Optimized production of lentiviral vectors

Abstract

A modified U1snRNA, wherein the modified U1snRNA is modified to bind to a nucleotide sequence within a packaging region of a lentiviral vector genomic sequence.

Description

[0001] This patent application is a divisional application of the patent application with application number 2020800532524, application date July 23, 2020, and invention name “Optimized production of lentiviral vectors”. Technical Field

[0002] The present invention relates to the production of lentiviral vectors in eukaryotic cells. More specifically, the present invention relates to the design and co-expression of modified U1 snRNA during the production of lentiviral vectors to increase the output titer. Background Art

[0003] Over the past several decades, the development and manufacture of viral vectors for vaccines and human gene therapy has been well documented in scientific journals and patents. The use of engineered viruses to deliver transgenes for therapeutic effects is widespread. Modern gene therapy vectors based on RNA viruses and DNA viruses have shown promise in an increasing number of human disease indications, including RNA viruses such as γ-retroviruses and lentiviruses (Muhlebach, MD et al., 2010, Retroviruses: Molecular Biology, Genomics and Pathogenesis, 13:347-370; Antoniou, MN, Skipper, KA & Anakok, O., 2013, Hum. Gene Ther., 24:363-374), and DNA viruses such as adenoviruses (Capasso, C. et al., 2014, Viruses, 6:832-855) and adeno-associated viruses (AAV) (Kotterman, MA & Schaffer, DV, 2014, Nat. Rev. Genet., 15:445-451). These approaches include ex vivo modification of patient cells for hematological diseases (Morgan, RA & Kakarla, S., 2014, Cancer J., 20:145-150; Touzot, F. et al., 2014, Expert Opin. Biol. Ther., 14:789-798) and in vivo treatment for ophthalmology (Balaggan, KS & Ali, RR, 2012, Gene Ther., 19:145-153), cardiovascular (Katz, MG et al., 2013, Hum. Gene Ther., 24:914-927), neurodegenerative diseases (Coune, PG, Schneider, BL & Aebischer, P., 2012, Cold Spring Harb. Perspect. Med., 4:a009431), and tumor therapy (Pazarentzos, E. & Mazarakis, ND, 2014, Adv. Exp. Med. Biol., 818: 255-280). As these approaches begin to move toward regulatory approval and commercialization with success in clinical trials, attention has focused on bottlenecks that arise in the large-scale production of good manufacturing practice (GMP)-grade carrier materials (Van der Loo JCM, Wright JF., 2016, Human Molecular Genetics, 25(R1): R42–R52).

[0004] One way to overcome this challenge is to find new ways to generate maximum titers during viral vector production.Therefore, there is a need in the art to provide alternative methods for producing viral vectors that help solve the known problems associated with large-scale production of GMP-grade vector materials.

[0005] Common methods for viral vector manufacturing include transfection of primary cells or mammalian / insect cell lines with vector DNA components, followed by a limited incubation period, and then harvesting crude vector from the culture medium and / or cells (Merten, OW., Schweizer, M., Chahal, P., & Kamen, AA, 2014, Pharmaceutical Bioprocessing, 2: 183-203). In other cases, producer cell lines (PrCL; in which all necessary vector component expression cassettes are stably integrated into the production cell DNA) are used in a transfection-independent method, which is advantageous on a larger scale. The efficiency of lentiviral vector manufacturing is generally affected by several factors in the "upstream stage", including [1] the viral serotype / pseudotype used, [2] the transgene sequence composition and size, [3] the culture medium composition / gas treatment / pH, [4] the transfection reagent / transfection process, [5] the chemical induction and vector harvest time control, [6] the cell fragility / activity, [7] the bioreactor shear force and [8] the impurities. Obviously, there are other factors to consider in the "downstream" purification / concentration stage (Merten, OW. et al., 2014, Pharmaceutical Bioprocessing, 2:237-251).

[0006] An important aspect of optimization is the relative abundance of the lentiviral vector components, GagPol, envelope, rev, and vector genomic RNA (vRNA), in the upstream stages of production. For methods that require transient transfection of plasmid DNA encoding these components, the optimal "mass" ratio of these plasmids is usually determined during the optimization process. The optimal ratio is also effectively solved by screening a number of PrCLs containing all components that are stably integrated into the host DNA; those PrCLs with the greatest output are clones containing expression cassettes at the locus, which allow each individual component to be expressed at or near the optimal component ratio. The inventors note that the genomic vRNA component may generally be a limiting factor in PrCLs; this is supported by reports that high titer output of PrCL clones is associated with high copy numbers of the vector genome cassette (Sheridan, PL et al., 2000, Mol. Ther, 2 (3): 262-275). Typically, in transient transfection methods, even considering the size of the plasmid, the largest proportion of plasmid DNA is at the optimal ratio of the component plasmids. This suggests that the production of genomic vRNA during lentiviral vector manufacturing is a key factor in generating an efficient lentiviral vector manufacturing method.

[0007] Splicing and polyadenylation are key processes for mRNA maturation, especially in higher eukaryotic organisms where most protein-coding transcripts contain multiple introns. The mRNA internal elements required for splicing include 5' splice donor signals, sequences around branch points, and 3' splice acceptor signals. Interacting with these three elements is the spliceosome, which is formed by five small nuclear RNAs (snRNAs), including U1 snRNA and related nuclear proteins (snRNPs). U1 snRNA is expressed by a polymerase II promoter and is present in most eukaryotic cells (Lund et al., 1984, J. Biol. Chem., 259: 2013-2021). Human U1 snRNA (small nuclear RNA) is 164nt long and has a clear structure consisting of four stem loops (West, S., 2012, Biochemical Society Transactions, 40: 846-849). U1 snRNA contains a short sequence at its 5' end that is extensively complementary to the 5' splice donor site at the exon-intron junction. U1 snRNA participates in splice site selection and spliceosome assembly by base pairing with the 5' splice donor site. In addition to splicing, one known function of U1 snRNA is to regulate 3' mRNA processing: it responds to early polyadenylation (polyA) signals to suppress premature polyA (especially within introns).

[0008] Repression of polyA sites within intronic sequences within cellular genes by recruiting endogenous U1 snRNA has been well characterized (Kaida, D. et al., 2010, Nature, 468:664-8). Others have also used modified U1 snRNA as a research tool to dissect the mechanism of inhibition of premature polyadenylation at the 5'LTR during HIV-1 replication (Ashe, MP, Pearson, LH & Proudfoot NJ, 1997, EMBO J., 16:5752-63; Ashe, MP, Furger, A. & Proudfoot, NJ, 2000, RNA, 6:170-7; Furger, A., Monks, J. & Proudfoot, NJ, 2001, J. Virol., 75:11735-46).

[0009] HIV-1 encodes identical polyA signals within the R region of both the 5'LTR and 3'LTR; the 3'LTR polyA is active and serves to terminate all pre-mRNA transcription events. To avoid premature termination at the polyA site in the 5'LTR (i.e., termination immediately after transcription initiation), binding of endogenous U1 snRNA to the major splice donor (approximately 200 bases downstream) inhibits the activity of this polyA site, allowing transcription to continue to the end of the proviral cassette. Results showed that mutations in the major splice donor activated the polyA site in the 5'LTR, but this inhibition could be reinitiated if a modified U1 snRNA (targeting a sequence adjacent to the major splice donor) was co-expressed. However, inhibition of the polyA site depends on the proximity of the U1 snRNA to the polyA site, so most work has been performed in artificial "minigene" expression cassettes that lack many of the other RNA sequences found in wild-type HIV-1 or HIV-1-based lentiviral vectors.

[0010] Manipulation and use of U1 snRNA is referred to in the art as "U1 interference" or "U1i", and has been used to develop methods for inhibiting gene expression (Beckley, SA et al., 2001, Mol. Cell Biol., 21:2815-25; Fortes, P. et al., 2003, Proc. Nat. Acad. Sci. USA, 100:8264-9). The mechanism by which U1i works is by inhibiting the correct location and processing of polyadenylation of pre-mRNA, resulting in the production of unstable mRNA, which leads to reduced protein levels. Inhibition of polyadenylation requires the addition of a modified U1

[0011] The snRNP particles are localized to the 3'-terminal exon of the target transcript. The nucleic acid sequence of the U1 snRNA gene is modified so that the U1 snRNA binds to the selected sequence instead of the 5' splice donor site sequence used to initiate splicing of the target gene. Inhibition of polyadenylation is achieved by base pairing the 5' end of the modified U1 snRNA in the associated RNP complex with the selected complementary region in the target pre-mRNA. It has been used as an antiviral method (Bláquez, L. & Fortes, P., 2015, Adv. Exp. Med. Biol., 848: 51-69), including HIV-1

[0012] (Sajic, R. et al., 2007, Nucleic Acids Res., 35:247-55; Knoepfel, SA et al., 2012, Antiviral Res., 94:208-16).

[0013] Other studies have shown that binding of endogenous U1 snRNA or modified U1 snRNA to shared or non-shared 5' splice sites in HIV-1 can alter the stability of viral RNA (Lützelberger, M. et al., 2006, J. Biol. Chem., 281: 18644-51). However, this report suggests that this effect is specific to a short, novel intron found in the pol region of HIV-1. Such a sequence is completely absent in the vector genome sequence of HIV-1 lentiviral vectors.

[0014] At the filing date of this application, manipulation and use of U1 in the production of lentiviral vectors

[0015] Methods for increasing the titer of lentiviral vectors by using snRNA are unknown. Summary of the invention

[0016] The inventors surprisingly discovered that the output titer of lentiviral vectors can be increased by co-expressing non-coding RNAs based on U1 snRNAs, which have been modified so that they no longer target endogenous sequences (splice donor sites) but instead target sequences within the vRNA molecule. The present invention relates to such modified U1 snRNAs and a novel method for increasing the production titer of lentiviral vectors. The method comprises co-expressing the modified U1 snRNA with other vector components during the vector production process. The modified U1 snRNA is designed so that the binding to the common splice donor site is removed by replacing it with a heterologous sequence complementary to the target sequence within the vector genome vRNA. The present invention describes various application modes and optimal characteristics of the modified U1 snRNA, including target sequence and complementary length, design and expression mode.

[0017] In one aspect, the present invention provides a modified U1 snRNA, wherein the modified U1 snRNA has been modified to bind to a nucleotide sequence within the packaging region of a lentiviral vector genome sequence.

[0018] In one aspect, the present invention provides a modified U1 snRNA, wherein the modified U1 snRNA has been modified to be complementary to a nucleotide sequence within the packaging region of a lentiviral vector genome sequence.

[0019] In some embodiments, the modified U1 snRNA is modified to introduce a heterologous sequence that is complementary to the nucleotide sequence.

[0020] In some embodiments, the modified U1 snRNA is modified at the 5′ end to introduce the heterologous sequence within nine nucleotides at positions 3- to 11-.

[0021] In some embodiments, the modified U1 snRNA is modified at the 5' end to introduce the heterologous sequence within the native splice donor annealing sequence.

[0022] In some embodiments, 1 to 9 nucleotides of the native splice donor annealing sequence are replaced by the heterologous sequence. In one aspect, nucleotides 1 to 11 including the native splice donor annealing sequence are replaced with a heterologous sequence complementary to the nucleotide sequence.

[0023] In some embodiments, the modified U1 snRNA is modified at the 5' end to replace the sequence comprising the natural splice donor annealing sequence with a heterologous sequence complementary to the nucleotide sequence.

[0024] In some embodiments, the heterologous sequence comprises at least 9 nucleotides that are complementary to the nucleotide sequence.

[0025] In some embodiments, the heterologous sequence comprises 15 nucleotides that are complementary to the nucleotide sequence.

[0026] In some embodiments, the packaging region of the lentiviral vector genome sequence is from the 5' U5 domain to the end of the sequence derived from the gag gene.

[0027] In some embodiments, the nucleotide sequence is located within a 5' U5 domain, a PBS element, a SL1 element, a SL2 element, a SL3ψ element, a SL4 element, and / or a sequence derived from a gag gene.

[0028] In some embodiments, the nucleotide sequence is located within a SL1, SL2, and / or SL3ψ element.

[0029] In some embodiments, the nucleotide sequence is located within the SL1 and / or SL2 elements.

[0030] In some embodiments, the nucleotide sequence is located within a SL1 element.

[0031] In some embodiments, the modified U1 snRNA is a modified U1A snRNA or a modified U1AsnRNA variant.

[0032] In some embodiments, the first two nucleotides at the 5' end of the modified U1 snRNA are not AU.

[0033] In some embodiments, the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, or Vesna lentivirus.

[0034] In some embodiments, the lentiviral vector is derived from HIV-1, HIV-2, or EIAV.

[0035] In some embodiments, the lentiviral vector is derived from HIV-1.

[0036] In some embodiments, the lentiviral vector is derived from SIV.

[0037] In another aspect, the present invention provides an expression cassette comprising a nucleotide sequence encoding the modified U1 snRNA of the present invention.

[0038] In yet another aspect, the present invention provides a cell for producing a lentiviral vector, comprising nucleotide sequences encoding vector components including gag, env, rev and RNA genome of the lentiviral vector, and at least one nucleotide sequence encoding the modified U1 snRNA of the present invention.

[0039] In another aspect, the invention provides a cell comprising the modified U1 snRNA according to the invention.

[0040] In some embodiments, the cell further comprises a nucleotide sequence encoding an RNA genome of a lentiviral vector.

[0041] In some embodiments, the cell further comprises a nucleotide sequence encoding a Nucleotide of Interest (NOI).

[0042] In some embodiments, the nucleotide of interest produces a therapeutic effect.

[0043] In some embodiments, the target nucleotide encodes an enzyme, a cofactor, a cytokine, a chemokine, a hormone, an antibody, an antioxidant molecule, an engineered immunoglobulin-like molecule, a single-chain antibody, a fusion protein, an immune co-stimulatory molecule, an immune modulatory molecule, a chimeric antigen receptor, a cross-domain negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a transcription factor, a structural protein, a reporter protein, a subcellular localization signal, a tumor suppressor protein, a growth factor, a membrane protein, a receptor, a vasoactive protein or peptide, an antiviral protein or ribozyme, or a derivative thereof, or a microRNA.

