Engineered escherichia coli as well as construction method and application thereof

Abstract

The invention discloses engineered escherichia coli as well as a construction method and application thereof. The engineered escherichia coli is obtained by taking escherichia coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell; the nucleotide sequence of the target gene is as shown in any one of SEQ ID NO.1-3; the recombinant plasmid carrying the target gene is obtained after the target gene is inserted into a vector, the vector is a cytoplasmic plasmid of escherichia coli, the engineered escherichia coli is used for expressing target proteins with Uniprot numbers of B2UL22, B2UKX5 and B2URF3, the target proteins are used for preparing medicines for preventing or treating bone related diseases, and the protein medicines prepared from the target proteins can increase bone mass and can be used for preparing medicines for preventing or treating bone related diseases. The sclerotin is improved and the bone regeneration is promoted. Therefore, the compound can be used for preparing medicines for preventing and treating bone-related diseases, and a novel safe and effective biological treatment means is provided for preventing and treating the bone-related diseases.

Description

Technical Field

[0001] The present invention relates to the field of bone-related medical technology, and in particular to an engineered Escherichia coli capable of expressing a specific protein that can be used to prepare drugs for preventing and treating bone-related diseases, and a construction method and application thereof. Background Art

[0002] Metabolic bone disease is a collective term that covers a series of diseases that present different clinical characteristics. The commonality of these diseases is that the chemical environment of the bone is abnormal, resulting in bone defects and dysfunction. This abnormality is usually caused by metabolic imbalance of key minerals such as calcium, phosphorus, magnesium or vitamin D. The "bone-related disease" referred to in the present invention is a broader definition of metabolic bone disease, which also includes abnormal bone metabolism caused by other factors, such as fractures, cancer, burns, etc.

[0003] The core pathogenesis of metabolic bone disease lies in the dynamic imbalance of bone remodeling process (bone formation and bone resorption). Normal bone remodeling is a finely regulated process, in which osteoblasts are responsible for forming new bone, while osteoclasts are responsible for absorbing and breaking down old bone. Any factors that lead to an imbalance in the activities of these two cells may lead to changes in bone mass and quality, and then develop into metabolic bone disease. The pathogenesis may include endocrine disorders, genetic factors, age-related changes in bone turnover rate, and nutrient deficiencies.

[0004] Osteoporosis is a typical and common metabolic bone disease, characterized by destruction of bone microarchitecture and decreased bone density. Primary osteoporosis is usually associated with physiological osteopenia, such as postmenopausal osteoporosis in women and osteoporosis in the elderly. They are mainly related to decreased estrogen levels and age-related slowdown in bone remodeling. Secondary osteoporosis can be caused by limb disuse, stress, disease (such as chronic kidney disease, thyroid disease) or drug treatment (such as high-dose or long-term use of glucocorticoids). In these cases, the dynamic balance of bone remodeling is broken, leading to decreased bone density and even fractures, resulting in decreased quality of life and even premature death of patients.

[0005] At present, the drugs used clinically to correct the imbalance of bone metabolism in bone-related diseases mainly include basic supplements (such as calcium supplements, vitamin D), drugs that inhibit bone resorption (such as bisphosphonates), and drugs that promote bone formation (such as parathyroid hormone). However, the above drugs have problems such as unsatisfactory therapeutic effects, high costs for long-term treatment, certain side effects and / or poor patient compliance. Therefore, it is urgent to develop new, efficient and safe anti-osteoporosis drugs. Summary of the invention

[0006] The present invention provides an engineered Escherichia coli and a construction method and application thereof, which are used to solve the technical problems mentioned in the background technology, such as poor effect and high cost of existing bone drugs.

[0007] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0008] An engineered Escherichia coli is obtained by taking Escherichia coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell; the nucleotide sequence of the target gene is shown in any one of SEQ ID NO.1-3; the recombinant plasmid carrying the target gene is obtained by inserting the target gene into a vector, and the vector is a cytoplasmic plasmid of Escherichia coli.

[0009] Based on the same technical concept, the present invention also provides a method for constructing the above-mentioned engineered Escherichia coli, comprising the following steps:

[0010] (1) synthesizing or extracting the target gene;

[0011] (2) Using cell engineering to culture E. coli and extract plasmids from the cytoplasm of E. coli;

[0012] (3) using the same restriction endonuclease to cut the plasmid to form an incision, and connecting the cut plasmid and the target gene to obtain a recombinant plasmid capable of expressing the target protein;

[0013] (4) Using culture medium to culture Escherichia coli, and adding the recombinant plasmid thereto, so that the Escherichia coli absorbs the recombinant plasmid, thereby obtaining the engineered Escherichia coli.

[0014] Based on the same technical concept, the present invention also provides an application of the above-mentioned engineered Escherichia coli, which is used to express a target protein with a Uniprot number of B2URF3, B2UKX5 or B2UL22, and the target protein is used to prepare a drug for preventing or treating bone-related diseases.

[0015] As a further preferred embodiment of the above technical solution, the engineered E. coli is propagated, and the plasmid therein is transcribed and translated to obtain a supernatant containing the target protein, which is then washed and purified to obtain a purified target protein.

[0016] As a further preferred embodiment of the above technical solution, the bone-related diseases include primary metabolic bone diseases, abnormal bone metabolism caused by secondary factors, or osteoarthritis caused by obesity or trauma.

[0017] As a further preferred embodiment of the above technical solution, primary metabolic bone diseases and related diseases include senile and postmenopausal osteoporosis and its fractures, rickets, mineral metabolism disorders, bone sclerosis and dysplasia, bone fibrosis and bone atrophy, etc.; abnormal bone metabolism and related diseases caused by secondary factors, including osteoporosis and its fractures caused by limb disuse, improper / excessive use of hormones, lipid metabolism disorders, cancer, etc., inflammatory bone diseases (including osteomyelitis, arthritis, rheumatoid arthritis, osteoarthritis, rheumatoid arthritis and ankylosing spondylitis), cancer-related (such as bone metastases, giant cell tumors of bone, myeloma) and other secondary bone diseases, such as spina bifida, Paget's disease, scoliosis, myelitis and scleroderma, etc.

[0018] As a further preferred embodiment of the above technical solution, the bone-related disease is postmenopausal osteoporosis or hormone-induced osteoporosis.

[0019] The present invention has the following beneficial effects:

[0020] The present invention provides an engineered Escherichia coli, and discloses the use of a target protein expressed and purified by the engineered Escherichia coli in a conventional manner in the prevention and treatment of bone-related diseases. The protein medicine prepared from the target protein can increase bone mass, improve bone quality, and promote bone regeneration. Therefore, it can be used to prepare a drug for the prevention and treatment of bone-related diseases, providing a new safe and effective biological treatment method for the prevention and treatment of bone-related diseases.

[0021] The present invention will be further described in detail below with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The drawings constituting a part of this application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0023] Figure 1 Comparison of femoral bone microstructures in each group of postmenopausal osteoporosis mouse models.

[0024] Figure 2 The three-dimensional imaging of the distal femur of each group of postmenopausal osteoporosis mouse models (the white ruler in the figure is 1 mm);

[0025] Figure 3 Comparison of femoral bone microstructures in each group of hormone-induced osteoporosis mouse models;

[0026] Figure 4 The three-dimensional imaging of the distal femur of each group of steroid-induced osteoporosis mouse models (the white scale in the figure is 1 mm);

[0027] Figure 5a is ARS staining of BMSCs treated with three target proteins, and TRAP staining of RAW264.7 treated with three target proteins (white scale is 1 mm in the figure);

[0028] Figure 5 b is Figure 5 a Quantitative statistics of staining; Figure 6 The expression result of the target protein in Example 1; Figure 7 The expression result of the target protein in Example 2; Figure 8 This is the expression result of the target protein in Example 3. DETAILED DESCRIPTION

[0029] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, but the present invention can be implemented in many different ways as defined and covered by the claims.

[0030] Embodiment 1:

[0031] The engineered Escherichia coli of this embodiment is obtained by using Escherichia coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell; the nucleotide sequence of the target gene is shown in SEQ ID NO.1.

