physical positions of the 12,942 SNP sites are determined based on the whole-genome sequence alignment of the reference genome of Porphyra yezoensis, and the version number of the whole-genome sequence of the reference genome of Porphyra yezoensis is GCA_009829735.1; among them, the 12,942 SNP sites are as shown in Table 1 of the specification.

[0007] Table 1

[0008]

[0009]

[0010]

[0011]

[0012]

[0013]

[0014]

[0015]

[0016]

[0017]

[0018]

[0019]

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152] Note: In the genomic location, the number before " - " represents the chromosome, and the number after " - " represents the physical position of the locus on the corresponding chromosome.

[0153] The 12,942 SNP loci of the present invention are obtained by screening based on the DNA samples of Pyropia yezoensis, and the obtained 12,942 SNP loci can be used as the basis for genotyping Pyropia yezoensis; the liquid chip designed according to the 12,942 SNP loci can quickly and low-costly achieve genotyping of the target SNP loci, and the obtained genotyping data can be used for population structure analysis and genome-wide association analysis of Pyropia yezoensis.

[0154] In a preferred embodiment, the 10K liquid chip of Pyropia yezoensis further includes probes designed according to the gene sequences covering 12,942 SNP loci.

[0155] A method for designing a 10K liquid chip of Pyropia yezoensis, comprising the following steps:

[0156] S1. Obtain the original SNP loci;

[0157] S2. Align the original SNP loci with the target reference genome to ensure that the original SNP loci are consistent with the target reference genome;

[0158] S3. Screen out the functional SNP loci from the original SNP loci that can successfully design probes;

[0159] S4. From the screened functional SNP loci, according to the principle of uniform distribution in the genome, screen out 12,942 SNP loci, which are the target SNP loci.

[0160] In a preferred embodiment, in step S3, the screening process includes locus filtering and locus evaluation.

[0161] In a preferred embodiment, the conditions for locus filtering include a minimum sequencing depth ≥ 5X, a deletion rate < 10%, a MAF > 0.35, and a heterozygosity rate < 10%.

[0162] In a preferred embodiment, the principles for locus evaluation include a probe length of 110 bp, a probe GC content of 30% - 70%, and the number of homologous regions ≤ 5.

[0163] In a preferred embodiment, in step S3, when screening for functional SNP loci, it is required that the coverage rate of the probe design segment is greater than or equal to 70%.

[0164] Application of a 10K liquid chip of Pyropia yezoensis in the analysis of the population structure of Pyropia yezoensis.

[0165] Application of a 10K liquid chip of Pyropia yezoensis in the genome-wide association analysis of Pyropia yezoensis.

[0166] Application of a 10K liquid chip of Pyropia yezoensis in the breeding of Pyropia yezoensis.

[0167] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0168] The liquid chip designed according to 12,942 SNP loci in the present invention can quickly and low-costly achieve genotyping of target SNP loci, and the obtained genotyping data can be used for population structure analysis and genome-wide association analysis of Pyropia yezoensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0169] The drawings described herein are used to provide a further understanding of the embodiments of the present invention, form a part of this application, and do not limit the embodiments of the present invention. In the drawings:

[0170] Figure 1 It is a statistical chart of the chromosomal distribution of SNP markers drawn based on 12,942 SNP loci in Example 1 of the present invention; wherein, the vertical coordinate Length on the right represents the chromosome length; the vertical coordinate Count on the left represents the number of loci and the number of segments;

[0171] Figure 2 It is a chromosomal distribution diagram of SNP markers drawn based on 12,942 SNP loci in Example 1 of the present invention;

[0172] Figure 3 It is a Gap distribution diagram drawn based on 12,942 SNP loci in Example 1 of the present invention, wherein the abscissa Chrom represents the chromosome, and the Position represents the position of the Gap on the chromosome;