[0044] In some embodiments, the nucleotide of interest encodes a molecule that can be used to treat a disease selected from the group consisting of:

[0045] (i) Diseases that respond to: cytokine and cell proliferation / differentiation activity; immunosuppressive or immunostimulatory activity (e.g., for the treatment of immunodeficiency (including infection with human immunodeficiency virus); regulation of lymphocyte growth; treatment of cancer and many autoimmune diseases, and prevention of transplant rejection or induction of tumor immunity); regulation of hematopoiesis (e.g., treatment of bone marrow or lymphoid diseases); promotion of growth of bone, cartilage, tendon, ligament and nerve tissue (e.g., for wound healing, treatment of burns, ulcers and periodontal disease and neurodegeneration); inhibition or activation of follicle stimulating hormone (regulation of fertility) ; chemotactic / chemopromoting activity (e.g., for mobilizing specific cell types to sites of injury or infection); hemostatic and thrombolytic activity (e.g., for treating hemophilia and stroke); anti-inflammatory activity (e.g., for treating septic shock or Crohn's disease); macrophage inhibitory activity and / or T cell inhibitory activity, and the resulting anti-inflammatory activity; anti-immunological activity (i.e., inhibition of cellular and / or humoral immune responses, including responses not related to inflammation); inhibition of the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, and upregulated fas receptor expression in T cells;

[0046] (ii) malignant diseases, including cancer; leukemia; benign and malignant tumor growth, invasion and spread, angiogenesis, metastasis; ascites and malignant pleural effusions;

[0047] (iii) autoimmune diseases, including arthritis (including rheumatoid arthritis), allergies, allergies, asthma, systemic lupus erythematosus, collagen diseases and other diseases;

[0048] (vi) vascular disease, including atherosclerosis, arteriosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vasculitic diseases, respiratory distress syndrome, cardiovascular effects, peripheral vascular disease, migraine and aspirin-dependent antithrombotic disease, stroke, cerebral ischemia, ischemic heart disease or other diseases;

[0049] (v) diseases of the gastrointestinal tract, including peptic ulcer, ulcerative colitis, Crohn's disease and others;

[0050] (vi) liver disease, including liver fibrosis and cirrhosis;

[0051] (vii) inherited metabolic disorders, including phenylketonuria (PKU), Wilson's disease, organic acidemias, urea cycle disorders, cholestasis, and other diseases;

[0052] (viii) renal and urinary diseases, including thyroiditis or other glandular diseases, glomerulonephritis or other diseases;

[0053] (ix) ear, nose and throat diseases, including otitis or other ear, nose and throat diseases, dermatitis or other skin diseases;

[0054] (x) dental and oral diseases, including periodontal disease, periodontitis, gingivitis or other dental / oral diseases;

[0055] (xi) testicular disease, including orchitis or epididymo-orchitis, infertility, testicular trauma or other testicular disease;

[0056] (xii) gynecological diseases, including placental dysfunction, placental insufficiency, recurrent miscarriage, eclampsia, preeclampsia, endometriosis and other gynecological diseases;

[0057] (xiii) ophthalmic diseases, such as Leber congenital amaurosis (LCA), including LCA10; posterior uveitis; intermediate uveitis; anterior uveitis; conjunctivitis; chorioretinitis; uveoretinitis; optic neuritis; glaucoma, including open-angle glaucoma and juvenile congenital glaucoma; intraocular inflammation, such as retinitis or cystoid macular edema; sympathetic ophthalmia; scleritis; retinitis pigmentosa; macular degeneration, including age-related macular degeneration (AMD) and juvenile macular degeneration, including Best's disease, Best's vitelliform macular degeneration, Stargardt's disease; Usher's syndrome; Dohn's honeycomb retinal dystrophy; Sorby's disease; Macular dystrophy; juvenile retinoschisis; cone-rod dystrophy; corneal dystrophy; Fuch dystrophy; Leber's congenital amaurosis; Leber's hereditary optic neuropathy (LHON); Ady syndrome; Oguchi's disease; degenerative fundus disease; visual impairment; eye inflammation due to infection; proliferative vitreoretinopathy; acute ischemic optic neuropathy; excessive scarring, such as after glaucoma filtering surgery, in response to eye implants, corneal allograft transplant rejection; and other ophthalmic conditions, such as diabetic macular edema, retinal vein occlusion, RLBP1-related retinal dystrophy, choroideremia, and color blindness;

[0058] (xiv) Neurological and neurodegenerative diseases, including Parkinson's disease, complications and / or side effects of treatment for Parkinson's disease, AIDS-related dementia complex, HIV-related encephalopathy, Devic's disease, Sydenham's chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, stroke, post-polio syndrome, psychiatric disorders, myelitis, encephalitis, subacute sclerosing panencephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Fabry disease, Gaucher disease, cystinosis, Pompe disease, metachromatic leukodystrophy, Wiscott's disease, Aldrich syndrome, adrenoleukodystrophy, beta-thalassemia, sickle cell disease, Guillain-Barré syndrome, Sydenham's chorea, myasthenia gravis, pseudotumor cerebrum, Down syndrome, Huntington's chorea, CNS compression or CNS trauma or infection of the CNS, muscular dystrophy and nutritional disorders, diseases, conditions or disorders of the central and peripheral nervous systems, motor neuron diseases including amyotrophic lateral sclerosis, spinal muscular atrophy, spinal cord and laceration injuries; and

[0059] (xv) cystic fibrosis; mucopolysaccharidoses, including Sanfilipo syndrome A, Sanfilipo syndrome B, Sanfilipo syndrome C, Sanfilipo syndrome D, Hunter syndrome, Hurler-Scheie syndrome, and Morchau syndrome; ADA-SCID; X-linked SCID; X-linked chronic granulomatous disease; porphyria; hemophilia A; hemophilia B; post-traumatic inflammation, bleeding, coagulation, and acute phase response; cachexia; anorexia; acute infection; septic shock; infectious diseases; diabetes; complications or side effects of surgery; bone marrow transplantation or other transplant complications and / or side effects; complications and side effects of gene therapy, for example due to infection with viral vectors, or AIDS; to suppress or inhibit humoral and / or cellular immune responses for the prevention and / or treatment of transplant rejection in the context of transplantation of natural or artificial cells, tissues, and organs, such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.

[0060] In another aspect, the present invention provides a stable or transient producer cell for producing a lentiviral vector, comprising at least one nucleotide sequence encoding a modified U1 snRNA of the present invention.

[0061] In another aspect, the present invention provides a method for producing a lentiviral vector as described herein, comprising the following steps:

[0062] a. introducing into a cell a nucleotide sequence encoding vector components, and at least one nucleotide sequence encoding a modified U1 snRNA of the present invention, wherein the vector components include gag, env, rev and RNA genome of a lentiviral vector;

[0063] b. optionally selecting a cell comprising the nucleotide sequence encoding the vector components and at least one modified U1snRNA;

[0064] c. Culturing cells under conditions where the vector components are co-expressed with the modified U1 snRNA and a lentiviral vector is produced.

[0065] In another aspect, the present invention provides a lentiviral vector produced by the method of the present invention.

[0066] In another aspect, the present invention provides use of the modified U1 snRNA of the present invention or the expression cassette of the present invention for producing a lentiviral vector.

[0067] In another aspect, the present invention provides a lentiviral vector produced in the presence of the modified U1 snRNA of the present invention, wherein the lentiviral vector comprises an inactivated major splice donor site in the RNA genome of the lentiviral vector.

[0068] In some embodiments, the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, or Vesna lentivirus.

[0069] In some embodiments, the lentiviral vector is derived from HIV-1, HIV-2, or EIAV.

[0070] In some embodiments, the lentiviral vector is derived from HIV-1.

[0071] In some embodiments, the lentiviral vector is derived from SIV.

[0072] In some embodiments as described herein, the major splice donor site in the RNA genome of the lentiviral vector is inactivated.

[0073] In some embodiments, the major splice donor site and the cryptic splice donor site 3' to the major splice donor site in the RNA genome of the lentiviral vector are inactivated.

[0074] In some embodiments, the lentiviral vector is a third generation lentiviral vector.

[0075] In some embodiments, the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is used in a tat-independent lentiviral vector.

[0076] In some embodiments, the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein a cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is generated in the absence of tat.

[0077] In some embodiments, the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is no longer tat-dependently transcribed.

[0078] In some embodiments, the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is used in a U3-independent lentiviral vector.

[0079] In some embodiments, the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is no longer transcribed independently of the U3 promoter.

[0080] In some embodiments, the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence has been transcribed by a heterologous promoter.

[0081] In some embodiments, the cryptic splice donor site is the first cryptic splice donor site 3' to the major splice donor site.

[0082] In some embodiments, the cryptic splice donor site is within 6 nucleotides of the major splice donor site.

[0083] In some embodiments, the major splice donor site and the cryptic splice donor site are mutated or deleted.

[0084] In one aspect, the present invention provides a nucleotide sequence encoding an RNA genome of a lentiviral vector, wherein the nucleotide sequence comprises a sequence as shown in any one of SEQ ID NOs: 1, 3, 4, 9, 10 and / or 13 before the splice site is inactivated. The nucleotide sequence may include a sequence having a mutation or deletion relative to the sequence shown in any one of SEQ ID NOs: 1, 3, 4, 9, 10 and / or 13. In one aspect, the sequence comprises SEQ ID NO: 13.

[0085] In one aspect, the nucleotide sequence comprises an inactivated major splice donor site that would otherwise have a cleavage site immediately upstream of nucleotide 1 of the major splice donor region (SEQ ID NO: 13).

[0086] In one aspect, the nucleotide sequence comprises an inactivated major splice donor site and an inactivated cryptic splice donor site, which would otherwise have a cleavage site immediately upstream of nucleotide 1 of the major splice donor region (SEQ ID NO: 13) and between nucleotides 4 and 5 corresponding to nucleotides.

[0087] In some embodiments, the nucleotide sequence encoding the RNA genome of the lentiviral vector comprises an inactivated major splice donor site that would otherwise have a cleavage site between nucleotides corresponding to nucleotides 13 and 14 of SEQ ID NO:1.

[0088] In some embodiments, the nucleotide sequence prior to inactivation of the major splice donor site comprises the sequence shown in SEQ ID NO:4.

[0089] In some embodiments, the nucleotide sequence prior to inactivation of the cryptic splice donor site comprises the sequence shown in SEQ ID NO:10.

[0090] In some embodiments, the nucleotide sequence encoding the RNA genome of the lentiviral vector comprises an inactivated cryptic splice donor site that would otherwise have a cleavage site between nucleotides corresponding to nucleotides 17 and 18 of SEQ ID NO:1.

[0091] In some embodiments, the nucleotide sequence encoding the RNA genome of the lentiviral vector includes a sequence as shown in any one of SEQ ID NO: 2, 5, 6, 7, 8, 11, 12 and / or 14.

[0092] In a preferred aspect, the nucleotide sequence comprises the sequence shown in SEQ ID NO:14.

[0093] In some embodiments, the nucleotide sequence encoding the RNA genome of the lentiviral vector does not include the sequence shown in SEQ ID NO:9.

[0094] In some embodiments, the splicing activity of the major splice donor site and the cryptic splice donor site of the RNA genome from the lentiviral vector is inhibited or eliminated.

[0095] In some embodiments, the splicing activity of the major splice donor site and the cryptic splice donor site of the RNA genome from the lentiviral vector is inhibited or eliminated in the transfected or transduced cells.

[0096] In some embodiments, the nucleotide sequence encoding the RNA genome of the lentiviral vector can be linked to the nucleotide sequence encoding the modified U1 snRNA.

[0097] In one aspect, the nucleotide sequence encoding the modified U1 snRNA and the nucleotide sequence encoding the RNA genome of the lentiviral vector are on different nucleotide sequences, such as on different plasmids.

[0098] In one aspect, the nucleotide sequence according to the present invention is used in a tat-independent lentiviral vector system. In one aspect, the lentiviral vector system may be a third generation lentiviral vector system.

[0099] In one aspect, the nucleotide sequence is applicable to a lentiviral vector in a tat-independent system for vector production. As described herein, third generation lentiviral vectors are tat-independent, and the nucleotide sequences according to the invention can be used in the case of third generation lentiviral vectors. For clarity, the term "tat-independent" means that the HIV-1U3 promoter used to drive transcription of the vector genome cassette is replaced by a heterologous promoter. In one aspect of the invention, tat is not provided in the lentiviral vector production system, for example, tat is not provided in trans. In one aspect, the cell or vector or vector production system as described herein does not contain a tat protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0100] Figure 1 : Schematic diagram of the U1 snRNA molecule and examples of how to modify the targeting sequences for use in the present invention. The endogenous noncoding RNA U1 snRNA binds to the consensus splice donor site (5′-MAGGURR-3′) during the early stages of intron splicing via the 5′-(AC)UUACCUG-3′ (grey highlighted) natural splice donor targeting sequence. Stem-loop I binds to the U1A-70K protein, which has been shown to be important for polyA repression. Stem-loop II binds to the U1A protein, and the 5′-AUUUGUGG-3′ sequence, together with stem-loop IV, binds to the Sm protein, which is important for U1 snRNA processing. In the present invention, the modified U1 snRNA is modified to introduce a heterologous sequence complementary to the target sequence within the vector genome vRNA molecule at the site of the natural splice donor targeting sequence; in this figure, the example given directs the modified U1 snRNA to 15 nucleotides (256-270, 256U1 relative to the first nucleotide of the vector genome molecule) of the standard HIV-1 lentiviral vector genome (if it is a packaging signal, it is located in the SL1 loop).

[0101] Figure 2 : Increased lentiviral vector titer mediated by modified U1 snRNA is independent of the suppression of polyA sites in the 5'LTR of the vector genome. [A] A GFP-polyA-GLuciferase reporter cassette was designed to evaluate the effects of two polyA signal mutants (pAM1 = AAUAAA>AACAAA; pAKO = AAUAAA deletion) and the wild-type polyA signal (wt pA = AAUAAA) on transcriptional readthrough of the HIV-1 polyA site. Readthrough of the HIV-1 polyA signal was measured by luciferase activity, which was normalized by GFP expression. [B] Vector particles were prepared using one standard lentiviral vector genome (STD-LV) and two lentiviral vector genomes containing different 5'LTR polyA signal mutants (Δ5'pA-LV pAM1 or pAM2) in the absence (NegCtrl) or presence of modified U1 snRNA (256_U1, provided in parallel during production) and then titrated.

[0102] Figure 3: Increase in lentiviral vector titer mediated by modified U1 snRNA does not require a functional U1A-70K or U1A protein binding loop. [A] U1 snRNA was modified to target the 256-270 region of the LV genome or two sites in the lacZ sequence (negative control). Modified U1A snRNAs were made with mutations known to disrupt binding of the U1A-70K protein, the U1A protein, or the sm protein (sequences shown). Modified U1A5, U1A6, and U1A7 snRNA variants were also prepared. [B] Effect of various modified U1 snRNAs provided in trans during production on LV-GFP titer.

[0103] Figure 4 : Effects of varying length and targeting sequence using modified U1 snRNA. Standard lentiviral vector encoding GFP was produced in the absence (black bars) or presence of modified U1 snRNA with a targeting sequence for a site along the 5' end length of the vector genome vRNA molecule, the targeting sequence comprising a 15 nucleotide (dark grey bar) or 9 nucleotide (light grey bar) targeting complementary length. The modified U1 snRNAs are named according to the first nucleotide of the targeting sequence site along the 5' end length of the vector genome vRNA molecule. The data bar for each modified U1 snRNA is aligned below the approximate marked position of each known functional sequence within the 5' end of the vector genome vRNA (not to scale).

[0104] Figure 5 : Production of a standard lentiviral vector encoding GFP in the absence (black bars) or presence of a modified U1 snRNA with a targeting sequence to a site along the 5' length of the vector genome vRNA molecule, the targeting sequence comprising a 15 nucleotide (dark grey bar) targeting complementary length. The modified U1 snRNAs are named according to the first nucleotide of the targeting sequence site along the 5' length of the vector genome vRNA molecule. The data bar for each modified U1 snRNA is aligned below the approximate marked position of each known functional sequence within the 5' end of the vector genome vRNA (not to scale).

[0105] Figure 6: Use of modified U1 snRNA to increase the titer of lentiviral vectors encoding different transgenes. Standard lentiviral vectors encoding GFP (pHIV-EF1a-GFP) or CD19 chimeric antigen receptor (pHIV-EF1a-CD19) were produced in the absence (-) or presence of modified U1 snRNA, which targets either a site within the lentiviral vector packaging region (256U1 or 305U1) or a LacZ control (LacZU1). The modified U1 snRNAs are named according to the first nucleotide of the targeted sequence site within the lentiviral vector packaging region. The modified U1 snRNA expression constructs were provided at two different doses: 1x or 4x.

[0106] Figure 7: The impact of abnormal splicing of the major splice donor site (MSD) in HIV-1-based lentiviral vectors. A. A schematic diagram showing the typical construction of a third-generation (self-inactivating (SIN)) lentiviral vector expression cassette, which contains a functional major splice donor embedded in the stem loop (SL2) of the packaging signal, and the types of mRNA produced during the lentiviral vector production process. The figure shows the types of mRNA produced by a "standard" lentiviral vector (LV) DNA cassette and (a) a lentiviral vector DNA cassette with a functional mutation in the MSD region that inhibits or removes the promiscuous activity from the MSD ("MSD-KOLVDNA cassette"). For both cassettes, full-length ("unspliced") vector RNA (vRNA) is produced by co-expression of rev bound to the rev response element (RRE), and it is generally believed that splicing of the splice acceptor 7 (sa7) included in the RRE sequence by the MSD is inhibited. For the standard lentiviral vector DNA cassette, in the absence of rev, it is generally believed that splicing out of all introns can occur efficiently ("spliced"). However, "abnormal" splicing products may be generated during lentiviral vector production, where MSD efficiently splices splice acceptor sites or cryptic splice acceptor sites ("abnormally" spliced), usually "ignoring" introns containing RRE, so that rev has minimal impact on this activity of MSD. Lentiviral vector production can also be performed by co-expression of modified U1 snRNA redirected to the packaging region of the MSD-mutated lentiviral vector DNA cassette. (Legend: Pro, promoter; the region from 5'R to gag contains the packaging element {Ψ}; msd, major splice donor; cppt, central polypurine tract; Int, intron; sd / sa, splice donor / acceptor; GOI, gene of interest; gray arrows indicate the positions of the forward {f} and reverse {r} primers used to assess the proportion of unspliced ​​vRNA produced during third-generation lentiviral vector production. For clarity, the post-transcriptional regulatory element {PRE} is not shown). B. Total RNA extracted from standard third-generation lentiviral vector production in HEK293T cells + / - rev. Total RNA was subjected to qPCR (SYBR green) using two primer sets (positions marked in A): f+rT amplifies the total transcripts produced by the lentiviral expression cassette, and f+rUS amplifies the unspliced ​​transcripts; therefore, the proportion of unspliced ​​vRNA transcripts in the total vRNA transcripts was calculated and plotted. The data show that the proportion of unspliced ​​vRNA relative to the total during standard third-generation lentiviral vector production is modest and varies depending on the internal transgene cassette (containing different promoters and the GFP gene in this case); in addition, this proportion is only minimally increased by the action of rev.