[0032] The engineered Escherichia coli of this embodiment is constructed by the following method:

[0033] (1) Isolating and purifying the desired target gene, and then using restriction endonucleases (NdeI and Hind3) to separate the target gene from the original DNA (using existing conventional techniques);

[0034] (2) Using cell engineering to culture E. coli and extract plasmids from the cytoplasm of E. coli;

[0035] (3) using the same restriction endonuclease to cut the plasmid to form an incision, and using DNA ligase to connect the cut plasmid and the target gene to obtain a recombinant plasmid capable of expressing the target protein;

[0036] (4) Competent cells BL21(DE3) and Rosetta TM 2(DE3) was taken out from -80℃ and thawed;

[0037] (5) Place 100 ng of the recombinant plasmid containing the target gene and the two cells in step (4) into the same test tube and mix well;

[0038] (6) Incubate the test tube in step (5) on ice for 30 min, then place at 42°C for 90 s, then replace the test tube and place on ice for 3 min;

[0039] (7) Add 100 μl of LB culture medium to the test tube replaced in step (6), and then mix in a shaker at 37°C and 200 rpm for 60 min;

[0040] (8) Spread on LB agar plates containing 50 μg / ml kanamycin;

[0041] (9) Invert the culture dish and incubate at 37°C overnight;

[0042] (10) Select three well-isolated single colonies and inoculate them into 4 ml LB medium containing 50 μg / ml kanamycin, and shake them in a shaker at 37°C and 200 rpm;

[0043] (11) When the OD value reached 0.6-0.8, 0.5 mM IPTG was added to two tubes and induced at 15°C for 16 h and 37°C for 4 h, respectively. The last tube was used as a negative control.

[0044] (12) Sample preparation: harvest cell pellets from 450 μl of culture medium, add 300 μl of lysis buffer (50 mM Tris, 150 mM sodium chloride, 5% glycerol pH 8.0) and use an ultrasonicator to lyse for 1 min: Preparation of whole cell lysate: mix 50 μl of 5x loading buffer into 100 μl of cell lysate to prepare a sample of whole cell lysate. Heat the sample at 100°C for 10 min and centrifuge at 15,000 rpm for 5 min. Centrifuge the remaining 200 μl of cell lysate at 15,000 rpm for 10 min, and collect the supernatant and pellet of the cell lysate. 90 μl of 5x loading buffer was added to 180 μl of supernatant as the sample of cell lysate supernatant; 150 μl of 5x loading buffer was used as the sample of cell lysate pellet to resuspend all the precipitates, the samples were heated at 100°C for 10 min, centrifuged at 15,000 rpm for 5 min, and then loaded into the gel;

[0045] (13) SDS-PAGE and western blot were used to detect the expression of the target protein (B2UL22) in the whole cell lysate, the supernatant of the cell lysate, and the pellet. The results are shown in Tables 1 and Figure 6 shown.

[0046] Embodiment 2:

[0047] The engineered Escherichia coli of this embodiment is obtained by using Escherichia coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell; the nucleotide sequence of the target gene is shown in SEQ ID NO.21.

[0048] The construction method of the engineered E. coli in this example is consistent with that in Example 1. The expression of the target protein (B2UKX5) in the whole cell lysate, the supernatant of the cell lysate and the pellet is shown in Tables 1 and Figure 7 shown.

[0049] Embodiment 3:

[0050] The engineered Escherichia coli of this embodiment is obtained by using Escherichia coli as a host cell and transferring a recombinant plasmid carrying a target gene into the host cell; the nucleotide sequence of the target gene is shown in SEQ ID NO.3.

[0051] The construction method of the engineered Escherichia coli in this example is consistent with that in Example 1. The expression of the target protein (B2URF3) in the whole cell lysate, the supernatant of the cell lysate and the pellet is shown in Tables 1 and Figure 8 shown.