[0173] Figure 4This is the MAF distribution statistical chart drawn based on 12,942 SNP loci in Example 1 of the present invention; wherein, the abscissa MAF represents different ranges of the minor allele frequency, and the ordinate Count represents the number of loci in each MAF range;

[0174] Figure 5 This is the SNP marker type statistical chart drawn based on 12,942 SNP loci in Example 1 of the present invention; wherein, the abscissa Type represents different locus types, and the ordinate Count represents the number of that locus type;

[0175] Figure 6 This is the PCA population distribution chart drawn based on 12,942 SNP loci in Example 1 of the present invention;

[0176] Figure 7 This is the phylogenetic tree drawn based on 12,942 SNP loci in Example 1 of the present invention;

[0177] Figure 8 This is the polymorphism statistical chart drawn based on 12,942 SNP loci in Example 1 of the present invention; wherein, the abscissa Diversity represents the diversity between samples, and the ordinate Count represents the number of sample combinations in each diversity range;

[0178] Figure 9 This is the principal component analysis chart of the population structure analysis of the genotypes of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 3 of the present invention;

[0179] Figure 10 This is the phylogenetic tree chart of the population structure analysis of the genotypes of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 3 of the present invention;

[0180] Figure 11 This is the line chart of the CV value change at different K values for the population structure analysis of the genotypes of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 3 of the present invention;

[0181] Figure 12 This is the leaf length Manhattan chart for the genome-wide association analysis of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 4 of the present invention. The dotted line in the figure represents the screening threshold (−log10(P) = 5.03;

[0182] Figure 13This is the leaf length Q-Q plot during the genome-wide association analysis of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 4 of the present invention. Here, the abscissa expected −log10(P) represents the logarithm of the theoretical expected value, and the ordinate Observed −log10(P) represents the logarithm of the measured expected value;

[0183] Figure 14 This is the leaf width Manhattan plot during the genome-wide association analysis of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 4 of the present invention. The dashed line in the figure represents the screening threshold (−log10(P) = 5.03;

[0184] Figure 15 This is the leaf width Q-Q plot during the genome-wide association analysis of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 4 of the present invention. Here, the abscissa expected −log10(P) represents the logarithm of the theoretical expected value, and the ordinate Observed −log10(P) represents the logarithm of the measured expected value;

[0185] Figure 16 This is the fresh weight Manhattan plot during the genome-wide association analysis of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 4 of the present invention. The dashed line in the figure represents the screening threshold (−log10(P) = 5.03;

[0186] Figure 17 This is the fresh weight Q-Q plot during the genome-wide association analysis of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 4 of the present invention. Here, the abscissa expected−log10(P) represents the logarithm of the theoretical expected value, and the ordinate Observed −log10(P) represents the logarithm of the measured expected value;

[0187] Figure 18 This is the dry weight Manhattan plot during the genome-wide association analysis of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 4 of the present invention. The dashed line in the figure represents the screening threshold (−log10(P) = 5.03;

[0188] Figure 19 This is the dry weight Q-Q plot during the genome-wide association analysis of 146 Pyropia yezoensis samples using the liquid chip prepared in Example 1 in Example 4 of the present invention. Here, the abscissa expected−log10(P) represents the logarithm of the theoretical expected value, and the ordinate Observed−log10(P) represents the logarithm of the measured expected value. Detailed implementation manners

[0189] To make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the embodiments and the accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and do not limit the present invention. The following described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts fall within the scope of protection of the present invention.

[0190] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is obvious to those of ordinary skill in the art that the present invention does not have to employ these specific details. In other embodiments, well-known structures, materials or methods are not specifically described in order to avoid obscuring the present invention. The materials, instruments and reagents used in the following embodiments can be obtained from commercial sources without special instructions. The technical means used in the embodiments are conventional means well-known to those skilled in the art without special instructions.