[0107] Figure 8HIV-1 lentiviral vector genomes containing three different promoter-GFP expression cassettes (EF1a, EFS, and CMV) were modified to functionally mutate MSD, thereby generating an “MSD-2KO” lentiviral vector genome or backbone (for description of mutations see Fig.15 A). Vectors were produced and titrated in HEK293T cells under standard protocols. Data show that functional mutation of MSD ("MSD-2KO") results in a 100-fold reduction in lentiviral vector titer.

[0108] Fig. 9 : A shows the construction of a standard lentiviral expression cassette encoding an EF1a-GFP internal expression cassette or a lentiviral expression cassette with a MSD mutation and a schematic diagram of the types of mRNA produced during lentiviral production. (Legend: Pro, promoter; the region from 5'R to gag contains the packaging element {Ψ}; msd, major splice donor; cppt, central polypurine tract; Int, intron; sd / sa, splice donor / acceptor; GOI, gene of interest; gray arrows indicate the positions of the forward {f} and reverse {r} primers used to assess the proportion of unspliced ​​vRNA produced during third-generation lentiviral production. For clarity, post-transcriptional regulatory elements {PRE} are not shown). B i Standard lentiviral vectors or MSD-2KO lentiviral vectors were produced in HEK293T cells with + / - tat, or 179U1 or 305U1, and titrated. ii Total cytoplasmic mRNA was extracted from post-production cells and analyzed by RT-PCR / gel electrophoresis using primers (f+rG) that detect the major "abnormal" splicing product from the SL2 splicing region to the EF1a splice acceptor. The data demonstrate that the modified U1 snRNA redirected to the 5' packaging region of the MSD-2KO lentiviral vector genome (vRNA) is able to increase the titer of both standard and MSD-2KO lentiviral vectors in a manner similar to tat. The MSD-2KO mutation abolishes the detection of "abnormal" splicing products from the SL2 splicing region to the EF1a splice acceptor (see Fig. 9 A) Importantly, the increase in titer produced by the modified U1 snRNA was accompanied by the maintenance of barely detectable "abnormal" splicing products compared to using tat.

[0109] Fig.10: Standard lentiviral vectors or MSD-mutated lentiviral vectors encoding an internal GFP cassette driven by EF1a, EFS or CMV promoters were produced in HEK293T cells with + / -256U1 and titrated. The enhanced lentiviral titers obtained by using modified U1 snRNA redirected to the 5' packaging region were independent of the promoter employed in the transgene cassette. The data indicate that the attenuated phenotype of the MSD-2KO mutation is largely rescued by co-expression of the modified U1 snRNA, thus, surprisingly increasing the titer of the MSD-mutated lentiviral vector genome in a disproportionate manner compared to the standard lentiviral vector genome.

[0110] Fig.11 : The enhancement of lentiviral vector titers of MSD mutants obtained by using modified U1 snRNA redirected to the 5' packaging region is independent of the inhibition of the potential activity of the 5' polyA signal within the 5' LTR. Previous reports have shown that mutations in the MSD can activate the polyA signal and the "mini-reporter" cassette within the 5' R sequence of the 5' LTR of the HIV-1 provirus, leading to premature transcription termination; binding of endogenous U1 snRNA or even redirected U1 snRNA can block this polyA activity. A GFP-polyA-GLuciferase reporter cassette was designed to evaluate the effects of two polyA signal mutants (pAM1 = AAUAAA>AACAAA; pAKO = AAUAAA deletion) and the wild-type polyA signal (wt pA = AAUAAA) on transcriptional readthrough of the HIV-1 polyA site. Readthrough of the HIV-1 polyA signal can be measured by luciferase activity, which can be normalized by GFP expression. B To test whether the modified U1 snRNA acts in a similar manner, a functional polyA mutation (pAm1) in the 5'polyA signal was introduced into the MSD-mutated lentiviral vector genome carrying the EF1a-GFP or CMV-GFP expression cassette. Standard lentiviral vector genomes and MSD-mutated lentiviral vector genomes carrying the EF1a-GFP or CMV-GFP expression cassettes were also used. Lentiviral vectors were produced in HEK293T cells + / -305U1 and titrated. The data show that functional removal of the 5'polyA signal only causes a modest increase in lentiviral vector titer, so the observed increase in lentiviral vector titer provided by the modified U1 snRNA, especially the MSD-2KO / polyA-mutated lentiviral vector genome, cannot be attributed to the inhibition of 5'polyA activity.

[0111] Fig.12: Several mutations were introduced into the 305U1 and 256U1 modified U1 snRNAs that are known to abrogate the binding of the U1-70K protein to SL1, the binding of the U1A protein to SL2, or the binding / access of the Sm protein to SL4 of the vector genome. Standard lentiviral vectors encoding the EF1a-GFP internal cassette or MSD-2KO lentiviral vectors were produced in the presence of these mutated modified U1 snRNAs and titrated, and the titer values ​​were normalized to the standard lentiviral vector produced without the modified U1 snRNA. The data indicate that the enhancement of the MSD-2KO lentiviral vector titer obtained by the modified U1 snRNA is not dependent on the U1-70K protein or U1A protein binding, but rather on the Sm protein binding site. Therefore, the enhancement of the MSD-2KO lentiviral vector titer obtained by using the modified U1 snRNA redirected to the 5' packaging region is not related to any known function of the U1 snRNA.

[0112] Fig.13 : Improving the titer of MSD-mutated lentiviral vectors by using modified U1 snRNAs containing targeting sequences of different lengths. MSD-2KO lentiviral vectors containing an EF1a-GFP cassette were produced in HEK293T cells in the presence of modified U1 snRNAs targeting the "305" region, where each modified U1 snRNA contained a retargeting sequence with a different complementary length. Increased titer was observed when using modified U1 snRNAs containing complementary lengths of 7 to 15 nucleotides, with the greatest effect observed at 10 or more nucleotides.

[0113] Fig.14 : Maximum titer recovery / growth of MSD-mutated lentiviral vectors was observed when the modified U1 snRNA was targeted to the packaging region of the vector genome RNA. MSD-2KO lentiviral vectors containing an EF1-GFP box were produced in the presence of a modified U1 snRNA having a targeting sequence that binds to a site along the 5' end length of the vector genome vRNA molecule, the targeting sequence comprising a 15 nucleotide (or the 9 nucleotides described) targeting complementary length. The modified U1 snRNAs are named according to the first nucleotide of the targeting sequence site along the 5' end length of the vector genome vRNA molecule. The data bars for each modified U1 snRNA are aligned below the approximate marked position of each known functional sequence within the 5' end of the vector genome vRNA (not to scale).

[0114] Fig.15: Description of functional major splice donor mutations, their effects on lentiviral vector titers, and recovery of modified U1 snRNA. A shows the sequence of the stem-loop 2 (SL2) region of "wild-type" HIV-1 at the top (NL4-3; the "standard" sequence in current lentiviral vector genomes). The sequence includes the major splice donor site (MSD: consensus sequence = CTGGT) and the cryptic splice donor site (used when the MSD site itself is mutated (crSD: consensus sequence = TGAGT). The nucleotides at the splice position when the splice donor site is used are indicated by bold and arrows. Four functional MSD mutations are described that eliminate the splicing activity of both the MSD and crSD sites: MSD-2KO, which mutates the two "GT" motifs from the MSD and crSD sites (and is widely used in most examples); MSD-2KOv2, which also includes mutations that eliminate the MSD and crSD sites; MSD-2KOm5, which introduces a completely new stem-loop structure without any splice donor sites; and ΔSL2, which completely deletes the SL2 sequence. The substituted bases introduced into the SL2 sequence of the MSD-2KO, MSD-2KOv2 and MSD-2KOm5 mutants are shown in lowercase italics. B Cloning of four lentiviral vector genome variants containing functional MSD mutations (in Fig.15 A), and in addition cloned MSD-2KO or MSD-2KOm5 variants with EF1a-, CMV-, or huPGK-GFP internal cassettes. Standard LV and MSD mutant LV were produced in HEK293T cells + / - 256U1 and titrated. The data show that the degree of attenuation of lentiviral vector titers can vary depending on the specific mutation, and the MSD-2KOm5 variant generally produces a less attenuated phenotype. When co-expressed during production, the modified U1 snRNA was able to increase the lentiviral titers of four lentiviral vector genome variants including functional MSD mutations. The titer increase was greatest when 256U1 was expressed together with the MSD mutant LV genome carrying the MSD-2KOm5 sequence.

[0115] Fig.16:The modified U1 snRNA expression cassette can be located on the lentiviral vector genome plasmid backbone for use in transient transfection protocols. In the production of lentiviral vectors, many embodiments use a separate modified U1 snRNA expression plasmid to co-transfect with the lentiviral vector component plasmids. In order to identify "permissive" sites on the lentiviral vector genome plasmid backbone so that the modified U1 snRNA cassette can be provided in cis during transient transfection, three variants were cloned. A schematic diagram of a lentiviral vector genome variant that provides a modified U1 snRNA cassette in cis during transient transfection. Version 1 (“[cis]ver1”) and version 3 (“[cis]ver3”) place the modified U1 snRNA cassette between the resistance marker and the replication origin such that the modified U1 snRNA cassette is inverted relative to the lentiviral vector genome cassette (the orientation of the resistance marker is different between ver1 and ver3), whereas version 2 (“[cis]ver2”) places the modified U1 snRNA cassette upstream of the lentiviral vector genome cassette and in the same orientation. (Legend: Pro, promoter; region from 5’R to gag contains the packaging element {Ψ}; msd, major splice donor {shown here as MSD-2KO}; RRE, rev response element; cppt, central polypurine tract; transgene, heterologous sequence containing the therapeutic payload; U1-Pro, U1 promoter; Term[3’box], U1 transcription terminator). B Three "cis" versions of the MSD-2KO lentiviral vector genome plasmids containing the EF1a-GFP cassette were used to produce lentiviral vectors in HEK293T cells in a parallel process to the "trans" versions, where the same MSD-2KO lentiviral vector genome (without the modified U1 snRNA cassette inserted in the backbone) was produced by co-transfection with a separate plasmid with or without the supply of modified U1 snRNA. The data indicate that, similar to co-transfection of a separate encoding plasmid with modified U1 snRNA, the MSD-2KO lentiviral vector titer can be increased by using the "cis" lentiviral vector genome.

[0116] Fig.17: Further demonstration of the use of modified U1 snRNA to increase the titer of a standard lentiviral vector encoding a therapeutic transgene. Standard lentiviral vectors containing an EF1a-driven transgene cassette encoding codon-optimized or wild-type human α1-antitrypsin fused to GFP via T2A peptide or a chimeric antigen receptor (CAR) to the cancer antigen 5T4 were produced under serum-free, + / - modified U1 snRNA (256U1) suspension HEK293T cell conditions and titrated by integration assay and GFP-FACS assay (as indicated). The data showed that vector titer increased approximately 3-fold when modified U1 snRNA was provided during production.

[0117] Fig.18 : The successful isolation of HEK293T cells stably expressing modified U1 snRNAs that can augment standard lentiviral vectors or MSD-2KO lentiviral vectors demonstrates that modified U1 snRNA cassettes can be introduced into lentiviral packaging and producer cell lines. Standard lentiviral vector genomes or MSD-2KO lentiviral vector genomes containing the EFS-GFP cassette were produced in HEK293T or HEK293T.305U1 (9nt variant) cells + / - additional 305U1 plasmids. The data show that stable cassettes expressing modified U1 snRNAs can be introduced into cells without toxicity.

[0118] Fig.19: Abnormally spliced ​​mRNAs expressing transgenes during lentiviral vector production are removed in the MSD-2KO lentiviral vector, thereby reducing the amount of transgene mRNA required to be targeted by TRAP when using the TRiP system. A Schematic diagram of the "TRiP" lentiviral vector genome encoding the EF1a-GFP transgene cassette, in which the TRAP binding site (tbs) is located within the 5'UTR of the cassette (providing TRAP during vector production reduces transgene expression levels). During the production of the MSD-2KO lentiviral vector, full-length, unspliced ​​packageable vRNA and transgene mRNA are the major RNA forms produced by the lentiviral vector cassette (i) (when the transgene promoter is active during production). However, the promiscuous activity of MSD in the standard lentiviral vector genome results in additional "abnormally" spliced ​​products that may encode the transgene (ii); this can occur independently of the internal transgene promoter (i.e., tissue-specific promoter). (Legend: Pro, promoter; the region from 5'R to gag contains the packaging element {Ψ}; msd, major splice donor; cppt, central polypurine tract; Int, intron; sd / sa, splice donor / acceptor; GOI, gene of interest; grey arrows indicate the positions of the forward {f} and reverse {r} primers used to assess the proportion of unspliced ​​vRNA produced during the third-generation lentiviral vector production process. For clarity, the post-transcriptional regulatory element {PRE} is not shown). B Lentiviral vectors were produced in HEK293T cells using a standard lentiviral vector genome plasmid or an MSD-2KO lentiviral vector genome plasmid containing an EF1a-GFP cassette, and GFP expression scores (% GFP x MFI) were generated. MSD-2KO has a significant effect of reducing the amount of GFP produced relative to the total amount of GFP produced in the culture during the standard lentiviral vector production process, even in the absence of TRAP. Therefore, the repressive effect of TRAP is enhanced by using the MSD-2KO lentiviral vector genome, resulting in much lower levels of GFP in the culture.

[0119] Fig. 20 : The enhancement of lentiviral vector titers obtained by using modified U1 snRNA is associated with increased packaging of vector RNA into viral particles. Total RNA was extracted from RNAse-treated crude vector supernatant of the vector produced in Example 5 (see Figure 6 RT-qPCR was performed on purified RNA using primers targeting the HIV-1 packaging signal in the vector genomic RNA. The increase in vRNA signal in crude vector harvests produced in the presence of modified U1 snRNA directed against vRNA was consistent with Figure 6 The magnitude of the increase in vector titers reported in was similar.

[0120] Fig.21: Improving the titer of VSVG-pseudotyped lentiviral vectors encoding α1-antitrypsin (α1AT) by using modified U1 snRNA, with concomitant suppression of transgene expression during production. HIV-1-based LVs encoding codon-optimized (co) or wild-type (wt) α1AT proteins, which were translationally linked to GFP expression (via the T2A peptide), were produced in HEK293T serum-free suspension cells in the absence or presence of 256U1. [A] Clarified vector harvests were titrated by transduction of adherent HEK293T and flow cytometry. [B] Post-production cell lysates were immunoblotted for transgene protein and β-actin. A modest but observable reduction in transgene expression was evident in cells co-transfected with the 256U1 expression plasmid.

[0121] Fig. 22 : Improving the titer of Sendai virus (SeV) enveloped pseudotyped lentiviral vectors encoding α1-antitrypsin (α1AT) by using modified U1 snRNA, with concomitant suppression of transgene expression during production. HIV-1-based LVs encoding the α1AT protein translationally associated with GFP expression (via the T2A peptide) were produced in adherent or suspension (serum-free) HEK293T cells in the absence or presence of 256U1. SeV-F / HN pseudotyped LVs required activation by trypsin treatment prior to transduction. [A] Clarified vector harvests were obtained by transduction of adherent HEK293T and titration by flow cytometry. [B] Post-production cell lysates were immunoblotted for transgene protein and β-actin. A modest but observable reduction in transgene expression was evident in cells co-transfected with the 256U1 expression plasmid. The increase in LV titers mediated by 256U1 was more pronounced with SeV F / HN-pseudotyped vectors than with VSVG-pseudotyped vectors due to the reduced expression of α1-antitrypsin during the production process ( Fig.21 ). SeV F protein needs to be activated by trypsin before transduction, so the presence of α1AT in the crude vector may inhibit this activation step.

[0122] Fig.23 : Using modified U1 snRNA to improve the titer of lentiviral vectors containing inverse transgene cassettes. [A] Schematic diagram of the LV genomic expression cassette encoding the inverse β-globin gene driven by the LCR-β-globin promoter (containing the exons / introns required for efficient expression in primary cells). [B] LV preparations were produced in suspension (serum-free) HEK293T cells in the absence or presence of the modified U1 snRNA. The clarified vector harvest was then titrated by transduction of adherent HEK293T cells followed by integration assays.

[0123] Fig.24 : The titer of the lentiviral vector was observed to be increased by using modified U1 snRNA in concentrated vector materials as well as in crude vector materials. In the absence or presence of 256U1, HIV-1 based lentiviral vectors encoding the firefly luciferase / GFP dual reporter gene cassette driven by the EF1a promoter were produced in suspended (serum-free) HEK293T cells. Most of the clarified vector harvest was concentrated by centrifugation to achieve a concentration factor of about 20 times. The clarified vector harvest and concentrated vector were titrated by transducing adherent HEK293T cells and then measuring GFP positive cells by flow cytometry.

[0124] Fig.25 : Development of a Taqman-based RT-qPCR assay for detecting modified U1 snRNA to assess expression levels and carryover. [A] Schematic showing 256 U1 snRNA molecules and the binding locations of forward / reverse primers and FAM / TAMRA-coupled probes. The main difference between endogenous U1 snRNA and the modified U1 snRNA described in the present invention is at the 5' end of the molecule; the natural splice donor annealing sequence is replaced with a targeting sequence, thereby enabling the modified U1 snRNA to anneal to the vector genomic RNA. Due to the necessary requirement of using a reverse primer for the cDNA synthesis step (using reverse transcriptase), both endogenous U1 snRNA and modified U1 snRNA will contribute to the cDNA pool generated during cDNA synthesis from cellular RNA and (potentially) RNA extracted from vector particles. Therefore, in order to distinguish between endogenous U1 snRNA and modified U1 snRNA, the forward primer was designed to anneal to the vRNA targeting sequence at the 5' end. [B] Ct thresholds plotted for Taqman qPCR (+ / - RT step) of total RNA extracted from cell lysates transfected with or without p256U1. 7 The standard curve (black circles) generated using a standard sample of +RT and -RT treated samples from p256U1-transfected cells (with 10 copies per reaction) has good range and linearity. The approximately 2-fold difference in cycles between the untransfected cell sample and cells transfected with p256U1 (without RT step) indicates possible levels of residual p256U1 DNA associated with the samples, even though the samples were treated with DNAse after the RT step. The average difference in Cts between +RT and -RT treated samples from p256U1-transfected cells was 19.4 cycles, which was consistent with the standard curve generated when the samples were diluted 80-fold (i.e., approximately 10 copies per reaction). 5 copies), this difference is 20 cycles.

[0125] Fig.26: Dose effect of adding modified U1snRNA expression plasmid to the transfection mixture in a transient transfection method for lentiviral vector production. HIV-1-based LV-CAR vectors (encoding EF1a promoter-driven boxes expressing CARs targeting CD19) were produced by transient transfection in suspended (serum-free) HEK293T cells in the absence or presence of increasing amounts of co-transfected p256U1. [A] Total RNA was extracted from cells after production, and the levels of vector genome RNA (vRNA) or 256U1 snRNA were quantified by RT-qPCR. All data were adjusted according to control RT-qPCR for endogenous transcripts (RPH1). [B] Clarified LV-CAR vector supernatants were titrated by transducing adherent HEK293T cells followed by integration assays (qPCR of extracted host cell DNA using vRNA primers). The data show that there is a correlation between 256U1 snRNA and vRNA levels in production cells, resulting in similar increases in vector output titers.

[0126] Fig. 27 : Application of multivariate modeling (by "experimental design" [DoE]) to optimize the ratio of modified U1 snRNA and LV component plasmids for the production of an example of a lentiviral vector encoding a therapeutic transgene. HIV-EF1a-5T4CAR vectors were produced at a 40 mL shake flask scale in suspended (serum-free) HEK293T cells. GagPol and rev input levels were fixed, and genome, VSVG, and 256U1 plasmid levels were varied. Crude vector harvests were titrated by transducing adherent HEK293T cells and then by immunocytometry using anti-CAR antibodies (light gray bars; "test" T1-28). The titer values ​​generated by the DoE experiment were able to predict the optimal p256U1 input level, which was then used ("DoE prediction" D1-3) or without p256U1 ("blank form" P1-3) to further produce vector preparations. This optimization experiment enabled the use of p256U1, which increased the HIV-EF1a-5T4CAR output titer by approximately 10-fold.

[0127] Fig.28:+ / -256U1 HIV-EF1a-5T4CAR vector production and concentration, to produce concentrated vectors for primary T cell transduction and residual 256U1 snRNA analysis. By transient transfection of 250mL shake flask scale suspended (serum-free) HEK293T cells, and ion exchange chromatography, DNAse treatment with salt active nuclease (SAN), followed by low-speed centrifugation, HIV-EF1a-5T4CAR ("LV-CAR") vectors are produced. By transducing HEK293T cells and then performing integration tests, vector preparations are titrated.

[0128] Fig.29 : Detection and quantification of residual 265U1 snRNA in vector preparations. HIV-EF1a-5T4CAR ("LV-CAR") produced under + / -256U was analyzed prior to RT-qPCR analysis of vector-associated RNA to quantify vRNA and 256U1 residual DNA levels / ratios (see Fig.28 ) were subjected to total RNA extraction from vector samples produced by PCR. The data suggest that the high levels of 256U1 snRNA initially detected in clarified vector harvests were primarily due to "free" 256U1 snRNA, which could be removed by treatment with Benzonase (clarified vector harvests were not treated with Benzonase during purification). This treatment reduced the 256U1:vRNA ratio to 1:20, which was further reduced to 1:32 following treatment with salt-active nuclease (SAN) during downstream processing / concentration.

[0129] Fig.30 : Comparative protein analysis of concentrated / purified preparations of HIV-EF1a-5T4CAR produced by + / -256U by mass spectrometry. Concentrated / purified LV-CAR preparations (see Table IV) used for transduction of primary T cells (see Table IV) were analyzed by mass spectrometry. Fig.28 and 29) were analyzed to assess any major differences in protein content that may have been caused by the expression of U1 snRNA molecules modified by 256U1 during LV production. For vectors produced in the presence of 256U1 (LV-CAR[+256U1]), the top 400 protein hits were ranked from 1 to 400 based on relative abundance as a percentage of the total, and the relative abundance of these hits within LV-CAR or LV-CAR[+256U1] were plotted on the y-axis. Of these 400 proteins, the top 100 proteins accounted for approximately 70% of the total protein abundance, while the top 10 proteins accounted for approximately 30% of the total protein abundance. The top two hits with the highest abundance were both Gag and VSV-G for LV preparations, and other cytokines known to be incorporated at high levels in HIV-1 viral particles include basic immunoglobulin (Basigin), HSPc-71K, pyroprotein, and cyclophilin A, which specifically binds to the viral capsid. The comparison showed that there were few differences between the protein compositions of the two LV preparations. The ratio of peptide abundance mapped to Gag versus Pol was approximately 16 for both LV preparations, consistent with the expected ratio of approximately 20 for HIV-1, indicating good data quality.

[0130] Fig.31 : CAR-T cells were generated using HIV-EF1a-5T4CAR vector produced with + / -256U. Approximately 1.5x10 from three healthy donors 6 Peripheral blood mononuclear cells (PBMCs) were cultured with CD3 / CD28 T cell expander microbeads and incubated with IL-2. Figures 28 to 30 and Table IV) were transduced with activated T cells at MOI 1.25 and additionally transduced with LV-CAR [+256U1] at MOI 0.3. [A] In the preparation of frozen live cell banks (1x10 7 vc / vial), monitor total viable cell counts on day 13 (D13) after transduction. CAR-T cells were recovered and expanded for 5 days (R+5) to prepare for cell killing and cytokine release assays (see Fig.32 and 33 ). [B] Percent transduction was determined on day 8 (D8) after transduction and upon recovery from frozen stocks.

[0131] Fig.32 : Evaluation of the function of CAR-T cells produced using LV-CAR vectors produced in the presence or absence of 256U1; cytokine release. Resuscitated CAR-T cells were expanded for another 5 days, and the survival rate was >97%. Approximately 1x10 5CAR-T cells were co-cultured with the same number of target cell lines: THP-1, Kasumi-1, and SKOV-3 (all 5T4-positive) and AML-193 (5T4-negative cell line). After 24 hours, the culture supernatant was analyzed for granzyme-B [A] and interferon-γ activity [B] using cell counting beads.

[0132] Fig.33 : Evaluation of the function of CAR-T cells produced using LV-CAR vectors produced with or without 256U1; target cell killing effect. The revived CAR-T cells were expanded for another 5 days, and the survival rate was >97%. Approximately 1x10 5 CAR-T cells were co-cultured with the same number of target cell lines: THP-1, Kasumi-1 and SKOV-3 (all 5T4 positive) and AML-193 (5T4 negative cell line). Target cells were labeled with fluorescent cell tracking dyes for subsequent identification by flow cytometry. Cells were harvested after 40 hours and stained with fluorescent active dyes. The percentage of non-viable target cells in each experimental well was measured by flow cytometry and compared with the survival rate of target cell cultures only (no CAR-T added).

[0133] Fig.34 : Analysis of residual vector-associated RNA in CAR-T expansion cultures after transduction with HIV-EF1a-5T4CAR produced in the presence of 256U1. Fig.31 ) During the expansion of CAR-T cells after transduction with two different MOIs, cell pellets were harvested on days 8 and 13. Total RNA was extracted and RT-qPCR was performed for RPH1 mRNA, vRNA (Psi), and 256U1 snRNA. The difference in abundance of endogenous RPH1 transcripts and residual 256U1 snRNA was calculated by the ΔCt method.

[0134] Fig.35 :By transiently transfecting lentiviral vector packaging cell lines with or without p256U1 in shake flasks and bioreactors, HIV-EF1a-CAR (CD19) vectors are produced. HIV-EF1a-CAR_CD19 or HIV-EF1a-CAR_CD19-T2A-GFP genomic plasmids are transfected into suspension with or without p256U1, adapted to serum-free lentiviral vector packaging cell lines (PAC). Produced in 40mL shake flasks or 250mL bioreactors. Suspended, adapted to serum-free HEK293T cells are used as controls, in which all vector component plasmid DNAs are also co-transfected.

[0135] Fig.36: Enhancement of lentiviral vector production by a suspended, adapted (serum-free) HEK293T cell line stably transfected with a 256U1 snRNA expression cassette. HEK293T cells were stably transfected with a 256U1 snRNA expression cassette that could be linked to a hygromycin B resistance marker cassette, and then a suspended, adapted (serum-free) HEK293T cell line "256U1c39" was isolated from the HEK293T cells. The evaluation showed that HIV-EF1a-5T4CAR titers were increased compared to the parental HEK293T cell line within 10 weeks with or without selection pressure. The data showed that the 256U1c39 clone stably produced 256U1 snRNA at levels close to or the same as those of transiently transfected HEK293T parental cells.

[0136] Fig.37 : Testing the length of the retargeting sequence of modified U1 snRNA. HIV-EF1a-GFP, HIV-EF1a-CARCD19, or HIV-EF1a-5T4CAR vectors were produced in suspended (serum-free) HEK293T cells in the presence of modified U1 snRNA targeting position 305 within the LV packaging region of the vRNA. Each 305U1 variant tested contained a different length of targeting sequence: 5, 7, 9 to 15 nucleotides and was compared to unmodified U1 and 256U1 (15nt). Clarified vector supernatants were titrated by transduction of adherent HEK293T cells followed by flow cytometry [A] or integration assay [B].

[0137] Fig.38 : The improvement in lentiviral vector titer by modified U1 snRNA appears to be unrelated to the reported ability of U1 snRNA to generate the "AU" dinucleotide dependency in the splicing finalization complex. HIV-EF1a-GFP vectors were produced in suspended (serum-free) HEK293T cells (see Table V) with the 256U1 snRNA with the described dinucleotide variants and titrated in adherent HEK293T cells. Relative titers (relative to no 256U1) were plotted and the effects on titer (13nt variants; light gray bars) and predicted CBP20 binding scores were ranked from highest to lowest as described by Yeh et al. (2017). The dotted line indicates the increase in titer of the 256U1_13_aT control variant. There appears to be no correlation between the predictive power of the CAP binding score for each dinucleotide variant and the increase in vector titer.

[0138] Fig.39 : Fine-tuning of modified U1 targeting sites. Based on the clear "hot spots" identified by 256 U1 snRNAs (see Figure 4 and 5) designed modified U1 snRNAs containing 13 nucleotide target annealing lengths (Table VI). These modified U1 snRNAs were designed so that the target site was moved upstream or downstream of the nt256 target site in the HIV-1-based LV genome in increments of approximately 2 nt. HIV-EF1a-GFP vectors were produced in suspended (serum-free) HEK293T cells by transient transfection in the absence or presence of each indicated variant-modified U1 snRNA. Clarified vector supernatants were titrated by transduction of adherent HEK293T cells and then analyzed by flow cytometry.

[0139] Fig.40 : EIAV-based lentiviral vector titers were boosted by co-transfecting producer cells with modified U1 snRNA targeting the 5' packaging region of EIAV vRNA. Suspended (serum-free) HEK293T cells were transfected with pEIAV-CMV-GFP or pEIAV-EF1a-GFP genomic plasmids and pGagPol, pRev and pVSVG with or without the specified modified U1 snRNA expression plasmids (see Table VI). Clarified vector supernatants were titrated by transduction of adherent HEK293T cells followed by flow cytometry. Relative titers are plotted compared to vectors produced in the absence of modified U1 snRNA expression plasmids (striped bars).

[0140] Fig.41 : Improving SIVagm-based lentiviral vector titers by co-transfecting producer cells with modified U1 snRNA targeting the 5' packaging region of SIVagm vRNA. Suspension (serum-free) HEK293T cells were transfected with SIV vector components and with or without the specified modified U1 snRNA expression plasmids (see Table VIII). Clarified vector supernatants were titrated by transduction of adherent HEK293T cells followed by integration assays. DETAILED DESCRIPTION

[0141] General Definition

[0142] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology and immunology, which are within the capabilities of those skilled in the art and are explained in the literature. See, for example: J. Sambrook, EF Fritsch, and T. Maniatis (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, FMet al. (1995 and periodic supplements) Current Protocols in Molecular Biology, Ch. 9, 13, and 16, John Wiley & Sons, New York, NY; B. Roe, J. Crabtree, and A. Kahn (1996) DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; JMPolak and James O'D. McGee (1990) In Situ Hybridization: Principles and Practice; Oxford University Press; MJ Gait (ed.) (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; and DMJ Lilley and JE Dahlberg (1992) Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. The entire contents of these documents are incorporated herein by reference.

[0143] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Unless otherwise specified, "rev" and "gag-pol" refer to proteins and / or genes of lentiviral vectors.

[0144] As used herein, the term "protein" includes proteins, polypeptides and peptides. As used herein, the term "protein" includes single-chain polypeptide molecules and complexes of multiple polypeptides in which the individual constituent polypeptides are linked covalently or non-covalently. As used herein, the terms "polypeptide" and "peptide" refer to polymers in which monomers are amino acids and are linked together by peptide bonds or disulfide bonds.

[0145] As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein". In some cases, the term "amino acid sequence" is synonymous with the term "peptide". In some cases, the term "amino acid sequence" is synonymous with the term "enzyme".

[0146] As used herein, the term "nucleotide sequence" is synonymous with the term "polynucleotide" and / or the term "nucleic acid sequence."

[0147] The present disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to the methods and materials described herein can be used in the practice or testing of the embodiments of the present disclosure. Numerical ranges include the numbers of the limited ranges. Unless otherwise indicated, any nucleic acid sequence is written from left to right in the 5' to 3' direction; amino acid sequences are written from left to right in the direction of amino to carboxyl, respectively.

[0148] It should be understood that where a numerical range is provided, unless the context clearly dictates otherwise, the interval also specifically discloses each intermediate value between the upper and lower limits of the range, up to one tenth of the unit of the lower limit. Each smaller range between any specified value or intermediate value in a specified range and any other specified value or intermediate value in the specified range is included in the present disclosure. The upper and lower limits of these smaller ranges may be independently included in the range or excluded from the range, and one, neither, or both of the two extreme values ​​of each range are included in the smaller range, and are also included in the present disclosure, subject to any specific excluded extreme value in the specified range. Where a specified range includes one or two extreme values, ranges excluding one or both of these included extreme values ​​are also included in the present disclosure.

[0149] It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0150] As used herein, the terms "comprising, comprises, comprised of" are synonymous with "including, includes" or "containing, contains", and are inclusive or open-ended, thus not excluding additional, non-recited components, elements or method steps. The terms "comprising, comprises, comprised of" also include the term "consisting of".

[0151] Modified U1 snRNA

[0152] The inventors surprisingly found that the output titer of lentiviral vectors can be increased by co-expressing non-coding RNA based on modified U1 snRNA, which has been modified so that they no longer target endogenous sequences (splice donor sites) but instead target sequences within the vRNA molecule. The present invention relates to such modified U1 snRNA and a novel method for increasing the production titer of lentiviral vectors. The method comprises co-expressing the modified U1 snRNA with other vector components during the vector production process. The U1 snRNA is designed so that it binds to a conserved splice donor site, which is removed by replacing it with a heterologous sequence complementary to a target sequence within the vector genome vRNA. The present invention describes various application modes and optimal characteristics of the modified U1 snRNA, including target sequence and complementary length, design and expression mode.

[0153] Human U1 snRNA (small nuclear RNA) is 164 nt long and has a well-defined structure consisting of four stem-loops (see Figure 1 ). Endogenous noncoding RNA (U1 snRNA) binds to a common 5' splice donor site (e.g., 5'-MAGGURR-3', where M is A or C and R is A or G) at the early stage of intron splicing via a natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3'). Stem-loop I binds to the U1A-70K protein, which has been shown to be important for polyA repression. Stem-loop II binds to the U1A protein, and the 5'-AUUUGUGG-3' sequence, together with stem-loop IV, binds to the Sm protein, which is important for U1 snRNA processing. In the present invention, the modified U1 snRNA is modified to introduce a heterologous sequence complementary to a target sequence within the vector genome vRNA molecule at the site of the natural splice donor targeting sequence (see Figure 1 ).

[0154] As used herein, the terms "modified U1 snRNA", "redirected U1 snRNA", "retargeted U1 snRNA", "redesigned U1 snRNA" and "mutated U1 snRNA" refer to U1 snRNA that has been modified so that it no longer binds to the common 5' splice donor site sequence (e.g., 5'-MAGGURR-3') used to initiate the splicing process of the target gene. Therefore, the modified U1 snRNA is modified based on the complementarity of the donor site sequence to the natural splice donor annealing sequence at the 5' end of the U1 snRNA so that it no longer binds to the splice donor site sequence (e.g., 5'-MAGGURR-3'). Alternatively, the modified U1 snRNA is designed to bind to a nucleotide sequence (target site) having a unique RNA sequence within the packaging region of the lentiviral vector genome molecule, i.e., a sequence that is not related to gene splicing. The nucleotide sequence within the packaging region of the lentiviral vector genome molecule can be pre-selected. Therefore, the modified U1 snRNA is a U1 snRNA modified so that its 5' end binds to a nucleotide sequence in the packaging region of the lentiviral vector genome molecule. As a result, the modified U1 snRNA binds to the target site sequence based on complementarity between the target site sequence and a short sequence at the 5' end of the modified U1 snRNA.

[0155] The 5' packaging region of the lentiviral vector may have a sequence known in the art. For example, the 5' packaging region of the lentiviral vector may be any of the following:

[0156] SEQ ID NO:67–HIV-1(HxB2)[GenBank:K03455.1]:

[0157]

[0158] SEQ ID NO:68 - HIV-2 [NCBI Reference Sequence: NC_001722.1]:

[0159]

[0160]

[0161] SEQ ID NO:69–EIAV (SPEIAV-19 strain) [GenBank:U01866.1]:

[0162] SEQ ID NO:70–SIVagm (TYO-1 strain) [GenBank: AB253736.1]:

[0163]

[0164]

[0165] SEQ ID NO:71-SIVmac (Mm251 strain) [GenBank:M19499.1]:

[0166] SEQ ID NO:72—FIV (Petaluma strain, clone: ​​34TF10)

[0167] [GenBank:M25381.1]:

[0168]

[0169]

[0170] Appropriate modified U1 snRNA can be designed to bind to the packaging region of a particular vector type. For example, increasing the output titer of a lentiviral vector using a modified U1 snRNA can be achieved by following the following general procedure:

[0171] 1. The lentiviral vector genome sequence should be obtained and a set of target sequences should be identified within the 5' packaging sequence region of the vector genome RNA molecule. The broad 5' packaging sequence region is from the first nucleotide of the vector genome RNA molecule to the 3' nucleotide of the remaining wild-type gag sequence, which is usually retained as part of the packaging sequence.

[0172] 2. It is recommended to identify a set of target sequences of 15 nucleotides in length in the initial target screening, and to first identify 15 to 20 different (non-overlapping) sequences. These sequences should be evenly distributed in the packaging sequence from the first nucleotide of the vRNA to about the 50th nucleotide of the gag region, with fewer sequences identified in the retained gag region.

[0173] 3. These target sequences present in the vector genomic RNA (5'-3') should be reverse complementary to provide a 15 nucleotide Target annealing sequence, which will be encoded within the first nucleotide (5'-3') of the modified U1 snRNA molecule.

[0174] 4. Insert the target annealing sequence into the U1 snRNA expression cassette (comprising the U1 promoter and termination region) thereby replacing the natural U1 snRNA nucleotides 3 to 11, i.e., the "AT" dinucleotide (nucleotides 1 and 2 of the natural U1 snRNA ["AU" in the snRNA molecule]) should remain upstream of the target annealing sequence, and "A" is the transcription start site. This can be achieved by standard molecular cloning / gene synthesis techniques.

[0175] 5. A panel of modified U1 snRNA expression constructs should then be screened by producing lentiviral vectors encoding the transgenic sequence of interest, where each modified U1 snRNA expression construct is expressed individually with the vector components. This is most easily done by transient co-transfection with the vector components, but can also be done in packaging or producer cell lines. The output vector supernatant is then titrated to empirically determine the major target regions that cause the greatest titer increase.

[0176] 6. The modified U1 snRNA can be further improved by generating variants containing target annealing sequences that incrementally target the vector genomic RNA upstream and downstream of the initial, empirically determined target site. Incremental scanning can be achieved by progressively shifting the target annealing sequence by one, two, three, or four or more nucleotides per variant, upstream or downstream of the initial, empirically determined target site, possibly continuing to the target position tested in the previous (initial) screen. This can determine the optimal target site within the vector genomic RNA.

[0177] 7. The modified U1 snRNA can be further improved by generating variants containing target annealing sequences of different lengths. It is suggested to take a modified U1 snRNA identified from a previous screen (which may have a target annealing sequence of 15 nucleotides) and design variants in which the target annealing sequence is gradually reduced or increased so as to generate a new set of variants in which the target annealing sequence of each variant may be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length. This new set of modified U1 snRNA variants can then be screened as previously described.

[0178] 8. The modified U1 snRNA can be further improved by generating variants containing alternative nucleotides at positions 1 and 2. Specifically, the "AT" dinucleotide ("AU" in the snRNA molecule) can be changed to avoid this consensus, for example to "GA". This new set of modified U1 snRNA variants can then be screened as described above.

[0179] 9. The modified U1 snRNA expression construct can be encoded within a DNA molecule (eg, plasmid DNA) separate from the lentiviral vector components, or can be operably linked to DNA encoding the vector genome or gagpol or other DNA components co-transfected with the vector components (eg, a plasmid expressing TRAP).

[0180] 10. The modified U1 snRNA expression construct can be stably transfected to generate a cell line that can be used to produce a lentiviral vector by transient transfection. For example, the cell line can also be stably transfected with a transcriptional repressor (such as tetR) and / or a translational repressor (such as TRAP), or both types of expression control proteins.

[0181] 11. The modified U1 snRNA expression construct can be stably transfected with other lentiviral vector components to generate packaging or producer cell lines.

[0182] 12. Another method for obtaining the above stable cell line is to insert the modified U1 snRNA expression cassette into a self-inactivating retroviral or lentiviral vector, produce vector virus particles encoding the modified U1 snRNA expression cassette, and transduce cells at a controlled multiplicity of infection (MOI) to isolate stable cell lines that are more likely to contain the target copy number of the modified U1 snRNA expression cassette. The self-inactivating retroviral or lentiviral vector may also contain a selection marker cassette.

[0183] 13. To assess the RNA or DNA copy number of modified U1 snRNA sequences in lentiviral vector production cells or lentiviral vector preparations, an RT-qPCR assay can be developed in which the forward primer anneals to the specific target annealing sequence of the modified U1 snRNA in order to specifically detect the modified U1 snRNA rather than the endogenous / natural U1 snRNA.

[0184] As used herein, the terms "natural splice donor annealing sequence" and "natural splice donor targeting sequence" refer to a short sequence at the 5' end of the endogenous U1 snRNA that is broadly complementary to the consensus 5' splice donor site of the intron. The natural splice donor annealing sequence may be 5'-ACUUACCUG-3'.

[0185] As used herein, the term "consensus 5' splice donor site" refers to a consensus RNA sequence at the 5' end of an intron used for splice site selection, for example having the sequence 5'-MAGGURR-3'.

[0186] As used herein, the terms "nucleotide sequence within the packaging region of the lentiviral vector genome sequence", "target sequence" and "target site" refer to a site having a specific RNA sequence within the packaging region of the lentiviral vector genome molecule, which is preselected as a target site for binding to modified U1 snRNA.

[0187] As used herein, the terms "packaging region of a lentiviral vector genome molecule" and "packaging region of a lentiviral vector genome sequence" refer to the region of the 5' end of the lentiviral vector genome starting from the 5'U5 domain to the end of the sequence derived from the gag gene. Therefore, the packaging region of the lentiviral vector genome molecule includes the 5'U5 domain, the PBS element, the stem-loop (SL) 1 element, the SL2 element, the SL3ψ element, the SL4 element, and the sequence derived from the gag gene. In the art, it is common to provide the genome with a complete gag gene in trans during lentiviral vector production to enable the production of replication-defective viral vector particles. The nucleotide sequence of the gag gene provided in trans does not need to be encoded by wild-type nucleotides, but can be codon-optimized; importantly, the main characteristic of the gag gene provided in trans is that it encodes and directs the expression of gag and gagpol proteins. Thus, those skilled in the art will appreciate that if the complete gag gene is provided in trans during lentiviral vector production, the term "packaging region of a lentiviral vector genome molecule" may refer to the region at the 5' end of the lentiviral vector genome molecule starting from the 5' U5 domain, through the "core" packaging signal at the SL3ψ element and the native gag nucleotide sequence from the ATG codon (present in SL4), to the end of the retained gag nucleotide sequence present on the vector genome.

[0188] As used herein, the term "sequence derived from the gag gene" refers to any native sequence of the gag gene to nucleotide 688 derived from the ATG codon that may be present in (e.g., retained in) the vector genome (Kharytonchyk, S. et.al., 2018, J. Mol. Biol., 430:2066-79).

[0189] As used herein, the terms “introducing a heterologous sequence within the first 11 nucleotides of U1 snRNA comprising a natural splice donor annealing sequence”, “introducing the heterologous sequence within the nine nucleotides at positions 3 to 11” and “introducing a heterologous sequence within the first 11 nucleotides of the 5′ end of U1 snRNA” include replacing all or part of the first 11 nucleotides or the nine nucleotides at positions 3 to 11 of U1 snRNA with the heterologous sequence, or modifying the first 11 nucleotides or the nine nucleotides at positions 3 to 11 of U1 snRNA so as to have the same sequence as the heterologous sequence.

[0190] As used herein, the terms "introducing a heterologous sequence into the natural splice donor annealing sequence" and "introducing a heterologous sequence into the natural splice donor annealing sequence at the 5' end of U1 snRNA" include replacing all or part of the natural splice donor annealing sequence with the heterologous sequence, or modifying the natural splice donor annealing sequence so that it has the same sequence as the heterologous sequence.

[0191] As used herein, the term "increasing lentiviral vector titer" includes "increasing lentiviral vector titer" and "improving lentiviral vector titer".

[0192] Thus, in one aspect, the present invention provides a modified U1 snRNA that has been modified to bind to a nucleotide sequence within the packaging region of a lentiviral vector genome sequence.

[0193] In some embodiments, the modified U1 snRNA is modified at the 5' end relative to the endogenous U1 snRNA to introduce a heterologous sequence that is complementary to a nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

[0194] In some embodiments, the modified U1 snRNA is modified at the 5' end relative to the endogenous U1 snRNA to introduce a heterologous sequence within the native splice donor annealing sequence that is complementary to a nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

[0195] The modified U1 snRNA may be modified at the 5' end relative to the endogenous U1 snRNA to replace a sequence comprising a natural splice donor annealing sequence with a heterologous sequence complementary to the nucleotide sequence.

[0196] The modified U1 snRNA may be a modified U1 snRNA variant. The modified U1 snRNA variant according to the present invention may be a naturally occurring U1 snRNA variant, a U1 snRNA variant comprising a mutation that removes U1-70K protein binding in the stem-loop I region, or a U1 snRNA variant comprising a mutation that removes U1A protein binding in the stem-loop II region. The U1 snRNA variant comprising a mutation that removes U1-70K protein binding in the stem-loop I region may be U1_m1 or U1_m2, preferably U1A_m1 or U1A_m2.

[0197] In some embodiments, the modified U1 snRNA of the invention comprises a nucleotide sequence having at least 70% identity (suitably at least 75%, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity) to the major U1 snRNA sequence [Clover Leaf] (nt 410-562) of the U1_256 sequence as described herein. In some embodiments, the modified U1 snRNA of the invention comprises a major U1 snRNA sequence [Clover Leaf] (nt 410-562) of the U1_256 sequence as described herein. The U1_256 sequence ( SEQ ID NO:15 The primary U1 snRNA sequence of ) [Clover Leaf] (nt 410-562) is as follows:

[0198]

[0199] In some embodiments, the modified U1 snRNA of the present invention comprises the following nucleotide sequence:

[0200] (wherein X is a target annealing sequence of undefined length; N is any one of A, C, G or T; N[0-2] is a nucleotide sequence of 0 to 2 nucleotides in length; and the major U1 snRNA sequence [Clover Leaf] (SEQ ID NO:66) is underlined).

[0201] In some embodiments, the modified U1 snRNA of the present invention comprises the following nucleotide sequence:

[0202] (where X is the target annealing sequence of undefined length and the major U1 snRNA sequence [Clover Leaf] (SEQ ID NO: 66) is underlined).

[0203] In some embodiments, the modified U1 snRNA of the present invention comprises the following nucleotide sequence:

[0204] (wherein N is any one of A, C, G or T; N[9-15] is a target annealing sequence of 9 to 15 nucleotides in length; and the major U1 snRNA sequence [Clover Leaf] (SEQ ID NO: 66) is underlined).

[0205] In some preferred embodiments, the first 11 nucleotides of the U1snRNA containing the natural splice donor annealing sequence can be replaced in whole or in part with a heterologous sequence complementary to a nucleotide sequence in the packaging region of the lentiviral vector genome sequence. Suitably, nucleic acids 1 to 11 (suitably 2 to 11, 3 to 11, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11) of the first 11 nucleotides of the U1snRNA are replaced with a heterologous sequence complementary to a nucleotide sequence in the packaging region of the lentiviral vector genome sequence.

[0206] In some embodiments, the natural splicing donor annealing sequence can be replaced in whole or in part by a heterologous sequence that is complementary to the nucleotide sequence in the packaging region of the lentiviral vector genome sequence. Suitably, nucleic acids 1 to 11 (suitably 2 to 11, 3 to 11, 5 to 11, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11) of the natural splicing donor annealing sequence are replaced with a heterologous sequence complementary to the nucleotide sequence in the packaging region of the lentiviral vector genome sequence. In a preferred embodiment, the entire natural splicing donor annealing sequence is replaced with a heterologous sequence complementary to the nucleotide sequence in the packaging region of the lentiviral vector genome sequence, i.e., the heterologous sequence according to the present invention completely replaces the natural splicing donor annealing sequence (e.g., 5'-ACUUACCUG-3').

[0207] In some embodiments, a modified U1 snRNA comprising a heterologous sequence complementary to a nucleotide sequence within the packaging region of a lentiviral vector genome sequence will encode an A at the first nucleotide 5' to the heterologous sequence, regardless of whether the A participates in annealing to a target sequence.

[0208] In some embodiments, a modified U1 snRNA comprising a heterologous sequence complementary to a nucleotide sequence within the packaging region of a lentiviral vector genome sequence will encode an AU at the first two nucleotides of the 5' end of the heterologous sequence, regardless of whether A or U is involved in annealing to the target sequence.

[0209] In some embodiments, the modified U1 snRNA comprising a heterologous sequence complementary to a nucleotide sequence within the packaging region of a lentiviral vector genome sequence does not encode an AU at the first two nucleotides at the 5' end of the heterologous sequence, and the first nucleotide may or may not participate in annealing to the target sequence.

[0210] In some embodiments, the heterologous sequence complementary to the nucleotide sequence in the packaging region of the lentiviral vector genome sequence includes at least 7 nucleotides complementary to the nucleotide sequence. In some embodiments, the heterologous sequence complementary to the nucleotide sequence in the packaging region of the lentiviral vector genome sequence includes at least 9 nucleotides complementary to the nucleotide sequence. Preferably, the heterologous sequence used in the present invention includes 15 nucleotides complementary to the nucleotide sequence.

[0211] Suitably, the heterologous sequence for use in the invention may comprise 7 to 25 (suitably 7 to 20, 7 to 15, 9 to 15, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25) nucleotides.

[0212] Suitably, the heterologous sequence for use in the present invention may comprise 7 nucleotides.

[0213] Suitably, the heterologous sequence for use in the present invention may comprise 8 nucleotides.

[0214] Suitably, the heterologous sequence for use in the present invention may comprise 9 nucleotides.

[0215] Suitably, the heterologous sequence for use in the present invention may comprise 10 nucleotides.

[0216] Suitably, the heterologous sequence for use in the present invention may comprise 11 nucleotides.

[0217] Suitably, the heterologous sequence for use in the present invention may comprise 12 nucleotides.

[0218] Suitably, the heterologous sequence for use in the present invention may comprise 13 nucleotides.

[0219] Suitably, the heterologous sequence for use in the present invention may comprise 14 nucleotides.

[0220] Suitably, the heterologous sequence for use in the present invention may comprise 15 nucleotides.

[0221] Suitably, the heterologous sequence for use in the present invention may comprise 16 nucleotides.

[0222] Suitably, the heterologous sequence for use in the present invention may comprise 17 nucleotides.

[0223] Suitably, the heterologous sequence for use in the present invention may comprise 18 nucleotides.

[0224] Suitably, the heterologous sequence for use in the present invention may comprise 19 nucleotides.

[0225] Suitably, the heterologous sequence for use in the present invention may comprise 20 nucleotides.

[0226] Suitably, the heterologous sequence for use in the present invention may comprise 21 nucleotides.

[0227] Suitably, the heterologous sequence for use in the present invention may comprise 22 nucleotides.

[0228] Suitably, the heterologous sequence for use in the present invention may comprise 23 nucleotides.

[0229] Suitably, the heterologous sequence for use in the present invention may comprise 24 nucleotides.

[0230] Suitably, the heterologous sequence for use in the present invention may comprise 25 nucleotides.

[0231] In some embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence is located within the 5'U5 domain, the PBS element, the SL1 element, the SL2 element, the SL3ψ element, the SL4 element and / or a sequence derived from the gag gene. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence is located within the SL1, SL2 and / or SL3ψ elements. In some preferred embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence is located within the SL1 and / or SL2 elements. In some particularly preferred embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence is located within the SL1 element.

[0232] In some embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence includes at least 7 nucleotides. In some embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence includes at least 9 nucleotides. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence includes 7 to 25 (suitably 7 to 20, 7 to 15, 9 to 15, 7, 8, 9, 10, 11, 12, 13, 14 or 15) nucleotides.

[0233] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 7 nucleotides.

[0234] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 8 nucleotides.

[0235] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 9 nucleotides.

[0236] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 10 nucleotides.

[0237] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 11 nucleotides.

[0238] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 12 nucleotides.

[0239] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 13 nucleotides.

[0240] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 14 nucleotides.

[0241] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 15 nucleotides.

[0242] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 16 nucleotides.

[0243] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 17 nucleotides.

[0244] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 18 nucleotides.

[0245] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 19 nucleotides.

[0246] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 20 nucleotides.

[0247] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 21 nucleotides.

[0248] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 22 nucleotides.

[0249] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 23 nucleotides.

[0250] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 24 nucleotides.

[0251] Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 25 nucleotides.

[0252] Preferably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises 15 nucleotides.

[0253] The binding of the modified U1 snRNA of the present invention to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence can increase the lentiviral vector titer during the lentiviral vector production process relative to the production of the lentiviral vector in the absence of the modified U1 snRNA of the present invention. Therefore, the production of the lentiviral vector in the presence of the modified U1 snRNA of the present invention increases the lentiviral vector titer relative to the production of the lentiviral vector in the absence of the modified U1 snRNA of the present invention. Suitable assays for measuring the titer of the lentiviral vector are as described herein. Suitably, the production of the lentiviral vector involves the co-expression of the modified U1 snRNA with vector components including gag, env, rev and RNA genome of the lentiviral vector. In some embodiments, the increase in lentiviral vector titer occurs in the presence or absence of a functional 5'LTR polyA site. In some embodiments, the increase in lentiviral vector titer mediated by the modified U1 snRNA of the present invention is independent of the inhibition of the polyA site in the 5'LTR of the vector genome.

[0254] In some embodiments, the binding of the modified U1 snRNA of the invention to the nucleotide sequence within the packaging region of the lentiviral vector genomic sequence can increase the lentiviral vector titer by at least 30% during lentiviral vector production relative to lentiviral vector production in the absence of the modified U1 snRNA of the invention. Suitably, the binding of the modified U1 snRNA of the invention to the nucleotide sequence within the packaging region of the lentiviral vector genomic sequence can increase the lentiviral vector titer by at least 35% (suitably at least 40%, 45%, 50%, 60%, 70%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950% or 1000%) during lentiviral vector production relative to lentiviral vector production in the absence of the modified U1 snRNA of the invention.

[0255] The modified U1 snRNA of the present invention can be designed by the following steps: (a) selecting a target site (preselected nucleotide site) for binding to the modified U1 snRNA in the packaging region of the lentiviral vector genome; (b) introducing a heterologous sequence into the natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3') at the 5' end of the U1 snRNA, which is complementary to the preselected nucleotide site selected in step (a).

[0256] It is within the capabilities of those of ordinary skill in the art to introduce a heterologous sequence complementary to the target site into the natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3') at the 5' end of the endogenous U1 snRNA using conventional techniques in molecular biology, or to replace the natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3') with a heterologous sequence complementary to the target site. In general, suitable conventional methods include directed mutagenesis or replacement via homologous recombination.

[0257] It is within the capabilities of a person of ordinary skill in the art to modify the natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3') at the 5' end of the endogenous U1 snRNA using conventional techniques in molecular biology to have a sequence identical to a heterologous sequence complementary to the target site. For example, suitable methods include directed mutagenesis or random mutagenesis followed by selection of mutations that provide a modified U1 snRNA according to the invention.

[0258] The modified U1 snRNA of the present invention can be produced according to methods known in the art. For example, the modified U1 snRNA can be produced by chemical synthesis or recombinant DNA / RNA technology.

[0259] It is within the capabilities of one of ordinary skill in the art to introduce a nucleotide sequence encoding a modified U1 snRNA of the invention into a cell using conventional molecular and cell biology techniques. For example, an expression cassette may be used as described below.

[0260] Therefore, in another aspect, the present invention provides a cell comprising the modified U1 snRNA of the present invention. Suitable cells are described below.

[0261] In another aspect, as demonstrated in the examples of the present invention, the modified U1 according to the present invention as described herein may beneficially cause repression of transgene expression. Thus, the present invention also includes methods of using modified U1 for transgene repression, or methods or uses thereof, as described herein.

[0262] Nucleotide sequence

[0263] In another aspect, the present invention provides a nucleotide sequence encoding the modified U1 snRNA of the present invention.

[0264] The term "nucleotide sequence" related to the present invention can be a double-stranded or single-stranded molecule and includes genomic DNA, cDNA, synthetic DNA, RNA and chimeric DNA / RNA molecules. Preferably, the nucleotide sequence refers to a DNA encoding the modified U1snRNA of the present invention, more preferably a cDNA sequence.

[0265] Typically, nucleotide sequences encompassed within the scope of the present invention are prepared using recombinant DNA techniques (ie, recombinant DNA), as described herein.

[0266] In a preferred embodiment, the nucleotide sequence encoding the modified U1 snRNA of the present invention is an expression cassette.

[0267] The presence / abundance of modified U1 snRNA molecules can be quantified in vector production cell extracts or vector viral particles by extracting total RNA and then performing RT-PCR or RT-qPCR (quantitative) using DNA primers. Importantly, the forward primer is designed to have complementarity to the target sequence of the modified U1 snRNA molecule, so that only the modified U1 snRNA and not the endogenous U1 snRNA is amplified during qPCR.

[0268] In one aspect, the invention provides a vector viral particle comprising a modified U1 according to the invention as described herein.

[0269] Vector / Expression Cassette

[0270] A vector is a tool that allows or facilitates the transfer of an entity from one environment to another. According to the present invention, and by way of example, some vectors used in recombinant nucleic acid technology allow an entity, such as a nucleic acid segment (e.g., a heterologous DNA segment, such as a heterologous cDNA segment), to be transferred into and expressed by a target cell. The vector can facilitate the integration of a nucleotide sequence encoding a modified U1 snRNA (or viral vector component) of the present invention to maintain the nucleotide sequence encoding a modified U1 snRNA (or viral vector component) of the present invention and its expression in a target cell.

[0271] The vector can be an expression cassette or can include an expression cassette (also referred to as an expression construct). An expression cassette as described herein comprises a nucleic acid region containing a sequence that can be transcribed. Therefore, sequences encoding mRNA, tRNA and rRNA are included in this definition.

[0272] The vector may contain one or more selectable marker genes (e.g., a neomycin resistance gene) and / or a traceable marker gene (e.g., a gene encoding green fluorescent protein (GFP)). The vector may be used, for example, to infect and / or transduce target cells. The vector may also contain a nucleotide sequence that enables the vector to replicate in the host cell in question.

[0273] The term "cassette", which is synonymous with terms such as "conjugate", "construct" and "hybrid", includes a polynucleotide sequence directly or indirectly connected to a promoter. The expression cassette of the present invention comprises a promoter for expressing a nucleotide sequence encoding the modified U1 snRNA of the present invention and an optional regulator of a nucleotide sequence encoding the modified U1 snRNA of the present invention. The expression cassette used in the present invention comprises a promoter for expressing a nucleotide sequence encoding a viral vector component and an optional regulator of a nucleotide sequence encoding a viral vector component. Preferably, the cassette comprises at least a polynucleotide sequence that can be connected to a promoter.

[0274] The expression cassette can be used to replicate the nucleotide sequence encoding the modified U1 snRNA of the present invention in a compatible target cell in vitro. Thus, the present invention provides a method for preparing a modified U1 snRNA in vitro by introducing the expression cassette of the present invention into a compatible target cell in vitro and growing the target cell under conditions that cause the expression of the modified U1 snRNA. The modified U1 snRNA can be recovered from the target cell by methods known in the art. Suitable target cells include mammalian cell lines and other eukaryotic cell lines.

[0275] The choice of expression cassette (e.g., plasmid, cosmid, viral or phage vector) generally depends on the host cell to be introduced. The expression cassette can be a DNA plasmid (supercoiled, nicked or linearized), a minicircle DNA (linear or supercoiled), a plasmid DNA containing only the region of interest by removing the plasmid backbone through restriction enzyme digestion and purification, a DNA generated using an enzymatic DNA amplification platform, such as doggybone DNA (dbDNA TM ), wherein the final DNA used is in a closed ligated form, or the DNA has been prepared (e.g., restriction enzyme digestion) to have open cleaved ends.

[0276] Therefore, in one aspect, the present invention provides an expression cassette comprising a nucleotide sequence encoding a modified U1 snRNA of the present invention.

[0277] In one aspect of the invention, a modified U1 expression cassette as described herein may be delivered to a cell as described herein via a lentiviral vector or a retroviral vector.

[0278] It is within the capabilities of one of ordinary skill in the art to introduce the expression cassettes of the invention into cells using routine molecular and cell biology techniques.

[0279] In another aspect, the invention provides a cell comprising an expression cassette of the invention. Suitable cells are described below.

[0280] Lentiviral vector production systems and cells

[0281] The lentiviral vector production system comprises a set of nucleotide sequences encoding the components required for producing the lentiviral vector. Thus, the vector production system comprises a set of nucleotide sequences encoding the viral vector components necessary for producing lentiviral vector particles.

[0282] A "viral vector production system" or "vector production system" or "production system" is to be understood as a system comprising the components required for the production of lentiviral vectors.

[0283] In one aspect, the nucleotide sequence is applicable to a lentiviral vector in a tat-independent vector production system. As described herein, third generation lentiviral vectors are U3-dependent (and use a heterologous promoter to drive transcription), and the nucleotide sequence according to the invention can be used in the context of third generation lentiviral vectors. In one aspect of the invention, tat is not provided in the lentiviral vector production system, for example, tat is not provided in trans. In one aspect, the cell or vector or vector production system as described herein does not contain a tat protein.

[0284] In one aspect, the present invention provides a nucleotide sequence encoding an RNA genome of a lentiviral vector, wherein a major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein a cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is used for a tat-independent lentiviral vector.

[0285] In one aspect, the present invention provides a nucleotide sequence encoding an RNA genome of a lentiviral vector, wherein a major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein a cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is produced in the absence of tat.

[0286] In one aspect, the present invention provides a nucleotide sequence encoding an RNA genome of a lentiviral vector, wherein a major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein a cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence has been transcribed independently of tat.

[0287] In one aspect, the present invention provides a nucleotide sequence encoding an RNA genome of a lentiviral vector, wherein a major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein a cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is used for a U3-independent lentiviral vector.

[0288] In one aspect, the present invention provides a nucleotide sequence encoding an RNA genome of a lentiviral vector, wherein a major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein a cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence has been transcribed independently of the U3 promoter.

[0289] In one aspect, the present invention provides a nucleotide sequence encoding an RNA genome of a lentiviral vector, wherein a major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein a cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence has been transcribed by a heterologous promoter.

[0290] In one aspect, transcription of a nucleotide sequence as described herein is independent of the presence of U3. The nucleotide sequence may be derived from a transcriptional event that is independent of U3. The nucleotide sequence may be derived from a heterologous promoter. The nucleotide sequence as described herein may not contain a native U3 promoter.

[0291] In one embodiment, the viral vector production system comprises nucleotide sequences encoding Gag and Gag / Pol proteins and Env protein and vector genome sequence. The production system may optionally comprise a nucleotide sequence encoding Rev protein or a functional substitute thereof.

[0292] In one embodiment of the invention, at least one transgenic component may be inverted or in the opposite orientation.

[0293] In one embodiment, at least one transgenic component may be in reverse orientation or have an orientation opposite to the 5' to 3' directionality of the vector genome RNA. Lentiviral vector genomes may be used in which the transgenic cassette is in reverse orientation, i.e., the transcription unit is opposite to the promoter driving the vector genome cassette. In addition, there may be situations in which one component of the transgenic cassette may be in reverse orientation while another is in forward orientation, such as using bidirectional transgenic cassettes or multiple separate cassettes.

[0294] In one embodiment, the viral vector production system comprises a modular nucleic acid construct (modular construct). A modular construct is a DNA expression construct comprising two or more nucleic acids for producing a lentiviral vector. A modular construct can be a DNA plasmid comprising two or more nucleic acids for producing a lentiviral vector. The plasmid can be a bacterial plasmid. The nucleic acid can encode, for example, gag-pol, rev, env, a vector genome. In addition, modular constructs designed to generate packaging and producer cell lines may also need to encode transcriptional regulators (e.g., TetR, CymR) and / or translation repressors (e.g., TRAP) and selectable markers (e.g., Zeocin). TM, hygromycin, blasticidin, puromycin, neomycin resistance genes). Suitable modular constructs for use in the present invention are described in EP 3502260, the entire contents of which are incorporated herein by reference.

[0295] Since the modular construct used according to the present invention is included in the nucleotide sequence encoding two or more retroviral components on a construct, the safety of these modular constructs has been considered, and additional safety features are directly designed into the construct. These features include using insulators for multiple open reading frames of retroviral vector components and / or using specific orientations and arrangements of retroviral genes in modular constructs. It is believed that by using these features, direct read-through will be prevented to generate viral particles with replication capacity.

[0296] In modular constructs, the nucleic acid sequence encoding viral vector components can be in reverse and / or interactive transcription directions. Therefore, the nucleic acid sequence encoding viral vector components is not presented in the same 5' to 3' direction, so that the viral vector components cannot be produced by the same mRNA molecule. Reverse may mean that at least two coding sequences of different vector components exist in "head to head" and "tail to tail" transcription directions. This can be achieved by providing a coding sequence of a vector component (such as env) on one chain of the modular construct and providing another coding sequence of a vector component (such as rev) on another chain of the modular construct. Preferably, when there are more than two coding sequences of vector components in the modular construct, at least two coding sequences exist in the reverse transcription direction. Therefore, when there are more than two coding sequences of vector components in the modular construct, each element can be oriented so that it exists in a 5' to 3' direction opposite to all adjacent coding sequences of other adjacent vector components, that is, each coding sequence can adopt an interactive 5' to 3' (or transcription) direction.

[0297] The modular construct used according to the present invention may comprise nucleic acid sequences encoding two or more of the following vector components: gag-pol, rev, env, vector genome. The modular construct may comprise nucleic acid sequences encoding any combination of vector components. In one embodiment, the modular construct may comprise nucleic acid sequences encoding the following components:

[0298] i) RNA genome of a retroviral vector and rev or a functional substitute thereof;

[0299] ii) RNA genome and gag-pol of retroviral vector;

[0300] iii) RNA genome and env of retroviral vector;

[0301] iv) gag-pol and rev or their functional substitutes;

[0302] v) gag-pol and env;

[0303] vi) env and rev or their functional substitutes;

[0304] vii) RNA genome of a retroviral vector, rev or a functional substitute thereof, and gag-pol;

[0305] viii) the RNA genome of a retroviral vector, rev or a functional substitute thereof, and env;

[0306] ix) RNA genome, gag-pol and env of a retroviral vector; or

[0307] x) gag-pol, rev or a functional substitute thereof and env,

[0308] wherein the nucleic acid sequences are in reverse and / or alternating orientations.

[0309] In one embodiment, the cell for producing a retroviral vector may comprise a nucleic acid sequence encoding any one of the above i) to x) combinations, wherein the nucleic acid sequence is located at the same genetic locus and is in reverse and / or alternating directions. The same genetic locus may refer to a single extrachromosomal locus in a cell, such as a single plasmid or a single locus (i.e., a single insertion site) in the cell genome. The cell may be a stable or transient cell for producing a retroviral vector (e.g., a lentiviral vector).

[0310] The DNA expression construct can be a DNA plasmid (supercoiled, nicked or linearized), minicircle DNA (linear or supercoiled), plasmid DNA containing only the region of interest by removal of the plasmid backbone by restriction enzyme digestion and purification, DNA generated using an enzymatic DNA amplification platform, such as doggybone DNA (dbDNA TM ), wherein the final DNA used is in a closed ligated form, or the DNA has been prepared (e.g., restriction enzyme digestion) to have open cleaved ends.

[0311] In one embodiment, the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, or Vesna lentivirus.

[0312] "Viral vector production cell", "vector production cell" or "production cell" is understood to be a cell capable of producing a lentiviral vector or lentiviral vector particles. A lentiviral vector production cell may be a "producer cell" or a "packaging cell". One or more DNA constructs of the viral vector system may be stably integrated or maintained as free bodies within the viral vector production cell. Alternatively, all DNA components of the viral vector system may be transiently transfected into the viral vector production cell. In another alternative, production cells that stably express some components may be transiently transfected with the remaining components required for vector production.

[0313] As described herein, in one aspect of the invention, the U1 expression cassette is stably integrated into a cell according to the invention as described herein.

[0314] As used herein, the term "packaging cell" refers to a cell that contains the elements necessary for producing lentiviral vector particles but lacks a vector genome. Optionally, such packaging cells contain one or more expression cassettes capable of expressing viral structural proteins (e.g., gag, gag / pol, and env) and usually rev.

[0315] The producer cells / packaging cells may be any suitable cell type. The producer cells are typically mammalian cells, but may also be, for example, insect cells.

[0316] As used herein, the term "producer cell" or "vector production cell / vector producer cell" refers to a cell that contains all the elements required for the production of lentiviral vector particles. Producer cells can be stable producer cell lines or transiently derived, or can be stable packaging cells in which the retroviral genome is transiently expressed.

[0317] The vector production cell can be a cell cultured in vitro, such as a tissue culture cell line. Suitable cell lines include, but are not limited to, mammalian cells, such as a mouse fibroblast-derived cell line or a human cell line. Preferably, the vector production cell is derived from a human cell line.

[0318] Cells and production methods

[0319] Another aspect of the present invention relates to a method of producing a lentiviral vector, the method comprising introducing a nucleotide sequence described herein into a cell (eg, a producer cell) and culturing the cell under conditions suitable for producing the lentiviral vector.

[0320] Therefore, in one aspect, the present invention provides a method for producing a lentiviral vector, comprising the following steps:

[0321] a) introducing into a cell a nucleotide sequence encoding vector components and at least one nucleotide sequence encoding a modified U1 snRNA of the invention;

[0322] b) optionally selecting a cell comprising said nucleotide sequence encoding the vector components and at least one nucleotide sequence encoding a modified U1 snRNA of the invention;

[0323] c) further culturing the cells under conditions where the vector components are co-expressed with the modified U1 snRNA and a lentiviral vector is produced; and

[0324] d) optionally isolating the lentiviral vector.

[0325] In another aspect, the present invention provides a method for producing a lentiviral vector, comprising the following steps:

[0326] a) introducing into a cell a nucleotide sequence encoding vector components and at least one nucleotide sequence encoding a modified U1 snRNA of the invention;

[0327] b) selecting a cell comprising said nucleotide sequence encoding the vector components and at least one nucleotide sequence encoding a modified U1 snRNA of the invention;

[0328] c) optionally introducing a nucleic acid vector different from the nucleotide sequence encoding the modified U1 snRNA of the present invention into the selected cell;

[0329] d) further culturing the cells under conditions for production of the lentiviral vector; and

[0330] e) optionally isolating the lentiviral vector.

[0331] In the method of the present invention, the vector components may include gag, env, rev and / or RNA genome of a lentiviral vector. The nucleotide sequence encoding the vector components and at least one nucleotide sequence encoding the modified U1 snRNA of the present invention may be introduced into the cell simultaneously or sequentially in any order. The nucleotide sequence encoding the vector components may be introduced into the cell before the introduction of at least one nucleotide sequence encoding the modified U1 snRNA of the present invention. At least one nucleotide sequence encoding the modified U1 snRNA of the present invention may be introduced into the cell before the introduction of the nucleotide sequence encoding the vector components.

[0332] In some embodiments, the lentiviral vector can be replication defective.

[0333] In another aspect, the present invention provides a lentiviral vector produced by any of the methods of the present invention.

[0334] In another aspect, the present invention provides use of the modified U1 snRNA of the present invention, or a nucleotide sequence encoding the modified U1 snRNA of the present invention, or a producer cell of the present invention for producing a lentiviral vector.

[0335] Lentiviral vector production may involve co-expression of the modified U1 snRNA of the invention with vector components in suitable producer cells as described herein.

[0336] In another aspect, the present invention provides a method for producing a producer cell for producing a lentiviral vector, comprising the following steps:

[0337] a) introducing into a cell a nucleotide sequence encoding vector components, including gag, env, rev and RNA genome of a lentiviral vector, and at least one nucleotide sequence encoding a modified U1 snRNA of the present invention; and

[0338] b) optionally selecting a cell comprising said nucleotide sequences encoding vector components and at least one nucleotide sequence encoding a modified U1 snRNA of the invention.

[0339] In another aspect, the present invention provides a method for producing a stable producer cell for producing a lentiviral vector, comprising the following steps:

[0340] a) introducing into a cell a nucleotide sequence encoding vector components, including gag, env, rev and RNA genome of a lentiviral vector, and at least one nucleotide sequence encoding a modified U1 snRNA of the present invention; and

[0341] b) selecting cells comprising said nucleotide sequences encoding vector components or at least one nucleotide sequence encoding at least one modified U1 snRNA according to the invention.

[0342] In another aspect, the present invention provides a method for producing a transient producer cell for producing a lentiviral vector, comprising introducing into the cell a nucleotide sequence encoding vector components including gag, env, rev and RNA genome of the lentiviral vector, and at least one nucleotide sequence encoding a modified U1 snRNA of the present invention.

[0343] In another aspect, the present invention provides a cell for producing a lentiviral vector produced by any method of the present invention.

[0344] In another aspect, the present invention provides a stable producer cell for producing a lentiviral vector produced by any of the methods of the present invention.

[0345] In another aspect, the present invention provides a transient producer cell for producing a lentiviral vector produced by any of the methods of the present invention.

[0346] In another aspect, the present invention provides a cell for producing a lentiviral vector, the cell comprising at least one nucleotide sequence encoding the modified U1 snRNA of the present invention.

[0347] In another aspect, the present invention provides a stable producer cell for producing a lentiviral vector, the stable producer cell comprising at least one nucleotide sequence encoding the modified U1snRNA of the present invention.

[0348] In another aspect, the present invention provides a transient producer cell for producing a lentiviral vector, the transient producer cell comprising at least one nucleotide sequence encoding the modified U1snRNA of the present invention.

[0349] In some embodiments, the stable or transient producer cells used to produce the lentiviral vector comprise 1, 5, 10, 15, 20, or 30 stably integrated nucleotide sequences encoding the modified U1 snRNA of the invention.

[0350] In some embodiments of the methods and uses of the present invention, the binding of the modified U1 snRNA of the present invention to the nucleotide sequence in the packaging region of the lentiviral vector genome sequence during lentiviral vector production increases the lentiviral vector titer relative to the production of the lentiviral vector in the absence of the modified U1 snRNA of the present invention. Therefore, the production of lentiviral vectors in the presence of the modified U1 snRNA of the present invention increases the lentiviral vector titer relative to the production of the lentiviral vector in the absence of the modified U1 snRNA of the present invention. Suitable assays for measuring lentiviral vector titers are as described herein. Suitably, lentiviral vector production involves co-expression of the modified U1 snRNA with vector components including gag, env, rev and RNA genome of the lentiviral vector. In some embodiments, the increase in lentiviral vector titer occurs in the presence or absence of a functional 5'LTR polyA site. In some embodiments, the increase in lentiviral vector titer mediated by the modified U1 snRNA of the present invention is independent of polyA site suppression in the 5'LTR of the vector genome.

[0351] In some embodiments of the methods and uses of the present invention, the binding of the modified U1snRNA of the present invention to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence can increase the lentiviral vector titer by at least 30% during lentiviral vector production relative to lentiviral vector production in the absence of the modified U1snRNA of the present invention. Suitably, the binding of the modified U1 snRNA of the invention to the nucleotide sequence within the packaging region of the lentiviral vector genomic sequence may increase the lentiviral vector titer by at least 35% (suitably at least 40%, 45%, 50%, 60%, 70%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950% or 1000%) during lentiviral vector production relative to the production of the lentiviral vector in the absence of the modified U1 snRNA of the invention.

[0352] In some embodiments of the methods and uses of the present invention, suitable production cells or cells for producing lentiviral vectors are cells that are capable of producing viral vectors or viral vector particles when cultured under appropriate conditions. Therefore, cells generally contain nucleotide sequences encoding vector components, which may include gag, env, rev and RNA genomes of lentiviral vectors. Suitable cell lines include, but are not limited to, mammalian cells, such as mouse fibroblast-derived cell lines or human cell lines. They are typically mammals, including human cells, such as HEK293T, HEK293, CAP, CAP-T or CHO cells, but may also be, for example, insect cells, such as SF9 cells. Preferably, vector production cells are derived from human cell lines. Therefore, such suitable production cells can be used in any method or use of the present invention.

[0353] Methods for introducing nucleotide sequences into cells are well known in the art and have been described previously. Thus, using conventional techniques in molecular and cell biology within the capabilities of those skilled in the art, nucleotide sequences encoding vector components including gag, env, rev and RNA genome of a lentiviral vector, and at least one nucleotide sequence encoding a modified U1 snRNA of the present invention or at least one expression cassette of the present invention are introduced into cells.

[0354] Stable production cells can be packaging cells or producer cells. In order to produce producer cells from packaging cells, vector genome DNA constructs can be introduced stably or transiently. Packaging cells / producer cells can be produced by transducing a suitable cell line with a retroviral vector expressing one of the vector components (i.e., genome, gag-pol components, and envelope), as described in WO 2004 / 022761.

[0355] Alternatively, the nucleotide sequence can be transfected into the cell and then occasionally randomly integrated into the production cell genome. The transfection method can be performed using methods known in the art. For example, a stable transfection process can use a construct that has been engineered to help concatemerization. In another example, the transfection process can use calcium phosphate or commercially available preparations such as Lipofectamine TM 2000CD (Invitrogen, CA), HD or polyethyleneimine (PEI). Alternatively, the nucleotide sequence can be introduced into the production cell by electroporation. The technician will know the method for promoting the integration of the nucleotide sequence into the production cell. For example, if the nucleic acid construct is naturally circular, it may be helpful to linearize the nucleic acid construct. Less random integration methods may involve such a nucleic acid construct, which comprises a region with shared homology with the endogenous chromosome of the mammalian host cell to guide integration into the selected site in the endogenous genome. In addition, if there is a recombination site on the construct, these sites can be used for targeted recombination. For example, the nucleic acid construct may include a loxP site, which allows targeted integration when combined with the Cre recombinase (i.e., using the Cre / lox system derived from the P1 phage). Alternatively or additionally, the recombination site is an att site (e.g., from λ phage), wherein the att site allows site-directed integration in the presence of λ integrase. This will allow the retroviral gene to target the locus in the host cell genome, thereby allowing higher and / or stable expression.

[0356] Other methods of targeted integration are well known in the art. For example, the method of inducing genomic DNA targeted cutting can be used to promote targeted recombination at a selected chromosomal locus. These methods generally involve using methods or systems to induce double-strand breaks (DSBs), for example, nicks in endogenous genomes, to induce break repair by physiological mechanisms such as non-homologous end joining (NHEJ). Can be by using specific nucleases, such as engineered zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), using engineered crRNA / tracr RNA ("single guide RNA") to guide the CRISPR / Cas9 system of specific cutting, and / or using nucleases based on Argonaute systems (for example, from Streptococcus thermophilus (T.thermophilus)) for cutting.

[0357] The packaging / producer cell line can be generated by integrating the nucleotide sequence using only lentiviral transduction or only nucleic acid transfection, or a combination of both.

[0358] WO 2009 / 153563 describes methods for producing retroviral vectors from producer cells, in particular the processing of retroviral vectors.

[0359] In one embodiment, the production cell may comprise an RNA binding protein (eg, tryptophan RNA binding attenuating protein, TRAP) and / or a Tet repressor (TetR) protein or other regulatory protein (eg, CymR).

[0360] Production of lentiviral vectors from producer cells can be by transfection methods, production from stable cell lines can include an induction step (eg, doxycycline induction) or by a combination of both. Transfection methods can be performed using methods well known in the art, and examples have been described previously.

[0361] Producing cells, whether packaging cell lines or producer cell lines, or cells transiently transfected with lentiviral vector encoding components, can be cultured to increase cell and virus numbers and / or viral titers. Cell culture is performed to enable it to metabolize, and / or grow and / or divide and / or produce viral vectors according to the purpose of the present invention. This can be accomplished by methods well known to those skilled in the art, including but not limited to, for example, providing nutrition to cells in an appropriate culture medium. The method may include growth attached to a surface, growth in suspension, or a combination thereof. For example, batch, fed-batch, continuous systems, etc. can be used to culture in tissue culture bottles, tissue culture multiwell plates, culture dishes, roller bottles, wave bags, or bioreactors. In order to achieve large-scale production of viral vectors by cell culture, the art preferably has cells capable of suspended growth. Suitable conditions for culturing cells are known (see, for example, Tissue Culture, Academic Press, Kruse and Paterson, editors (1973), and RI Freshney, Culture of animal cells: A manual of basic technique, fourth edition (Wiley-Liss Inc., 2000, ISBN 0-471-34889-9)).

[0362] Preferably, cells are initially "packed" in tissue culture flasks or bioreactors and subsequently grown in multi-layer culture vessels or large bioreactors (greater than 50 L) to produce the vector producing cells of the invention.

[0363] Preferably, cells are grown in adherent mode to produce the vector-producing cells of the present invention.

[0364] Preferably, cells are grown in suspension mode to produce the vector-producing cells of the present invention.

[0365] Major splice donor

[0366] It has been demonstrated that mutations in the major splice donor site in the packaging region of the RNA genome of a viral vector are detrimental to vector production titers and additionally activate a cryptic splice donor (crSD) adjacent to the MSD. Abnormal splicing of the MSD or CrSD results in the production of spliced ​​RNA that cannot be packaged into vector viral particles. It has also been reported that splicing of cellular transcripts from the MSD to transcriptional read-through products derived from integrated vectors in free transduced cells has caused safety issues. The inventors describe new mutations in the MSD splicing region that cause a non-significant decrease in vector titer (in the absence of modified U1 snRNA), thereby further increasing the titer in the presence of modified U1 snRNA. This mutation or deletion of the major splice donor site has an additional improvement effect on vector titer relative to the effects described herein and can be used in combination with any other aspect of the invention described herein.

[0367] RNA splicing is catalyzed by a large RNA protein complex called the spliceosome, which is composed of five small nuclear ribonucleoproteins (snRNPs). The boundary between introns and exons is marked by a specific nucleotide sequence within the pre-mRNA, which describes where splicing occurs. This boundary is called a "splice site". The term "splice site" refers to a polynucleotide that can be recognized by the splicing machinery of a eukaryotic cell as suitable for cleavage and / or ligation to another splice site.

[0368] Splice sites allow for the excision of introns present in the pre-mRNA transcript. Typically, the 5' splice boundary is referred to as the "splice donor site" or "5' splice site" and the 3' splice boundary is referred to as the "splice acceptor site" or "3' splice site". Splice sites include, for example, naturally occurring splice sites, engineered or synthetic splice sites, standard or consensus splice sites and / or atypical splice sites, for example, cryptic splice sites.

[0369] Splice acceptor sites are usually composed of three independent sequence elements: a branch point or branch site, a polypyrimidine tract, and an acceptor consensus sequence. The branch point consensus sequence in eukaryotes is YNYTRAC (wherein Y is a pyrimidine, N is any nucleotide, and R is a purine). The 3' acceptor splice site consensus sequence is YAG (wherein Y is a pyrimidine) (see, e.g., Griffiths et al., eds., Modern Genetic Analysis, 2nd edition, WH Freeman and Company, New York (2002)). The 3' splice acceptor site is usually located at the 3' end of an intron.

[0370] Therefore, the major splice donor site in the nucleotide sequence of the RNA genome encoding the lentiviral vector used in the present invention may be inactivated.

[0371] In one aspect, the invention also provides a cell according to the invention as described herein, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, such as mutated or deleted.

[0372] In one aspect, a nucleotide sequence encoding an RNA genome of a lentiviral vector is provided, wherein a major splice donor site in the RNA genome of the lentiviral vector is inactivated, such as mutated or deleted.

[0373] The terms "canonical splice site" or "consensus splice site" are used interchangeably to refer to splice sites that are conserved across species.

[0374] The consensus sequences for the 5' donor splice site and the 3' acceptor splice site for eukaryotic RNA splicing are well known in the art. These consensus sequences include nearly invariant dinucleotides at each end of an intron: GT at the 5' end of the intron, and AG at the 3' end of the intron.

[0375] A typical splice donor site consensus sequence may be (for DNA) AG / GTRAGT (where A is adenosine, T is thymine, G is guanine, C is cytosine, R is purine and " / " indicates a cleavage site). This corresponds to the more general splice donor consensus sequence MAGGURR described herein. It is well known in the art that splice donor sequences may deviate from this consensus sequence, especially in viral genomes where other limiting factors affect the same sequence, such as secondary structure within the vRNA packaging region. Atypical splice sites are also well known in the art, although they occur less frequently compared to the typical splice donor consensus sequence.

[0376] "Major splice donor site" refers to the first (dominant) splice donor site in the viral vector genome, which is encoded and embedded in the native viral RNA packaging sequence usually located in the 5' region of the viral vector nucleotide sequence.

[0377] In one aspect, the nucleotide sequence does not comprise an active major splice donor site, ie, the major splice donor site in the nucleotide sequence does not undergo splicing, and the splicing activity of the major splice donor site is removed.

[0378] The major splice donor site is located in the 5' packaging region of the lentiviral genome.

[0379] For HIV-1 virus, the major splice donor consensus sequence is (for DNA) TG / GTRAGT (where A is adenosine, T is thymine, G is guanine, C is cytosine, R is purine and " / " indicates the cleavage site).

[0380] In one aspect of the invention, the splice donor region, i.e., the region of the vector genome containing the major splice donor site before mutation, may have the following sequence:

[0381] GGGGCGGCGACTGGTGAGTACGCCAAAAAT (SEQ ID NO: 1) In one aspect of the present invention, the mutated splice donor region may comprise the following sequence:

[0382] GGGGCGGCGACTGCAGACAACGCCAAAAAT (SEQ ID NO: 2-MSD-2KO)

[0383] In one aspect of the invention, the mutated splice donor region may comprise the following sequence:

[0384] GGGGCGGCGAGTGGAGACTACGCCAAAAAT (SEQ ID NO: 11-MSD-2KOv2)

[0385] In one aspect of the invention, the mutated splice donor region may comprise the following sequence:

[0386] GGGGAAGGCAACAGATAAATATGCCTTAAAAT (SEQ ID NO: 12-MSD-2KOm5)

[0387] In one aspect of the invention, prior to modification, the splice donor region may comprise the following sequence:

[0388] GGCGACTGGTGAGTACGCC (SEQ ID NO: 9)

[0389] This sequence is also referred to herein as the "stem-loop 2" region (SL2). This sequence may form a stem-loop structure in the splice donor region of the vector genome. In one aspect of the invention, this sequence (SL2) may have been deleted from the nucleotide sequence of the invention as described herein.

[0390] Therefore, the present invention includes nucleotide sequences that do not comprise SL2. The present invention includes nucleotide sequences that do not comprise the sequence according to SEQ ID NO:9.

[0391] In one aspect of the invention, the major splice donor site may have the following consensus sequence, wherein R is a purine and " / " is a cleavage site:

[0392] TG / GTRAGT (SEQ ID NO: 3)

[0393] In one aspect, R can be guanine (G).

[0394] In one aspect of the invention, the major splice donor and cryptic splice donor regions may have the following core sequence, wherein " / " is the cleavage site at the major splice donor and cryptic splice donor sites:

[0395] / GTGA / GTA (SEQ ID NO: 13).

[0396] In one aspect of the invention, the MSD mutated vector genome may have at least two mutations in the major splice donor and cryptic splice donor "regions" (SEQ ID NO: 13), wherein the first and second "GT" nucleotides are immediately 3' to the major splice donor and cryptic splice donor nucleotides, respectively.

[0397] In one aspect of the invention, the major splice donor consensus sequence is CTGGT (SEQ ID NO: 4).The major splice donor site may comprise the sequence CTGGT.

[0398] In one aspect, the nucleotide sequence comprises a sequence as set forth in any one of SEQ ID NOs: 1, 3, 4, 9, 10 and / or 13 prior to inactivation of the splice sites.

[0399] In one aspect, the nucleotide sequence comprises an inactivated major splice donor site that would otherwise have a cleavage site between the nucleotides corresponding to nucleotides 13 and 14 of SEQ ID NO:1.

[0400] According to the invention described herein, the nucleotide sequence further comprises an inactive cryptic splice donor site. In one aspect, the nucleotide sequence does not comprise an active cryptic splice donor site adjacent to the major splice donor site (3'), that is, splicing does not occur from the adjacent cryptic splice donor site, and splicing from the cryptic splice donor site is removed.

[0401] The term "cryptic splice donor site" refers to a nucleic acid sequence that does not normally function as a splice donor site or is less efficiently utilized as a splice donor site due to the circumstances of the adjacent sequences (e.g., the presence of a "preferred" splice donor nearby), but can be activated by mutations in the adjacent sequences (e.g., mutations in the nearby "preferred" splice donor), thereby becoming a more efficient functional splice donor site.

[0402] In one aspect, the cryptic splice donor site is the first cryptic splice donor site 3' to the major splice donor.

[0403] In one aspect, the cryptic splice donor site is within 6 nucleotides of the major splice donor site on the 3' side of the major splice donor site. Preferably, the cryptic splice donor site is within 4 or 5 nucleotides, preferably within 4 nucleotides, of the major splice donor cleavage site.

[0404] In one aspect of the invention, the cryptic splice donor site has the consensus sequence TGAGT (SEQ ID NO: 10).

[0405] In one aspect, the nucleotide sequence comprises an inactivated cryptic splice donor site that would otherwise have a cleavage site between the nucleotides corresponding to nucleotides 17 and 18 of SEQ ID NO:1.

[0406] In one aspect of the invention, the major splice donor site and / or the adjacent cryptic splice donor site comprises a "GT" motif. In one aspect of the invention, both the major splice donor site and the adjacent cryptic splice donor site contain a mutated "GT" motif. The mutated GT motif may inactivate the splicing activity of the major splice donor site and the adjacent cryptic splice donor site. An example of such a mutation is referred to herein as "MSD-2KO".

[0407] In one aspect, the splice donor region may comprise the sequence:

[0408] CAGACA (SEQ ID NO: 5)

[0409] For example, in one aspect, the mutated splice donor region can comprise the following sequence:

[0410] GGCGACTGCAGACAACGCC (SEQ ID NO: 6)

[0411] Another example of an inactivating mutation is referred to herein as "MSD-2KOv2".

[0412] In one aspect, the mutated splice donor region may comprise the following sequence:

[0413] GTGGAGACT (SEQ ID NO: 7)

[0414] For example, in one aspect, the mutated splice donor region can comprise the following sequence:

[0415] GGCGAGTGGAGACTACGCC (SEQ ID NO: 8)

[0416] For example, in one aspect, the mutated splice donor region can comprise the following sequence:

[0417] AAGGCAACAGATAAATATGCCTT (SEQ ID NO: 14)

[0418] In one aspect, the stem-loop 2 region as described above can be deleted from the splice donor region, thereby causing inactivation of the major splice donor site and the adjacent cryptic splice donor site. This deletion is referred to herein as "ΔSL2".

[0419] A variety of different types of mutations can be introduced into a nucleic acid sequence to inactivate both the major splice donor site and adjacent cryptic splice donor sites.

[0420] In one aspect, the mutation is a functional mutation that removes or inhibits splicing activity in a splicing region. The nucleotide sequences described herein may comprise a mutation or deletion in any nucleotide in any of SEQ ID NOs: 1, 3, 4, 9, 10 and / or 13. Suitable mutations are known to those skilled in the art and are described herein.

[0421] For example, point mutations can be introduced into a nucleic acid sequence. As used herein, the term "point mutation" refers to any change to a single nucleotide. Point mutations include, for example, deletions, transitions, and transversions; when present in a protein coding sequence, these mutations can be classified as nonsense mutations, missense mutations, or silent mutations. "Nonsense" mutations produce stop codons. "Missense" mutations produce codons that encode different amino acids. "Silent" mutations produce codons that encode the same amino acid, or different amino acids that do not change the function of the protein. One or more point mutations can be introduced into a nucleic acid sequence comprising a hidden splice donor site. For example, a nucleic acid sequence comprising a hidden splice site can be mutated by introducing two or more point mutations therein.

[0422] At least two point mutations can be introduced in several positions within the nucleic acid sequence comprising the major splice donor and cryptic splice donor sites to achieve attenuation of splicing in the splice donor region. In one aspect, the mutations can be within four nucleotides of the splice donor cleavage site; in a typical splice donor consensus sequence, this is A 1 G 2 / G 3 T 4 , where " / " is the cleavage site. It is well known in the art that the splice donor cleavage site may deviate from this consensus, especially in viral genomes where other constraints have an impact on the same sequence, such as secondary structures within the vRNA packaging region. 3 T 4 The dinucleotide is usually the least variable sequence in the typical splice donor consensus sequence, so it is important for G 3 and / or T 4 For example, for the major splice donor site in the HIV-1 viral vector genome, this could be T 1 G 2 / G 3T 4 , where " / " is the cleavage site. For example, for a cryptic splice donor site in the HIV-1 viral vector genome, this could be G 1 A 2 / G 3 T 4 , where " / " is the cleavage site. In addition, one or more point mutations may be introduced near the splice donor site. For example, a point mutation may be introduced upstream or downstream of the splice donor site. In embodiments where the nucleic acid sequence comprises a primary and / or cryptic splice donor site that is mutated by introducing multiple point mutations therein, point mutations may be introduced upstream and / or downstream of the cryptic splice donor site.

[0423] Construction of splice site mutants

[0424] A variety of techniques can be used to construct the splice site mutants of the present invention. For example, mutations can be introduced at a specific locus by synthesizing oligonucleotides containing the mutant sequence, which are flanked by restriction sites that can be ligated to fragments of the native sequence. After ligation, the resulting reconstructed sequence contains derivatives with the desired nucleotide insertions, substitutions, or deletions.

[0425] Other known techniques which allow the alteration of DNA sequences include recombinant methods such as Gibson assembly, Golden-gate cloning and In-fusion.

[0426] Alternatively, oligonucleotide-directed site-specific (or segment-specific) mutagenesis procedures can be used to provide altered sequences according to the desired substitutions, deletions or insertions. Deletion or truncation derivatives of splice site mutants can also be constructed by utilizing convenient restriction endonuclease sites adjacent to the desired deletion.

[0427] After restriction, the overhangs can be filled in and the DNA religated.

[0428] An exemplary method for making such changes is disclosed by Sambrook et al. (Molecular cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, 1989).

[0429] Splice site mutants can also be constructed using PCR mutagenesis, chemical mutagenesis, by forced nucleotide misincorporation (e.g., Liao and Wise, 1990), or by chemical mutagenesis (Drinkwater and Klinedinst, 1986) using random mutagenic oligonucleotides (Horwitz et al., 1989).

[0430] The present invention also provides a method for producing a lentiviral vector nucleotide sequence, comprising the following steps:

[0431] (i) providing a nucleotide sequence encoding the RNA genome of a lentiviral vector as described herein; and

[0432] (ii) mutating the major splice donor site and the cryptic splice donor site as described herein in the nucleotide sequence.

[0433] Lentiviral vectors

[0434] Slow virus is part of a larger class of retroviruses. A detailed list of slow viruses can be found in Coffin et al. (1997) ("Retroviruses" Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763). In short, slow viruses can be divided into primate and non-primate classes. Examples of primate slow viruses include, but are not limited to: human immunodeficiency virus (HIV), the pathogen of human autoimmune deficiency syndrome (AIDS), and simian immunodeficiency virus (SIV). Non-primate slow viruses include the prototype "slow virus" sheep demyelinating leukoencephalitis / sheep chronic progressive pneumonia virus (VMV), and the related caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), Maedi Visna virus (MVV) and bovine immunodeficiency virus (BIV). In one embodiment, the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, or Visna lentivirus.

[0435] In one embodiment, the lentiviral vector is derived from HIV-1.

[0436] In one embodiment, the lentiviral vector is derived from HIV-2.

[0437] In one embodiment, the lentiviral vector is derived from EIAV.

[0438] In one embodiment, the lentiviral vector is derived from SIV.

[0439] In one embodiment, the lentiviral vector is derived from FIV.

[0440] In one embodiment, the lentiviral vector is derived from BIV.

[0441] In one embodiment, the lentiviral vector is derived from CAEV.

[0442] In one embodiment, the lentiviral vector is derived from a Vesna lentivirus.

[0443] The difference between the lentiviridae and retroviruses is that lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis et al (1992) EMBO J 11(8):3053-3058 and Lewis and Emerman (1994) J Virol 68(1):510-516). In contrast, other retroviruses (such as MLV) are unable to infect non-dividing or slowly dividing cells, such as those that make up tissues such as muscle, brain, lung, and liver.

[0444] As used herein, a lentiviral vector is a vector comprising at least one component that is derivable from a lentivirus. