Recombinant escherichia coli producing n-acetylneuraminic acid, and construction method and application thereof

Abstract

The application discloses a recombinant escherichia coli for producing N-acetylneuraminic acid as well as a construction method and application thereof, and belongs to the technical field of genetic engineering. The recombinant escherichia coli can grow in glucose and glycerol double carbon sources, synthesize N-acetylneuraminic acid and has extremely low acetic acid generation by knocking out 6-phosphofructokinase, introducing a glycerol kinase mutant, replacing PTS phosphotransferase I with a glucose-promoted diffusion transporter and optimizing a promoter. On this basis, the application further knocks out the 6-phosphofructokinase coding gene pfkB, introduces a heterologous ED pathway from Pseudomonas aeruginosa, and further improves the yield under the hole plate level to 9.44 g / L through copy number optimization and RBS intensity optimization.

Description

Technical Field

[0001] This invention relates to a recombinant Escherichia coli that produces N-acetylneuraminic acid, its construction method, and its application, belonging to the field of genetic engineering technology. Background Technology

[0002] N-acetylneuraminic acid (NAc) is a functional monosaccharide with significant application value. In the human body, NAc participates in important physiological processes such as intercellular signal transduction and recognition. Therefore, NAc is widely used to promote brain development in infants, maintain brain function and health in the elderly, combat influenza viruses, and enhance immunity. Currently, natural extraction, enzymatic catalysis, and whole-cell catalysis are the main industrial production methods for NeuAc, but these methods suffer from high costs and environmental pollution. However, with the development of synthetic biology and metabolic engineering, analyzing and regulating metabolic pathways within microorganisms to achieve efficient accumulation of target products has become a reality and is easy to implement. As a greener, more efficient, and sustainable method, microbial fermentation for the de novo synthesis of NeuAc has significant advantages and is a more promising synthetic strategy.

[0003] Escherichia coli is a commonly used chassis microbial cell in industry, possessing advantages such as simple culture and easy genetic manipulation, and has been widely applied in the synthesis of various useful compounds. Furthermore, E. coli already possesses fully functional genetic tools for metabolic engineering, and its raw material fermentation process is relatively mature and cost-effective. Therefore, using E. coli as a host, through metabolic engineering modification, and using inexpensive carbon sources such as glucose as substrates, to efficiently synthesize N-acetylneuraminic acid de novo is an effective strategy.

[0004] Currently, the EMP pathway is used as the glycolytic route for the production of N-acetylneuraminic acid in E. coli, but this method suffers from insufficient phosphoenolpyruvate (PEP) supply. The EMP pathway involves numerous steps in pyruvate production, resulting in significant carbon source losses during intermediate processes, which limits further increases in N-acetylneuraminic acid yield. Therefore, reducing intermediate metabolic processes, lowering the carbon source loss rate, and increasing PEP supply are crucial. Summary of the Invention

[0005] To address the aforementioned issues, this invention first achieves N-acetylneuraminic acid production from a dual carbon source of glucose and glycerol through a three-step combination modification of the genome and promoter optimization, significantly reducing the generation of the byproduct acetic acid. Secondly, it constructs the ED pathway as the main glycolysis pathway in the strain, enabling the EMP pathway to supply the precursor pyruvate through a 10-step reaction in just 4 steps. This reduces intermediate steps, lowers the protein metabolic burden, and minimizes carbon source loss. The rapid supply of pyruvate promotes its conversion into PEP, addressing the problem of insufficient PEP supply during growth and achieving highly efficient synthesis of N-acetylneuraminic acid.

[0006] The first objective of this invention is to provide a recombinant Escherichia coli, said recombinant Escherichia coli comprising the following modifications:

[0007] Knock out the 6-phosphofructokinase-encoding genes pfkA, pfkB, and glycerol kinase-encoding gene (GlpK), overexpress the glycerol kinase mutant gene (GlpK22), knock out the PTS phosphotransferase I gene (ptsI) and integrate the glucose-promoted diffusion transporter gene (glf) at that site, and integrate an expression cassette containing the 6-PG dehydratase gene (EDD) and the KDPG aldolase gene (EDA) into the genome, with at least one copy integrated into the ymgF gene site;

[0008] The glucose-promoted diffusion transporter gene is expressed by a promoter whose nucleotide sequence is shown in SEQ ID NO.10, and the amino acid sequence of the glycerol kinase mutant is shown in SEQ ID NO.1.

[0009] Furthermore, two copies of the expression cassette containing the 6-PG dehydratase encoding gene and the KDPG aldolase encoding gene were integrated and expressed, with integration sites located at the ends of the ettA gene and the ymgF gene, respectively.

[0010] Furthermore, the GeneID of the ettA gene is 948909; and the GeneID of the ymgF gene is 1450253.

[0011] Furthermore, the expression cassette containing the 6-PG dehydratase encoding gene and the KDPG aldolase encoding gene further includes a promoter and / or a regulatory element RBS. The promoter includes, but is not limited to, the T7 promoter, and the regulatory element RBS includes, but is not limited to, the sequences shown in SEQ ID NO. 16-21. Preferably, the RBS regulating the 6-PG dehydratase encoding gene is the sequence shown in SEQ ID NO. 18, and the RBS regulating the KDPG aldolase encoding gene is the sequence shown in SEQ ID NO. 20.