[0191] Example 1:

[0192] Design and preparation of the 10K liquid-phase chip for Porphyra yezoensis:

[0193] S1. Resequence the DNA samples of 90 Porphyra yezoensis individuals (the individual sequencing depth is 10X) and perform a merging process to obtain 1,070,946 SNP loci, which are the original SNP loci.

[0194] The 90 Porphyra yezoensis individuals include 21 individuals of the Lianyungang cultured strain (L-X), 21 individuals of the Rushan cultured strain (X-X), 18 individuals of the Yantai wild strain (Y-X), 17 individuals of the Qingdao wild strain (Z-X), and 13 individuals of the Weihai wild strain (W-X).

[0195] S2. Use the software BWA (-mem v0.7.17, parameters: -t10 -M -R) to align and remove duplicates of the original SNP loci with the target reference genome (the Porphyra yezoensis reference genome GCA_009829735.1 (GCA_009829735.1_ASM982973v1_genomic.fna)) to ensure that the original SNP loci are consistent with the target reference genome, and obtain 1,070,946 SNP loci that are consistent with the target reference genome.

[0196] S3. Screen out the functional SNP loci from the original SNP loci that can be successfully designed into probes: The screening process includes site filtering and site evaluation in sequence:

[0197] 89,284 SNP sites were selected for evaluation and probe design according to the conditions of a minimum sequencing depth ≥5X, a deletion rate <10%, a MAF >0.35, and a heterozygosity rate <10%. Among them, 63,562 SNP sites were successfully evaluated. The principles of site evaluation include a probe length of 110 bp, a probe GC content of 30%-70%, and the number of homologous regions ≤5.

[0198] S4. From the selected functional SNP sites, 12,942 SNP sites were screened according to the principle of uniform distribution in the genome, which are the target SNP sites; the 12,942 SNP sites are shown in Table 1.

[0199] The statistical chart of the chromosomal distribution of SNP markers drawn based on the above 12,942 SNP sites is as Figure 1 shown; the chromosomal distribution map of SNP markers drawn based on the above 12,942 SNP sites is as Figure 2 shown; the Gap distribution map drawn based on the above 12,942 SNP sites is as Figure 3 shown; the statistical chart of the MAF distribution drawn based on the above 12,942 SNP sites is as Figure 4 shown; the statistical chart of the SNP marker type drawn based on the above 12,942 SNP sites is as Figure 5 shown; the PCA population distribution map drawn based on the above 12,942 SNP sites is as Figure 6 shown; the phylogenetic tree drawn based on the above 12,942 SNP sites is as Figure 7 shown; the statistical chart of polymorphism drawn based on the above 12,942 SNP sites is as Figure 8 shown.

[0200] S5. Obtaining the nucleotide probe combination:

[0201] Using the GenoBaits Probe Designer software, probe design was carried out according to the evaluation results of the sequences upstream and downstream of the target sites; referring to the above principles of site evaluation for probe design, the probe length is 110 bp, and the DNA nucleotide sequence with a biotin group modification at the 5' end.

[0202] The above-obtained probe combination was adjusted with the 12,942 SNP sites in Table 1, and finally a nucleotide probe combination capable of capturing 12,942 SNP sites was obtained.

[0203] Since the probes are determined based on SNP sites according to the principle of DNA complementarity, those skilled in the art can determine the corresponding probe sequences when they know the SNP sites, and will not list them one by one here. For example, there are 2 probe sequences corresponding to CM020618.1_1114274, which are shown as SEQ ID NO.1: TCCCCGCCGCTGCCGAGGCGGTCCTGGCAGCAGACCTGACCGACGTGTGTGTGCGTTGGGGGCTGTTGTCGTCGTGTGACGAGAGAAGGGGGGGGGGAGGGGGAGATGGG; and SEQ ID NO.2: CAGCAGACCTGACCGACGTGTGTGTGCGTTGGGGGCTGTTGTCGTCGTGTGACGAGAGAAGGGGGGGGGGAGGGGGAGATGGGGCGCTCTGGGCGTTTTGGTGGAGTGCG.