[0052] Table 1. Expression test results of target proteins in Examples 1-3

[0053]

[0054] The gene sequences of the target proteins B2UL22, B2UKX5, and B2URF3 of Examples 1-3 are shown in SEQ ID NOs. 4-6, respectively. The target proteins of Examples 1-3 can be used to prepare drugs for preventing and / or treating bone-related diseases. The target proteins can be modified by functional enhancement, including but not limited to glycosylation, lipidation, polyvinyl alcoholization (PEGylation) or other appropriate chemical modifications to enhance their stability, enhance efficacy, increase oral bioavailability, or achieve targeted release of specific tissues or cells, especially targeting bones; the target protein can be combined with at least one pharmaceutically acceptable excipient, the excipient being selected from excipients, stabilizers, fillers, adhesives, wetting agents, sustained-release agents, absorption promoters, emulsifiers, dispersants, dissolution aids, preservatives, antioxidants, or lubricants; the drugs for preventing and / or treating bone-related diseases can be in the form of tablets, pills, capsules, or injections.

[0055] SEQ ID NO.1:

[0056] ATGCACCACCACCACCACCACATTCAGACCTACCAAGTGCTGCCGGTGGTTGCGATCGTTTGCAGCGCGAGCGCGTTTGCGCAGAACGCGGCGGACCCGGTGCAGATGGTTAAACAAAACATCGATCTGATTAGCAGCGCGAACAAAGTGCTGGACGATGTTAAGGACAACGCGGCGGTGGAGATCGCGATTAAGCAGCTGAACGCGCTGACCCAGCAAGCGAAGCAACTGGATAAAAGCATGGAGAAGATGCGTCTGACCAGCGAACAGGCGATCCGTATTACCAAACTGAACGGTGACGCGCAAGATACCATTGTGGACATGCTGGAGAACTGCGAACGTATCCAGAAGGATAAACTGATGACCCCGGCGCTGCTGAAGGCGGTTAACGACTTTGCGGATGCGGCGAACATCGACGTGGTTGAAACCATTACCACCGTGGAGCAAATCGTTGAAGATTAA;

[0057] SEQ ID NO.2:

[0058] ATGCATCACCACCACCACCACGAAAACATGAGCCTGCGTAGCGGTCGTGTTCTGAAGGACGCGGTGGTTGTGAGCAGCGGTGACGATTTCGTGAACATCCAGTACACCGATGGCGTTGCGAAAGTGAGCTATAAAGACCTGACCGATGCGCAGCAACGTGACTACCGTATGACCCCGGATGAGGTTAAAGCGCGTCTGGACCAACGTCGTATGGAGGAAGCGGCGCGTCGTAAGAAAGCGGAGGAAGCGCGTAAGGCGGCGGATGAGGAAGCGCGTAAAATCCGTGAGAGCCTGAGCGAGGCGGAACGTCACCCGCGTTATCTGGAGGGTGCGGACATTAGCCGTATGTTCCTGCTGATGGGCGAGCTGACCAAGGTTGAGGCGGAAGTGATGGCGCTGCAGTGGAACGCGCTGGAGGCGGACCGTGTTGGTCTGCCGGAAGATGCGCGTGTGTTTCGTGCGCGTGCGGCGGCGTACCAGGAACAAATCAACGCGATTCGTAAGAAACGTGAGACCGCGGAACAGTACTGGCAAGATCTGGAGAAGAAATATCTGGCGCTGAAGGACGGTACCCAGAAGAAAATCGCGGATCTGAACAAACAAGTGAGCCAGCTGCAAGGCGAGGTTCGTGAAGTGGCGAGCCAGCCGCGTACCGAACGTATCATTGTTCCGCCGATCATTCGTACCTGGAACTACCCGCCGCCGCCGGTGATCATTCGTCCGCAGCCGCCGCCGCCGCGTCCGGTTCCGCCGAGCCCGATTCCGCTGCCGGTGAAACCGAGCCTGTATCGTAGCTAA;

[0059] SEQ ID NO.3:

[0060]

[0061] Embodiment 4:

[0062] This example is a related experimental verification that the target protein of Examples 1-3 can prevent bone loss in a postmenopausal osteoporosis mouse model.

[0063] Mouse model: 8-week-old C57BL / 6 female SPF mice weighing 20-22 g were purchased from Hunan Slake Jingda Animal Experiment Co., Ltd. There were 5-8 mice in each group, with free access to food and water, and the circadian rhythm was maintained.

[0064] Grouping experiment: C57BL / 6 female SPF mice were randomly divided into 5 groups, including Sham group, OVX group, B2UL22 group, B2UKX5 group, and B2URF3 group; there were 5 to 8 mice in each group.

[0065] Modeling: Each group of mice underwent sham surgery or ovariectomy and then began intervention one week later.

[0066] Dosage:

[0067] Sham group: One week after the sham operation, the mice were injected with phosphate buffer via the tail vein at the same time. The injection volume was 100 μL twice a week, and samples were collected after two months of intervention.

[0068] OVX group: One week after the mice underwent ovariectomy, phosphate buffer was injected into the tail vein at the same time, with an injection volume of 100 μL twice a week, and samples were collected two months after the intervention.

[0069] B2UL22 group: One week after the mice underwent ovariectomy, they were injected with B2UL22 recombinant protein solution through the tail vein at an intervention concentration of 200 μg / kg and an injection volume of 100 μL twice a week. Samples were collected two months after the intervention.

[0070] B2UKX5 group: One week after the mice underwent ovariectomy, they were injected with B2UKX5 recombinant protein solution through the tail vein at an intervention concentration of 200 μg / kg and an injection volume of 100 μL twice a week. Samples were collected two months after the intervention.

[0071] B2URF3 group: One week after the mice underwent ovariectomy, they were injected with B2URF3 recombinant protein solution through the tail vein at an intervention concentration of 200 μg / kg and an injection volume of 100 μL twice a week. Samples were collected two months after the intervention.

[0072] like Figure 1-2As shown in the figure, after intravenous injection of the target protein, the cancellous bone volume fraction (Tb.BV / TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), and cortical bone thickness (Cb.Th) of the distal femur of mice were significantly higher than those of the model group (P<0.05), while the trabecular separation (Tb.Sp) and cortical bone inner diameter (Es.Pm) were significantly lower than those of the model group (P<0.05), indicating that tail vein injection of the target protein can alleviate the bone loss phenotype of the postmenopausal osteoporosis mouse model. Biomechanical tests showed that after intervention with the target protein, the mechanical strength of the mouse bones was significantly improved (P<0.05).

[0073] Embodiment 5:

[0074] This example is a related experimental verification that the target protein of Examples 1-3 can prevent bone loss in a hormone-induced osteoporosis mouse model.

[0075] Mouse model: 8-week-old C57BL / 6 female SPF mice weighing 20-22 g were purchased from Hunan Slake Jingda Animal Experiment Co., Ltd. There were 6 mice in each group, with free access to food and water, and circadian rhythm was maintained.

[0076] Grouping experiment: C57BL / 6 female SPF mice were randomly divided into 5 groups, including Veh group, MPS group, B2UL22 group, B2UKX5 group, and B2URF3 group; there were 6 mice in each group.

[0077] Modeling: Each group of mice was injected with hormones or solvents and intervention began at the same time.

[0078] Dosage:

[0079] Veh group: Mice were injected with solvent and phosphate buffer solution at the same time. The volume of tail vein injection was 100 μL, twice a week, and samples were collected after six weeks of intervention.

[0080] MPS group: At the same time as the injection of MPS, mice were injected with phosphate buffer via the tail vein. The volume of the tail vein injection was 100 μL, twice a week, and samples were collected after six weeks of intervention.

[0081] B2UL22 group: At the same time as the mice were injected with MPS, they were injected with B2UL22 recombinant protein solution through the tail vein at an intervention concentration of 200 μg / kg and an injection volume of 100 μL twice a week. Samples were collected after six weeks of intervention.

[0082] B2UKX5 group: At the same time as the mice were injected with MPS, they were injected with B2UKX5 recombinant protein solution through the tail vein at an intervention concentration of 200 μg / kg and an injection volume of 100 μL, twice a week, and samples were collected after six weeks of intervention.

[0083] B2URF3 group: At the same time as the mice were injected with MPS, they were injected with B2URF3 recombinant protein solution through the tail vein at an intervention concentration of 200 μg / kg and an injection volume of 100 μL, twice a week, and samples were collected after six weeks of intervention.

[0084] like Figure 3-4 As shown in the figure, after intravenous injection of the target protein, the cancellous bone volume fraction (Tb.BV / TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), and cortical bone thickness (Cb.Th) of the distal femur of mice were significantly higher than those of the model group (P<0.05), while the trabecular separation (Tb.Sp) and cortical bone inner diameter (Es.Pm) were significantly lower than those of the model group (P<0.05), indicating that tail vein injection of the target protein can reduce the bone loss phenotype of the steroid-induced osteoporosis mouse model. Biomechanical tests showed that after Akk protein intervention, the mechanical strength of mouse bones was significantly improved (P<0.05).

[0085] Embodiment 6:

[0086] This example is a related experimental verification that the target protein of Examples 1-3 can promote osteogenic differentiation and inhibit osteoclast differentiation in vitro.

[0087] like Figure 5 As shown in the figure, mouse bone marrow mesenchymal stem cells (BMSCs) were induced to osteogenic, and B2UL22, B2UKX5, and B2URF3 (at a concentration of 1 μg / mL) were respectively administered. After the intervention, ARS staining was performed to mark the osteogenic area, and quantitative statistics were performed. It can be seen that after the intervention of the target protein, the ARS staining area increased significantly, indicating that the target protein can promote osteogenic differentiation in vitro. At the same time, Figure 5 As shown, RAW264.7 cell line (mononuclear macrophages) was induced to osteoclast, and B2UL22, B2UKX5, and B2URF3 were respectively intervened (concentration of 1 μg / mL). After the intervention, TRAP staining was performed to mark osteoclasts, and quantitative statistics were performed. It can be seen that after the intervention of the target protein, the number of TRAP+ osteoclasts was significantly reduced, indicating that the target protein can inhibit osteoclast differentiation in vitro.

[0088] The above are only preferred embodiments of the present invention, and the protection scope of the present invention is not limited to the above embodiments. For those skilled in the art, improvements and changes obtained without departing from the technical concept of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. An engineered Escherichia coli, characterized in that: Escherichia coli is used as a host cell, and a recombinant plasmid carrying a target gene is transferred into the host cell to obtain the target gene; the nucleotide sequence of the target gene is shown in any one of SEQ ID NO.1-3; the recombinant plasmid carrying the target gene is obtained by inserting the target gene into a vector, and the vector is a cytoplasmic plasmid of Escherichia coli.

2. A method for constructing the engineered Escherichia coli according to claim 1, characterized in that: The following steps are involved: (1) synthesizing or extracting the target gene; (2) Using cell engineering to culture E. coli and extract plasmids from the cytoplasm of E. coli; (3) using the same restriction endonuclease to cut the plasmid to form an incision, and connecting the cut plasmid and the target gene to obtain a recombinant plasmid capable of expressing the target protein; (4) Using culture medium to culture Escherichia coli, and adding the recombinant plasmid thereto, so that the Escherichia coli absorbs the recombinant plasmid, thereby obtaining the engineered Escherichia coli.

3. Use of the engineered Escherichia coli according to claim 1 or the engineered Escherichia coli constructed by the construction method according to claim 2, characterized in that: The engineered Escherichia coli is used to express a target protein with a Uniprot number of B2URF3, B2UKX5 or B2UL22, and the target protein is used to prepare a drug for preventing or treating bone-related diseases.

4. The use of the engineered Escherichia coli according to claim 3, characterized in that: The engineered E. coli is propagated, and the plasmid therein is transcribed and translated to obtain a supernatant containing the target protein, which is then washed and purified to obtain a purified target protein.

5. The use of the engineered Escherichia coli according to claim 3, characterized in that: The bone-related diseases include primary metabolic bone disease, abnormal bone metabolism caused by secondary factors, or osteoarthritis caused by obesity or trauma.

6. The use of the engineered Escherichia coli according to claim 5, characterized in that: The primary metabolic bone diseases include senile / postmenopausal osteoporosis, fractures, rickets, mineral metabolism disorders, bone sclerosis and dysplasia, bone fibrosis or bone atrophy; the abnormal bone metabolism caused by secondary factors includes osteoporosis, fractures, inflammatory bone diseases, cancer or other secondary bone diseases, and the abnormal bone metabolism caused by secondary factors includes spina bifida, Paget's disease, scoliosis, myelitis or scleroderma.

7. The use of the engineered Escherichia coli according to claim 6, characterized in that: The bone-related disease is postmenopausal osteoporosis or hormonal osteoporosis.

Images