[0012] Further, the overexpression is integrated expression and / or free expression. Preferably, the glycerol kinase-encoding gene is knocked out and the glycerol kinase mutant-encoding gene is integrated and expressed at that site. The promoter used in this invention is the glpk in situ promoter.

[0013] Furthermore, the host bacteria of the recombinant Escherichia coli includes Escherichia coli.

[0014] BL21(DE3)ΔcheW::P6-glmSA,overexpression ofneuC gene in the temminator locus ofpspG gene under the control ofpromoter Pl,ΔmotA::P1-glmM-P4-glmUglmSA,overexpression ofNemneuB gene in the terminator locus ofyahOgene under the control ofpromoter Pl,ΔwecBΔmanAΔpykA,ΔnagΔnanATEΔmanXYZ.

[0015] Further, the Gene ID of the 6-phosphofructokinase encoding gene pfkA is 948412; the Gene ID of the 6-phosphofructokinase encoding gene pfkB is 946230; the Gene ID of the glycerol kinase encoding gene is 948423; the Gene ID of the PTS phosphotransferase I encoding gene is 946879; the amino acid sequence of the glucose-promoted diffusion transporter is shown in SEQ ID NO. 3; the amino acid sequence of the 6-PG dehydratase is shown in SEQ ID NO. 11; and the amino acid sequence of the KDPG aldolase is shown in SEQ ID NO. 13.

[0016] The nucleotide sequence of the gene encoding the glycerol kinase mutant is shown in SEQ ID NO.2; the nucleotide sequence of the gene encoding the glucose-promoted diffusion transporter is shown in SEQ ID NO.4; the nucleotide sequence of the 6-PG dehydratase is shown in SEQ ID NO.12; and the nucleotide sequence of the KDPG aldolase is shown in SEQ ID NO.14.

[0017] A second objective of this invention is to provide a method for constructing the recombinant Escherichia coli, comprising the following steps:

[0018] Using *Escherichia coli* BL21(DE3)ΔcheW::P6-glmSA, overexpression of neuC gene in the temminator locus of pspG gene under the control of promoter Pl,ΔmotA::P1-glmM-P4-glmUglmSA, overexpression of NemneuB gene in the terminator locus of yahO gene under the control of promoter Pl,ΔwecBΔmanAΔpykA,ΔnagΔnanATEΔmanXYZ as the host bacterium, the 6-phosphofructokinase (6-phosphofructokinase) encoding gene pfkA, the 6-phosphofructokinase (6-phosphofructokinase) encoding gene pfkB, and the glycerol kinase (GlpK) encoding gene were knocked out. A glycerol kinase mutant encoding gene (GlpK22) with the amino acid sequence shown in SEQ ID NO.1 was integrated into the genome. The PTS phosphotransferase I encoding gene (ptsI) was knocked out, and a gene containing the sequence shown in SEQ ID NO.1 was integrated at this site via homologous recombination. The glucose-promoted diffusion transporter gene (glf) expression cassette of promoter NO.10 is integrated with one copy each at the ymgF site and ettA site via homologous recombination, and contains expression cassettes encoding the 6-PG dehydratase gene and the KDPG aldolase gene, respectively.

[0019] A third objective of this invention is to provide the use of the recombinant Escherichia coli in the preparation of N-acetylneuraminic acid or its derivatives.

[0020] Furthermore, derivative products include, but are not limited to, pharmaceuticals or health supplements.

[0021] A fourth objective of this invention is to provide a method for producing N-acetylneuraminic acid, comprising a step of fermentation production using the recombinant Escherichia coli; the fermentation production includes fermentation using a complex carbon source, wherein the complex carbon source contains glucose and glycerol.

[0022] Furthermore, in the composite carbon source, the mass ratio of glycerol to glucose is 1:(8-16).

[0023] Furthermore, the fermentation medium used in fermentation production contains: 20-40 g / L complex carbon source, 3-9 g / L urea, 1-6 mg / L zinc sulfate heptahydrate, 0.01-1 g / L manganese sulfate monohydrate, 1-10 g / L ferric sulfate heptahydrate, 0.01-1 g / L copper sulfate pentahydrate, 0.01-1 g / L cobalt chloride hexahydrate, 1-10 g / L yeast extract, 1-5 g / L tryptone, 1-10 g / L potassium dihydrogen phosphate, 1-10 g / L dipotassium hydrogen phosphate trihydrate, 1-10 g / L citric acid monohydrate, 1-10 g / L magnesium sulfate heptahydrate, and 1-10 g / L ammonium sulfate.

[0024] Furthermore, the fermentation process includes cultivation at 35-37℃ and 180-280 rpm.

[0025] The beneficial effects of this invention are:

[0026] This invention uses *Escherichia coli* BL21(DE3)ΔcheW::P6-glmSA, overexpression of neuC gene in the temminator locus of pspG gene under the control of promoter Pl,ΔmotA::P1-glmM-P4-glmUglmSA, overexpression of NemneuB gene in the terminator locus of yahO gene under the control of promoter Pl.ΔwecBΔmanAΔpykA,ΔnagΔnanATEΔmanXYZ,ΔpfkA,ΔglpK::glpK22,ΔptsI::glf(ZG01) as the host. The pfkB gene, encoding 6-phosphofructokinase, is knocked out. A heterologous ED pathway from *Pseudomonas motilityis* is introduced, and copy number and RBS strength are optimized. This improves the N-acetylneuraminic acid synthesis capacity of recombinant *E. coli* and reduces the synthesis of byproducts. Specifically, copy number optimization involved integrating edd and eda combinations at different sites in the genome; RBS optimization involved integrating edd and eda combinations of different strengths of RBS at the ends of the ymgF gene. These optimizations resulted in a yield of 9.44 g / L at the well plate level when using a composite carbon source. Attached Figure Description

[0027] Figure 1 This is a flowchart of the dual-carbon-source metabolism of N-acetylneuraminic acid.