[0204] The evaluation results of this embodiment are shown in Table 2:

[0205] Table 2

[0206]

[0207] Remarks:

[0208] 1. The evaluation results are the results of probe design. It is not certain that the target sites can be captured as long as the probes are designed. 2. Probe design section coverage rate = number of target sections for which probes are designed / number of target sections. 3. If the probe type is chip-synthesized probe, the total number of probe designs will not be shown.

[0209] The liquid chip is designed with probes covering the target SNP at each site to be tested according to the principle of DNA complementarity, and the target probes are modified with biotin labeling. Then, in the liquid state, the biotin-modified probes are hybridized with the target region of the genome to form double strands. Subsequently, streptavidin-coated magnetic beads are used to molecularly adsorb the biotin-modified probes, thereby capturing the targets hybridized with the probes. Finally, the captured target sequences are eluted, target amplified, and sequenced to finally obtain the genotypes of the target SNPs.

[0210] Finally, the prepared Pyropia yezoensis 10K liquid chip in this embodiment includes a set of nucleotide probes for detecting 12,942 SNP sites. The physical positions of the 12,942 SNP sites are determined based on the whole-genome sequence alignment of the Pyropia yezoensis reference genome, and the version number of the whole-genome sequence of the Pyropia yezoensis reference genome is GCA_009829735.1; among them, the 12,942 SNP sites are shown in Table 1 of the specification.

[0211] The 10K liquid-phase chip of Porphyra yezoensis prepared in this example was used for the detection of 12 samples, and the test results are shown in Table 3:

[0212] Table 3

[0213]

[0214] Among the 12 test samples in Table 3, the detection rate was between 98.25% and 99.01%, and the average detection rate was 98.62%, indicating that the 10K liquid-phase chip of Porphyra yezoensis has high detection accuracy.

[0215] Example 2:

[0216] A method for obtaining genotype data of Porphyra yezoensis using the 10K liquid-phase chip of Porphyra yezoensis prepared in Example 1 includes the following steps:

[0217] Step 1: Genomic DNA extraction

[0218] Select the thallus of Porphyra yezoensis, extract nucleic acids using a plant genomic DNA extraction kit produced by Shijiazhuang Borui Biotechnology Co., Ltd., and accurately quantify the concentration of the extracted DNA using Qubit.

[0219] Step 2: DNA fragmentation and end repair

[0220] PCR amplification system: 300 ng of DNA; 2.6 μL of end repair enzyme, 4 μL of buffer; make up the system to 20 μL with nuclease-free water.

[0221] PCR amplification program: 37°C for 20 min; 72°C for 20 min.

[0222] Step 3: Introduce a linker ligation system by PCR in the system of Step 2;

[0223] PCR system: 4 μL of linker; 2 μL of ligase; 8 μL of buffer; make up to 20 μL with nuclease-free water.

[0224] PCR amplification program: 22°C for 60 min.

[0225] Step 4: Purify the product of the ligation system;

[0226] 4.1 Add magnetic beads to the PCR product and mix well;

[0227] 4.2 Let it stand at room temperature for 5 min and then centrifuge briefly;

[0228] 4.3 Place the PCR tube on a magnetic stand until the solution becomes clear;

[0229] 4.4 Carefully remove the supernatant, ensuring not to aspirate the magnetic beads.

[0230] 4.5 Keep the PCR tube / plate in the magnetic stand, add 100 μL of 80% ethanol, and let it stand at room temperature for 30 s.

[0231] 4.6 Remove the supernatant, keep the PCR tube / plate in the magnetic stand, and place it at room temperature until the ethanol has completely evaporated.

[0232] Step 5: Use the extracted genomic DNA of Porphyra yezoensis as a template for PCR amplification to obtain a DNA library.

[0233] PCR amplification system: Add 10 μL of the mixture of PCR enzyme and buffer to the product of Step 4; 2 μL of sequencing barcode; make up the system to 20 μL with nuclease-free water.

[0234] PCR amplification program: 98 °C for 2 min for 1 cycle; (98 °C for 30 s, 65 °C for 30 s, 72 °C for 40 s) for 5 cycles; 72 °C for 4 min for 1 cycle.

[0235] Step 6: Purify the obtained DNA library.

[0236] 6.1 Add 20 μl of GenoPrep DNA Clean Beads to the product obtained in Step 6, mix well by shaking, and do not generate bubbles during the shaking process.

[0237] 6.2 After standing for 5 min, centrifuge briefly.

[0238] 6.3 Place the PCR tube / plate on the magnetic stand until the solution is clear, which is expected to stand at room temperature for at least 3 min.

[0239] 6.4 Remove the supernatant, ensuring not to aspirate the magnetic beads.

[0240] 6.5 Keep the PCR tube / plate in the magnetic stand, add 100 μL of 80% ethanol. Let it stand at room temperature for 30 seconds.

[0241] 6.6 Remove the supernatant, keep the PCR tube / plate in the magnetic stand, and place it at room temperature until the ethanol has evaporated completely.

[0242] 6.7 Remove the PCR tube or plate from the magnetic stand, add 35 μL of Eultion Buffer, mix well by shaking, and after standing for 5 min, centrifuge briefly.

[0243] 6.8 Place the PCR tube on the magnetic stand until the solution is clear.

[0244] 6.9 Transfer the supernatant to a new 0.2 ml low-binding PCR tube / plate.

[0245] Step 7: Mix the purified DNA libraries in equal amounts.

[0246] Step 8: Concentrate the mixed libraries and add them to the hybridization system, and perform hybridization capture with the prepared probes;

[0247] PCR amplification system: 1.5 - 2.5 μg of the mixed libraries; 300 ng of the probes; make up the system to 16 μl with nuclease-free water.

[0248] PCR amplification program: 95°C for 10 min (hot lid temperature 105°C); 65°C for 2 - 4 h (hot lid temperature 75°C).

[0249] Step 9: Elute to remove unbound DNA

[0250] 9.1 After the hybridization in Step 9 is completed, open the lid of the PCR instrument and the lid of the PCR tube, and transfer 16 μL of the hybridization capture solution to the prepared magnetic beads.

[0251] 9.2 Vortex for 10 s to mix well, and centrifuge briefly.

[0252] 9.3 Place the PCR tube in the PCR instrument at 65°C for 45 min, with the hot lid temperature at 75°C.

[0253] 9.4 Every 12 min, shake for 5 s and centrifuge briefly.

[0254] 9.5 Add 100 μL of elution buffer preheated to 65°C to each PCR tube.

[0255] 9.6 Vortex briefly for 5 s and centrifuge for 5 s.

[0256] 9.7 Place the PCR tube on the magnetic stand until the magnetic beads are completely separated from the solution.

[0257] 9.8 Use a pipette to remove the supernatant, retain the magnetic beads, and place the PCR tube in the PCR instrument at 65°C.

[0258] 9.9 Add 150 μL of GenoBaits 1X Stringent Wash Buffer preheated to 65°C, and slowly pipette up and down 10 times to mix the magnetic beads well. After the last group of samples is mixed, place it on the PCR instrument for 2 min.

[0259] 9.10 Place the PCR tube on the magnetic stand until the magnetic beads are completely separated from the solution, and quickly remove the supernatant with a pipette.

[0260] 9.11 Transfer the PCR tube from the magnetic stand, add 150 μL of room temperature elution buffer I, and shake for 2 min.

[0261] 9.12 Place the PCR tube on the magnetic stand until the magnetic beads are completely separated from the solution. Use a pipette to remove the supernatant.

[0262] 9.13 Transfer the PCR tube from the magnetic stand, add 150 μL of room temperature elution buffer II, and shake for 1 min.

[0263] 9.14 Place the PCR tube on the magnetic stand until the magnetic beads are completely separated from the solution. Use a pipette to remove the supernatant.

[0264] 9.15 Add 150 μL of room temperature elution buffer III, and shake for 30 s.

[0265] 9.16 Place the PCR tube on the magnetic stand until the magnetic beads are completely separated from the solution. Use a pipette to remove the supernatant.

[0266] 9.17 Remove the tube containing the captured DNA magnetic beads from the magnetic stand, add 20 μL of nuclease-free water. Slowly pipette up and down 10 times to ensure that all magnetic beads are resuspended.

[0267] Step 10: Enrich the library.

[0268] PCR system: DNA enriched on magnetic beads in step 9; 15 μL of enzyme mixture; 1.2 μL of primer; nuclease-free water to make up the system to 30 μL.

[0269] PCR amplification program: 98°C for 45 s for 1 cycle; (98°C for 15 s, 60°C for 30 s, 72°C for 30 s) for 13 cycles; 72°C for 1 min.

[0270] Step 11: Purify the enriched product to complete the preparation of the sequencing library

[0271] 11.1 Place the PCR tube on the magnetic stand until the solution is clear;

[0272] 11.2 Transfer the supernatant to a new PCR tube;

[0273] 11.3 Add 45 μl of magnetic beads to each reaction and shake well.

[0274] 11.4 Let stand at room temperature for 5 min and then centrifuge briefly;

[0275] 11.5 Place the PCR tube on the magnetic stand until the solution is clear;

[0276] 11.6 Use a pipette to remove the supernatant;

[0277] 11.7 Keep the PCR tube on the magnetic rack and add 100 μL of 80% ethanol. Incubate at room temperature for 30 seconds;

[0278] 11.8 Remove the supernatant with a pipette;

[0279] 11.9 Keep the PCR tube on the magnetic rack and place it at room temperature until the ethanol has completely evaporated;

[0280] 11.10 Transfer the PCR tube from the magnetic rack to room temperature, add 35 μL of elution buffer, and mix by vortexing. After standing at room temperature for 5 min, centrifuge briefly.

[0281] 11.11 Place the PCR tube on the magnetic rack until the solution becomes clear;

[0282] 11.12 Transfer the supernatant to a new 0.2 mL low-binding tube, making sure not to aspirate the magnetic beads. The purified DNA library can be stored at -20 °C until needed for sequencing.

[0283] Step 12: Mix the sequencing libraries in equal amounts and perform high-throughput sequencing using the BGI T7 sequencer;

[0284] Step 13: Split the raw sequencing bases according to the barcodes of different materials, filter the low-quality sequencing data, align them back to the Porphyra yezoensis reference genome, and perform variant mining;

[0285] Step 14: Obtain the corresponding genotypes based on the obtained SNP information.

[0286] Example 3:

[0287] Application of the 10K liquid chip of Porphyra yezoensis prepared in Example 1 in the population structure analysis of Porphyra yezoensis:

[0288] Population structure analysis is a method used to study the genetic structure of populations and the genetic relationships among individuals. By analyzing genotype data, it divides individuals into different subgroups or populations and evaluates the genetic similarity and genetic differences among individuals. Commonly used population structure analysis methods include: (1) Cluster Analysis: By using clustering algorithms, it divides individuals into different groups or subgroups and evaluates the genetic differences among individuals and the population structure; (2) Principal Component Analysis (PCA): It transforms high-dimensional genotype data into low-dimensional principal components in a way of dimensionality reduction, revealing the genetic similarity and population structure among individuals; (3) Structure analysis: Based on Bayesian statistical models, through model selection and parameter estimation, it divides individuals into different subgroups or populations and estimates the probability distribution of individuals in each subgroup.

[0289] Genotype data of 146 Porphyra yezoensis samples were obtained using the 10K liquid-phase chip of Porphyra yezoensis prepared in Example 1. The 146 samples included 81 wild strains from Yantai, corresponding to the YT population, and 65 wild strains from Weihai, corresponding to the WH population.

[0290] Based on the eigenvectors of the genotypes of the above 146 Porphyra yezoensis samples, in this example, the principal components PC1 and PC2 were selected for plotting, as Figure 9 shown. The variance contribution rates of these two principal components to the genetic structure were 18.44% and 9.57% respectively, and the cumulative variance contribution rate was 28.01%. The sequenced population could be divided into 3 subgroups, and the grouping did not strictly follow the geographical regions. This might be because the collection locations were relatively close, and gene flow occurred between different populations due to immigration and emigration.

[0291] As Figure 10 shown, through cluster analysis, individuals from different regions were labeled. The phylogenetic tree diagram showed that there were obvious genetic differences among different geographical populations, and the grouping effect was consistent with the results of PCA analysis; Figure 10 The numbers starting with Y in it correspond to the YT population; the numbers starting with W correspond to the WH population.

[0292] As Figure 11 shown, using the Admixture software for population structure analysis, a line graph of the change in CV values and a population structure graph at different K values were drawn, and the range of K values was 1 - 10. The K value corresponding to the minimum cross-validation error rate (CV) was 4, which means that the 146 Porphyra yezoensis samples were most suitable to be divided into 4 subgroups.

[0293] In summary, the 10K liquid-phase chip of Porphyra yezoensis prepared in Example 1 can be used for population structure analysis of the above 146 Porphyra yezoensis samples; the two geographical populations of WH and YT can be roughly divided into two large populations, but there is gene flow between the YT population and the WH population, resulting in four subpopulations.

[0294] Example 4:

[0295] Application of the 10K liquid-phase chip of Porphyra yezoensis prepared in Example 1 in genome-wide association analysis of Porphyra yezoensis:

[0296] Kinship and population stratification are important factors leading to false positive results in genome-wide association analysis. The mixed linear model can be used to reduce the influence of these two factors. The model is as follows: y = = SNP + PCs + Kinship + e. In the formula, y is the observed value of phenotypic traits, SNP represents the genotype matrix of the population, PCs represents the fixed effect caused by population stratification, Kinship represents the random effect caused by kinship, and e represents the random error.

[0297] Use the 10K liquid-phase chip of Porphyra yezoensis prepared in Example 1 to obtain the genotype data of the above 146 Porphyra yezoensis samples. According to the filled genotyping data, use the GEMMA software to calculate the kinship matrix, and introduce the first 30 principal components in the PCA analysis and the kinship matrix as covariates into the mixed linear model (y = = SNP + PCs + Kinship + e) at the same time to perform genome-wide association analysis on the four traits of leaf length, leaf width, dry weight and fresh weight of Porphyra yezoensis.

[0298] Use the CMplot package in the R software to draw the Manhattan plot and Q-Q plot. The Manhattan plot is used to display the marker loci significantly related to the traits on the genome, and the Q-Q plot is used to judge whether the false positive loci in the association analysis are well controlled. According to the principle of Bonferroni correction, the threshold is set to 1 / the number of SNPs, and according to the formula of Shim et al.:

[0299] ;

[0300] Calculate the phenotypic variance explained rate (PVE) of each SNP locus. Finally, screen the SNPs significantly related to the traits of leaf length, leaf width, fresh weight and dry weight according to the P value and the set threshold, and select the genes within the 20 KB region upstream and downstream of the significant SNP loci as candidate genes with reference to the annotation information of the Porphyra yezoensis genome.

[0301] Based on the analysis results of population structure and kinship, a genome-wide association study was conducted on the leaf length, leaf width, fresh weight, and dry weight of Pyropia yezoensis, as Figures 12 - 19 shown. Among them, the Manhattan plot shows the degree of association between each SNP and the trait, and the significance threshold corresponding to the dashed line in the figure; according to the Q-Q plot, it can be observed that the distribution of scatter points basically coincides with the diagonal line, and only deviates at the end, indicating that the false positive results of the association analysis have been corrected.

[0302] In this example, -log10(P)>5.03 was used as the threshold for significant association, and 17, 32, and 1 loci significantly related to leaf length, leaf width, and fresh weight were screened, respectively. In addition, 1 locus significantly related to dry weight was also screened, and the phenotypic interpretation rates of the loci were 14.4% - 21.2%, 14.4% - 20.0%, 14.9%, and 14.6%, respectively. Among them, 1 SNP (Chr3:10908946) was detected in both the leaf width and fresh weight traits. After removing the duplicate SNPs, a total of 49 were obtained, as shown in Table 4. According to the distribution of significant association loci, the SNPs are distributed on three chromosomes, indicating that the growth of Pyropia yezoensis is controlled by multiple genes. Finally, genes within a 20 KB distance upstream and downstream of the 49 SNP loci were screened, and a total of 103 candidate genes were obtained, as shown in Table 5. Among them, the candidate gene I4F81_005486 located on chromosome CM020619.1 is related to both leaf length and dry weight.

[0303] Table 4 SNP loci (Chip) significantly related to leaf length, leaf width, fresh weight, and dry weight traits

[0304]

[0305]

[0306]

[0307] Table 5 Candidate genes (Chip) related to leaf length, leaf width, fresh weight, and dry weight traits

[0308]

[0309]

[0310]

[0311]

[0312]

[0313]

[0314] The specific embodiments described above further elaborate on the purpose, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A Porphyra yezoensis 10K liquid phase chip, characterized in that: The genotyping sites of the Porphyra yezoensis 10K liquid phase chip include 12942 SNP sites; the physical positions of the 12942 SNP sites are determined based on the whole genome sequence alignment of the Porphyra yezoensis reference genome, and the version number of the whole genome sequence of the Porphyra yezoensis reference genome is GCA_009829735.1; wherein the 12942 SNP sites are shown in Table 1: Table 1 ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； ； 。 2. The Porphyra yezoensis 10K liquid phase chip according to claim 1, characterized in that: It also includes probes designed based on the gene sequence covering 12,942 SNP sites.

3. The method for designing a Porphyra yezoensis 10K liquid phase chip according to claim 1 or 2, characterized in that: The steps include: S1. Obtain the original SNP site; S2, comparing the original SNP site with the target reference genome to ensure that the original SNP site is consistent with the target reference genome; S3, screening out functional SNP sites for which probes can be successfully designed from the original SNP sites; S4. From the functional SNP sites screened out, 12942 SNP sites were screened out according to the principle of uniform distribution of the genome, which were the target SNP sites.

4. The design method according to claim 3, characterized in that: In step S3, the screening process includes site filtering and site evaluation.

5. The design method according to claim 4, characterized in that: The conditions for site filtering include minimum sequencing depth ≥5X, deletion rate <10%, MAF>0.35 and heterozygosity rate <10%.

6. The design method according to claim 4, characterized in that: The principles of site evaluation include probe length of 110 bp, probe GC content of 30%-70%, and the number of homologous regions ≤5.

7. The design method according to claim 3, characterized in that: In step S3, when screening the functional SNP sites, the probe design segment coverage is required to be greater than or equal to 70%.

8. Use of the Porphyra yezoensis 10K liquid phase chip as claimed in claim 1 or 2 in the analysis of the population structure of Porphyra yezoensis.

9. Use of the Porphyra yezoensis 10K liquid phase chip as claimed in claim 1 or 2 in genome-wide association analysis of Porphyra yezoensis.

10. Use of the Porphyra yezoensis 10K liquid phase chip according to claim 1 or 2 in Porphyra yezoensis breeding.

Images