[0028] Figure 2 The fermentation yield and acetic acid production of different engineered strains were compared.

[0029] Figure 3 To improve the fermentation yield of engineered strains that integrate gene fragments from different copy ED pathways.

[0030] Figure 4 The impact of optimized RBS combinatorial expression for the second copy of the ED pathway on NeuAc synthesis. Detailed Implementation

[0031] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0032] I. The genes and sequences involved in this invention are as follows:

[0033] The amino acid sequence of the glycerol kinase mutant GlpK22 is shown in SEQ ID NO.1, encoding GlpK22.

[0034] The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0035] The amino acid sequence of the glucose-promoted diffusion transporter Glf is shown in SEQ ID NO.3, and the nucleotide sequence encoding the Glf gene and optimized by codons is shown in SEQ ID NO.4.

[0036] The nucleotide sequence of promoter P1 is shown in SEQ ID NO.5; the nucleotide sequence of promoter P2 is shown in SEQ ID NO.6; the nucleotide sequence of promoter P3 is shown in SEQ ID NO.7; the nucleotide sequence of promoter P4 is shown in SEQ ID NO.8; the nucleotide sequence of promoter P5 is shown in SEQ ID NO.9; and the nucleotide sequence of promoter P6 is shown in SEQ ID NO.10.

[0037] The amino acid sequence of 6-PG dehydratase EDD is shown in SEQ ID NO.11, and the codon-optimized edd nucleotide sequence is shown in SEQ ID NO.12. The amino acid sequence of KDPG aldolase EDA is shown in SEQ ID NO.13, and the codon-optimized eda nucleotide sequence is shown in SEQ ID NO.14.

[0038] The T7 promoter sequence is shown in SEQ ID NO.15; the RBS1 nucleotide sequence is shown in SEQ ID NO.16; the RBS2 nucleotide sequence is shown in SEQ ID NO.17; the RBS3 nucleotide sequence is shown in SEQ ID NO.18; the RBS4 nucleotide sequence is shown in SEQ ID NO.19; the RBS5 nucleotide sequence is shown in SEQ ID NO.20; and the RBS6 nucleotide sequence is shown in SEQ ID NO.21.

[0039] II. The materials and methods involved in this invention are as follows:

[0040] The originating strain NBC45 is described in "Metabolic Engineering of Escherichia coli for Increased Bioproduction of N-Acetylneuraminic Acid". Its genotype is Escherichia coli BL21(DE3)ΔcheW::P6-glmSA, overexpression of neuC gene in the temminator locus of pspG gene under the control of promoter Pl,ΔmotA::P1-glmM-P4-glmUglmSA, overexpression of NemneuB gene in the terminator locus of yahO gene under the control of promoter Pl,ΔwecBΔmanAΔpykA,ΔnagΔnanATEΔmanXYZ.

[0041] The seed culture medium formula is: 10 g / L tryptone, 10 g / L sodium chloride, and 5 g / L yeast extract.

[0042] The fermentation medium formula is as follows: 30 g / L carbon source (glycerol: glucose = 1:12), 6 g / L urea, 3.8 mg / L zinc sulfate heptahydrate, 0.33 g / L manganese sulfate monohydrate, 5 g / L ferric sulfate heptahydrate, 0.1 g / L copper sulfate pentahydrate, 0.1 g / L cobalt chloride hexahydrate, 4.8 g / L yeast extract, 2.4 g / L tryptone, 5.336 g / L potassium dihydrogen phosphate, 3.284 g / L dipotassium hydrogen phosphate trihydrate, 2.84 g / L citric acid monohydrate, 2 g / L magnesium sulfate heptahydrate, 4 g / L ammonium sulfate, and pH adjusted to 7.

[0043] Culture conditions: Recombinant Escherichia coli was inoculated into LB medium and cultured at 37℃ and 220rpm for 12-14h to obtain seed culture. Then, 1-2% of the seed culture was transferred to fermentation medium for fermentation. (If necessary, 2‰ 0.5M IPTG was added to induce fermentation when OD≈0.5 after 2h.) The reaction was carried out at 37℃ and 220rpm for 48h.

[0044] Sample detection method: N-acetylneuraminic acid was detected by Waters liquid chromatography with an Aminex HPX-87H column (300×7.8mm). The UV absorption peak was detected at 210nm. The mobile phase was 10mM sulfuric acid, the flow rate was 0.5mL / min, and the elution time of N-acetylneuraminic acid was approximately 9.8 minutes.

[0045] Example 1 Construction of recombinant strains

[0046] (1) Knockout of pfkA and glpK

[0047] The CRISPER / Cpf1 gene editing technology was used to knock out the 6-phosphofructokinase gene pfkA (GeneID: 948412) and the glycerol kinase gene glpK (GeneID: 948423) in the genome of the starting strain of *E. coli*. The N23 sequence of pfkA is...

[0048] The N23 sequence of TGACATGATCAACCGTGGCGGTA,glpK is

[0049] TACGCGACAACCTG CTTCAGGAT. First, the Cpf1 plasmid containing the Cas12 cleavage protein was chemically transformed into *E. coli* host bacteria. Using *E. coli* BL21(DE3) as a template, approximately 800 bp fragments upstream and downstream of the knockout site were amplified by PCR. After obtaining the fragments through PCR amplification, they were ligated to the pcrEG vector targeting the cleavage plasmid in the CRISPER / Cpf1 system using a Gibson assembly kit. After plasmid construction and sequencing, competent *E. coli* cells containing Cpf1 were created to achieve the knockout of the target gene. After transformation, transformants were plated on antibiotic plates, and single colonies were picked for colony PCR verification of positive transformants and sequencing. The strain that knocked out pfkA was named DC1, and the strain that knocked out glpK in addition to DC1 was named DC2.

[0050] (2) Constructing a genome recombination-integrated glpK22 fragment

[0051] The glycerol kinase mutant enzyme GlpK22 (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.2) was selected, and the integration site of glpK22 was selected at the location of glpK.

[0052] Using Escherichia coli BL21(DE3) as a template, primers BL-glpK-3F and BL-glpK-3R were designed to amplify and integrate the NeuC left arm gene and the first half of the glpK mutation fragment.

[0053] BL-glpK-3F:GTTAGCTTGGCCAATCGTTACCGTCAGTTCGCTCAAC

[0054] BL-glpK-3R:TATGCGTTGGAAAGTGCGGTGTT

[0055] Using Escherichia coli BL21(DE3) as a template, primers pcrEG-glpK-4F-2k and BL-glpK-4R-1.5k were designed to amplify and integrate the NeuC right arm gene fragment and the latter half of the glpK mutation fragment.

[0056] BL-glpK-4F:ACACCGCACTTTCCAACGCATAG

[0057] BL-glpK-4R:TCGACTTCGAGCAGACTCATCACATTG

[0058] The amplified glpK22 left arm gene fragment, the first half of the glpK mutation fragment, the second half of the glpK mutation fragment, and the right arm fragment were constructed by fusion PCR technology to recombinantly integrate and obtain the glpK22 gene fragment with introduced mutation.

[0059] (3) Constructing a genome recombination-integrated GLF fragment

[0060] Based on the glucose-promoted diffusion transporter gene glf (amino acid sequence shown in SEQ ID NO. 3) of Pseudomonas aeruginosa, the nucleotide sequence of the gene glf encoded by codon optimization was synthesized (as shown in SEQ ID NO. 4). The integration site of glf was selected at the location of the PTS phosphotransferase I ptsI gene (Gene ID: 946879) and the end of the dadX gene (Gene ID: 945754) for knock-in integration.

[0061] Using Escherichia coli BL21(DE3) as a template, primers BL-glf-ptsI-3F and BL-glf-ptsI-3R were designed to amplify the recombinant and integrated left arm gene of glf.

[0062] BL-glf-ptsI-3F:gttAGCTTGGCCattgattcagcctgtcggaactgg

[0063] BL-glf-ptsI-3R:aaccctaccttacttgtgactgatttttaaaagaac

[0064] Using Escherichia coli BL21(DE3) as a template, primers BL-glf-ptsI-4F and BL-glf-ptsI-4R were designed to amplify the recombinant and integrated right arm gene fragment of glf.

[0065] BL-glf-ptsI-4F:GCCAGAAGTAATAAtccacgagatgcggcccaattta

[0066] BL-glf-ptsI-4R:agatctaaccagcagcatgagagcgatgaattg

[0067] The glf gene fragment with the nucleotide sequence shown in SEQ ID NO.4 and the P1 promoter fragment with the nucleotide sequence shown in SEQ ID NO.5 were synthesized.

[0068] The amplified left arm gene fragment, right arm gene fragment, P1 promoter fragment, and glf gene were used to construct a recombinant glf gene fragment P1-ptsI-glf using fusion PCR technology.

[0069] Using Escherichia coli BL21(DE3) as a template, primers BL-glf-dadX-3F and BL-glf-dadX-3R were designed to amplify and integrate the left arm gene of glf-dadX.

[0070] BL-glf-dadX-3F:ggcattattttgtatggcgcttcgc

[0071] BL-glf-dadX-3R:gcgtaagcgttttatgtagaacgcc

[0072] Using Escherichia coli BL21(DE3) as a template, primers BL-glf-dadX-4F and BL-glf-dadX-4R were designed to amplify and integrate the right arm gene fragment of glf-dadX.

[0073] BL-glf-dadX-4F:cacgctttacccttgatggagcct

[0074] BL-glf-dadX-4R:cgcgtattgcggcactgtttcgt

[0075] Synthesize the glf gene fragment as shown in SEQ ID NO.4 and the P1 promoter fragment as shown in SEQ ID NO.5.

[0076] The amplified left arm gene fragment of glf-dadX, the right arm gene fragment of glf-dadX, the P1 promoter fragment, and the glf gene were constructed into a recombinant and integrated glf gene fragment P1-dadX-glf using fusion PCR technology.

[0077] (4) Gene integration

[0078] After the fusion fragment glpK22 constructed in step (2) was ligated to the pcrEG vector containing the N23 recognition sequence (gggactaccggatgcggcataaa) in the CRISPER / Cpf1 system using the Gibson assembly kit, the constructed plasmid was transformed into E. coli DC2 competent cells constructed in step (1) containing the Cpf1 plasmid using the chemical transformation method. The recombinant strain with glpK22 integrated at Δglpk was obtained and named DC3 after verification.

[0079] The fusion fragment P1-ptsI-glf constructed in step (3) was ligated to the pcrEG vector containing the N23 recognition sequence (acgcagtacactctggcagttga) in the CRISPER / Cpf1 system using a Gibson assembly kit. The constructed plasmid was then chemically transformed into wild-type Escherichia coli BL21(DE3) competent cells and Escherichia coli DC1 and DC3 competent cells to obtain recombinant strains in which P1-ptsI-glf was integrated at the ΔptsI site. Transformants were subjected to colony PCR verification, and the successfully integrated strains were named DC4, DC5, and DC6-1, respectively. Similarly, after ligating P1-dadX-glf with the pcrEG vector containing the N23 recognition sequence (tctgaagtcgagttcgagtcaac) in the CRISPER / Cpf1 system, the constructed plasmid was transformed into DC3 competent cells using chemical transformation to obtain a recombinant strain in which P1-dadX-glf was integrated at the end of dadX. After verification, it was named DC7-1.

[0080] Example 2: Construction of Escherichia coli with constitutive promoters of different strengths regulating the glf gene

[0081] Synthesize the P2-P6 promoter fragments shown in SEQ ID NO.6-10.

[0082] The left arm gene fragment, right arm gene fragment, and glf gene obtained in step (3) of Example 1 are fused with the synthetic promoter fragment to obtain the Promoter2~6-ptsI-glf fusion fragment.

[0083] The constructed Promoter2-6-ptsI-glf fusion fragments were ligated to the pcrEG vector containing the N23 recognition sequence (acgcagtacactctggcagttga) in the CRISPER / Cpf1 system using a Gibson assembly kit. The constructed plasmids were then transformed into DC3 using a chemical transformation method to obtain DC6-2-DC6-6.

[0084] The left arm gene fragment of glf-dadX, the right arm gene fragment of glf-dadX, and the glf gene obtained in step (3) of Example 1 were fused with the synthetic promoter fragment to obtain Promoter2~6-dadX-glf fusion fragments. The constructed Promoter2~6-dadX-glf fusion fragments were then connected to the pcrEG vector containing the N23 recognition sequence (tctgaagtcgagttcgagtcaac) in the CRISPER / Cpf1 system using a Gibson assembly kit. The constructed plasmids were then transformed into DC3 using a chemical transformation method to obtain DC7-2~DC7-6.

[0085] After eliminating the tool plasmids in the gene editing system, the mixture was cultured in fermentation medium (glycerol: glucose = 1:12) at 37°C and 220 rpm for 48 h. The concentration of the product in the supernatant was then determined by high-performance liquid chromatography (HPLC). Figure 2 The strain with the ptsI system knocked out and regulated by the P6 promoter showed the highest N-acetylneuraminic acid (NeuAc) production at 8.2 g / L, while the acetic acid production was less than 0.2 g / L. This strain was named ZG01.

[0086] Example 3: Construction of recombinant strains

[0087] (1) PfKB knockout

[0088] The gene encoding 6-phosphofructokinase pfkB (GeneID: 946230) in the *E. coli* ZG01 genome was extracted using CRISPER / Cpf1 gene editing technology. The N23 sequence of pfkB is TCCCGAAGGAAAACTGCGCTGTA. First, the Cpf1 plasmid containing the Cas12 cleavage protein was chemically transformed into *E. coli* host bacteria. Using *E. coli* BL21(DE3) as a template, approximately 800 bp fragments upstream and downstream of the knockout site were amplified by PCR. After obtaining the fragments through PCR amplification, they were ligated to the pcrEG vector, the targeting cleavage plasmid in the CRISPER / Cpf1 system, using a Gibson assembly kit. After plasmid construction and sequencing, competent *E. coli* cells containing Cpf1 were created to achieve gene knockout. Transformants were plated on antibiotic-resistant plates, and single colonies were picked for colony PCR verification of positive transformants and sequencing. The pfkB-knockout strain was named ED01.

[0089] (2) Constructing genomic recombination and integration ED fragments

[0090] The key enzymes of the ED pathway, 6-PG dehydratase EDD and KDPG aldolase EDA, from *Pseudomonas aeruginosa*, were selected, and the integration site of the ED pathway was chosen at the end of the ettA gene (GeneID: 948909).

[0091] Using Escherichia coli BL21(DE3) as a template, primers BL-edd-3F and BL-edd-3R were designed to amplify the gene in the left arm of the ED pathway through recombination and integration.

[0092] BL-edd-3F:

[0093] TCAAACTTAGTTAGCTTGGCCAACCCGTTCCGCTACTGGGAATATATTC

[0094] BL-edd-3R:

[0095] GCGTTGCCAGTTATCTAACGCTGGTTTTCAACTCATCAAAAAACTTATT

[0096] TTATACCTCGCC

[0097] Using Escherichia coli BL21(DE3) as a template, primers BL-edd-6F and BL-edd-6R were designed to amplify the right arm gene fragment of the ED pathway through recombination and integration.

[0098] BL-edd-6F:TGATCTGGTTAAACAAGGTTTGAAAAAAACCTGCACGGGBL-edd-6R:

[0099] ATAACAGGGTAATAGATCTAAGGTTGATCAGTTCCGTGACTCAATGG

[0100] Codon-optimized EDD and EDA gene fragments were synthesized. Primers EDD-4F1, EDD-4F2, and EDD-4R were designed using EDD as a template to introduce the T7 promoter and the RBS2 and RBS4 nucleotide sequences to obtain the EDD fragment. Primers EDA-5F and EDA-5R were then designed using EDA as a template to obtain the EDA fragment.

[0101] EDD-4F1:AGCGTTAGATAACTGGCAACGCATGAGAAAGCCCCCGGA AGATCACCTTCCGGGGGCTTTTTTATTGCGCAGTTAGCTCACTCATTAGG C

[0102] EDD-4F2:TGCGCAGTTAGCTCACTCATTAGGCACCGGGATCTTAATACGACTCACTATAGGGGAATTGTGAGCG

[0103] EDD-4R:CCCATCTAGTAGTCCTGTGTGACTCTAGAATTAAAGTTAAA CAAAATTATTTCTACAGGTTAGATGCCTGCACCGCTGAAGATC

[0104] EDA-5F:TCTAGAGTCACACAGGACTACTAGATGGGGATGCGTGATAT CGATTCTGTTATGCGTCTG

[0105] EDA-5R:GGTTTTTTCAAACCTTGTTTAACCAGATCAATACAAATAATA AACGCATGAGAAAGCC

[0106] The amplified left arm, right arm, EDD, and EDA fragments of the ED pathway were constructed into a recombinant ED gene fragment T7-RBS2-EDD-RBS4-EDA using fusion PCR technology.

[0107] (3) Gene integration

[0108] The fusion fragment T7-RBS2-EDD-RBS4-EDA constructed in step (2) was ligated to the pcrEG vector containing the N23 recognition sequence (ATCTCGACAGCCTCTTCCAGAGA) in the CRISPER / Cpf1 system using a Gibson assembly kit. The constructed plasmid was then transformed into E. coli ED01 competent cells constructed in step (1) containing the Cpf1 plasmid using a chemical transformation method. A recombinant strain with ED integrated at the end of ettA was obtained and named ED02 after verification.

[0109] Example 4: Constructing Escherichia coli with different copy numbers of the ED pathway

[0110] (1) Constructing the second copy fragment of the ED pathway for genomic recombination integration

[0111] Using Escherichia coli BL21(DE3) as a template, primers BL-ymgF-3F and BL--ymgF-3R were designed to amplify the second copy of the left arm gene of the ED pathway through recombination and integration.

[0112] BL-ymgF-3F:CCAGAATCAACCCGAATTCTGGATTG

[0113] BL--ymgF-3R:GCCAGCAACCCATTCAGCCG

[0114] Using Escherichia coli BL21(DE3) as a template, primers BL-ymgF-3F and BL-ymgF-3R were designed to amplify the right arm gene of the second copy of the ED pathway through recombination and integration.

[0115] BL-ymgF-3F: GAAAGGCATTATTGCGCAAATAGTTGTCAAC

[0116] BL-ymgF-3R:

[0117] gtagggataacagggtaatagatctaaTCACCATTCATAAAGATGGTGCCACC

[0118] Using the T7-RBS2-EDD-RBS4-EDA recombinant fragment constructed in step (2) of Example 3 as a template, primers ymgF-ED-F and ymgF-ED-R were designed to amplify the edd-eda fragment.

[0119] ymgF-ED-F:GCTGAATGGGTTGCTGGCagcgttagataactggcaacgcat

[0120] ymgF-ED-R:

[0121] ACTATTTGCGCAATAATGCCTTTCaccagatcaatacaaataataaacgcatgagAAAG

[0122] The amplified ED pathway second copy left arm, right arm, and edd-eda fragment were constructed into a recombinant ED second copy gene fragment ymgF-edd-eda using fusion PCR technology.

[0123] (2) Constructing the third copy of the ED pathway for genome recombination integration

[0124] Using Escherichia coli BL21(DE3) as a template, primers BL-espX5-3F and BL-espX5-3R were designed to amplify the left arm gene of the third copy of the ED pathway through recombination and integration.

[0125] BL-espX5-3F:CCAGAATCAACCCGAATTCTGGATTG

[0126] BL--espX5-3R:GCCAGCAACCCATTCAGCCG

[0127] Using Escherichia coli BL21(DE3) as a template, primers BL-espX5-3F and BL-espX5-3R were designed to amplify the right arm gene of the third copy of the ED pathway through recombination and integration.

[0128] BL-espX5-3F:aatcgaccctaacgtcgaaatctggat

[0129] BL-espX5-3R:

[0130] acacgcagattgaggttaagtcgaccagatcaatacaaataataaacgcatgagAAAG

[0131] Using the T7-RBS2-EDD-RBS4-EDA recombinant fragment constructed in step (2) of Example 3 as a template, primers espX5-ED-F and espX5-ED-R were designed to amplify the edd-eda fragment.

[0132] espX5-ED-F:cgacttaacctcaatctgcgtgttgc

[0133] espX5-ED-R:gtagggataacagggtaatagatctaagacggaactctaaattcatgttccgctatgc

[0134] The amplified ED pathway second copy left arm, right arm, and edd-eda fragment were constructed into a recombinant ED second copy gene fragment espX5-edd-eda using fusion PCR technology.

[0135] (3) Gene integration

[0136] After the fusion fragment ymgF-edd-eda from step (1) was ligated to the pcrEG vector containing the N23 recognition sequence (CTTCAATGATCCAGGCGTTCACT) in the CRISPER / Cpf1 system using the Gibson assembly kit, the constructed plasmid was transformed into E. coli ED02 competent cells containing the Cpf1 plasmid using chemical transformation to obtain a recombinant strain with ED integrated at the end of ymgF. After verification, it was named ED03.

[0137] After the fusion fragment espX5-edd-eda from step (2) was ligated to the pcrEG vector containing the N23 recognition sequence (agattacctcgggcctggttacg) in the CRISPER / Cpf1 system using the Gibson assembly kit, the constructed plasmid was transformed into E. coli ED03 competent cells containing the Cpf1 plasmid using chemical transformation to obtain a recombinant strain with ED integrated at the end of espX5. After verification, it was named ED04.

[0138] (4) Fermentation verification

[0139] After eliminating the tool plasmids in the gene editing system, strains ZG01 and ED01-ED04 were cultured in fermentation medium (glycerol: glucose = 1:12) at 37°C and 220 rpm for 2 h. Then, 0.5 M IPTG (2‰) was added, and the culture was continued for another 46 h. The concentration of the product in the supernatant was then determined by high-performance liquid chromatography (HPLC). Figure 3 The results showed that knocking out pfkB reduced OD by 28.8% and yield by 22.3%. When the second copy was integrated, yield and OD rebounded, with NeuAc reaching 5.9 g / L.

[0140] Example 5: RBS optimization of the second copy of the ED pathway

[0141] (1) Constructing second copy fragments of the ED pathway with different RBS strengths through genomic recombination integration.

[0142] Design primers to amplify EDD fragments containing RBS fragments as shown in SEQ ID NO. 16–18 and EDA fragments containing RBS fragments as shown in SEQ ID NO. 19–21. By combining them in pairs, nine edd-eda fragment combinations can be obtained (where, in EDD-RBS, the intensity of SEQ ID NO. 16–18 increases sequentially; and in EDA-RBS, the intensity of SEQ ID NO. 19–21 increases sequentially).

[0143] The second copy left arm fragment, right arm fragment and edd fragment and eda fragment from step (1) of Example 4 were combined with the fusion PCR technology to construct a recombination and integration to obtain the recombination and integration ED second copy gene fragment ymgF-edd-eda-1~9.

[0144] (2) Gene integration

[0145] After the fusion fragment ymgF-edd-eda from step (1) was ligated to the pcrEG vector containing the N23 recognition sequence (CTTCAATGATCCAGGCGTTCACT) in the CRISPER / Cpf1 system using the Gibson assembly kit, the constructed plasmid was transformed into E. coli ED02 competent cells containing the Cpf1 plasmid using the chemical transformation method. The recombinant strain with ED integrated at the end of ymgF was obtained and named ED05-1 to 9 after verification.

[0146] (3) Fermentation verification

[0147] After eliminating the tool plasmids in the gene editing system, strains ZG01 and ED05-1~9 (i.e., ED05-1~8 and ED03 in the figure) were cultured in fermentation medium (glycerol: glucose = 1:12) at 37℃ and 220 rpm for 2 h. Then, 0.5 M IPTG (2‰) was added, and the culture was continued for another 46 h. The concentration of the product in the supernatant was then determined by high-performance liquid chromatography. Figure 4 The results show that when EDD is at high intensity and EDA is at medium intensity (ED05-5, i.e., EDD-RBS is SEQ ID NO.18 and EDA-RBS is SEQ ID NO.20), NeuAc increases by 1.42 g / L (17.7%), reaching 9.44 g / L (the yield of this batch of ZG01 is 8.02 g / L. The slight difference in yield from the above examples may be due to batch issues. Therefore, the yield recorded throughout the text is the yield of the batch in which the strain is located).

[0148] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. Use of a recombinant Escherichia coli for reducing by-products acetic acid in the synthesis of N-acetylneuraminic acid, characterized in that, The recombinant E. coli is based on the following modifications of the host bacteria: knocking out 6-phosphofructokinase encoding genes pfkA and pfkB, knocking out glycerol kinase encoding genes and integrating glycerol kinase mutant encoding genes at the site, knocking out PTS phosphotransferase I encoding genes and integrating glucose facilitated diffusion transporter encoding genes at the site, and integrating an expression frame containing 6-PG dehydratase encoding genes and KDPG aldolase encoding genes at the genomic ettA gene site and ymgF gene site, respectively; the glucose facilitated diffusion transporter encoding genes are expressed under the control of the promoter with the nucleotide sequence shown in SEQ ID NO. 10, the amino acid sequence of the glucose facilitated diffusion transporter is shown in SEQ ID NO. 3, the amino acid sequence of the glycerol kinase mutant is shown in SEQ ID NO. 1, the amino acid sequence of the 6-PG dehydratase is shown in SEQ ID NO. 11, and the amino acid sequence of the KDPG aldolase is shown in SEQ ID NO. 13; the expression frame containing 6-PG dehydratase encoding genes and KDPG aldolase encoding genes further comprises regulatory elements RBS: when the expression frame is integrated at the ettA gene site, the RBS for regulating the 6-PG dehydratase encoding genes is the sequence shown in SEQ ID NO. 17, and the RBS for regulating the KDPG aldolase encoding genes is the sequence shown in SEQ ID NO. 19; when the expression frame is integrated at the ymgF gene site, the RBS for regulating the 6-PG dehydratase encoding genes is the sequence shown in SEQ ID NO. 18, and the RBS for regulating the KDPG aldolase encoding genes is the sequence shown in SEQ ID NO. 20; the host bacteria of the recombinant E. coli is E. coli BL21 (DE3) ΔcheW::P6-glmSA, the neuC gene is overexpressed at the pspG gene termination site under the control of the promoter P1, ΔmotA::P1-glmM-P4-glmU glmSA, the NemneuB gene is overexpressed at the yho gene termination site under the control of the promoter P1, ΔwecB ΔmanA ΔpykA, Δnag ΔnanATE ΔmanXYZ, wherein the P1 promoter nucleotide sequence is shown in SEQ ID NO. 5, the P4 promoter nucleotide sequence is shown in SEQ ID NO. 8, and the P6 promoter nucleotide sequence is shown in SEQ ID NO. 10; the application comprises the step of using the recombinant E. coli to carry out fermentation with a complex carbon source containing glucose and glycerol in a mass ratio of 1:

12.

2. Use according to claim 1, characterized in that, at least one of the following features is included: the GeneID of the ettA gene is 948909; the GeneID of the ymgF gene is 1450253.

3. Use according to claim 1, characterized in that, the expression frame containing 6-PG dehydratase encoding genes and KDPG aldolase encoding genes further comprises a promoter; the promoter comprises a T7 promoter.

4. Use according to claim 1, characterized in that, Gene ID of the 6-phosphofructokinase-encoding gene pfkA is 948412; Gene ID of the 6-phosphofructokinase-encoding gene pfkB is 946230; Gene ID of the glycerol kinase-encoding gene is 948423; Gene ID of the PTS phosphotransferase I-encoding gene is 946879; The nucleotide sequence of the glycerol kinase mutant-encoding gene is shown in SEQ ID NO. 2; the nucleotide sequence of the glucose facilitator-encoding gene is shown in SEQ ID NO. 4; the nucleotide sequence of the 6-PG dehydratase is shown in SEQ ID NO. 12; the nucleotide sequence of the KDPG aldolase is shown in SEQ ID NO.

14.

5. The use according to claim 1, characterized in that, The method for constructing the recombinant E. coli comprises the following steps: The recombinant E. coli is constructed by the following method: E. coli BL21(DE3)ΔcheW::P6-glmSA, overexpression of neuC gene at the termination site of pspG gene under the control of promoter P1, ΔmotA::P1-glmM-P4-glmUglmSA, overexpression of NemneuB gene at the termination site of yho gene under the control of promoter P1, ΔwecBΔmanAΔpykA, ΔnagΔnanATEΔmanXYZ as the host strain, knockout of 6-phosphofructokinase-encoding gene pfkA and 6-phosphofructokinase-encoding gene pfkB, knockout of glycerol kinase-encoding gene and integration of glycerol kinase mutant-encoding gene at the site, knockout of PTS phosphotransferase I-encoding gene and integration of the expression frame of glucose facilitator-encoding gene containing the promoter shown in SEQ ID NO. 10 at the site by homologous recombination, integration of one copy of the expression frame containing 6-PG dehydratase-encoding gene and KDPG aldolase-encoding gene at ymgF site and ettA site by homologous recombination, when the expression frame is integrated at the site of ettA gene, the RBS for regulating 6-PG dehydratase-encoding gene is the sequence shown in SEQ ID NO. 17, and the RBS for regulating KDPG aldolase-encoding gene is the sequence shown in SEQ ID NO. 19; when the expression frame is integrated at the site of ymgF gene, the RBS for regulating 6-PG dehydratase-encoding gene is the sequence shown in SEQ ID NO. 18, and the RBS for regulating KDPG aldolase-encoding gene is the sequence shown in SEQ ID NO.

20.

6. Use according to claim 1, characterized in that, At least one of the following features is included: (1) The fermentation medium used in the fermentation production contains: 20-40 g / L complex carbon source, 3-9 g / L urea, 1-6 mg / L zinc sulfate heptahydrate, 0.01-1 g / L manganese sulfate monohydrate, 1-10 g / L iron sulfate heptahydrate, 0.01-1 g / L copper sulfate pentahydrate, 0.01-1 g / L cobalt chloride hexahydrate, 1-10 g / L yeast powder, 1-5 g / L tryptone, 1-10 g / L potassium dihydrogen phosphate, 1-10 g / L dipotassium hydrogen phosphate trihydrate, 1-10 g / L citric acid monohydrate, 1-10 g / L magnesium sulfate heptahydrate, 1-10 g / L ammonium sulfate; (2) The fermentation production includes culturing at 35-37°C, 180-280 rpm.

Images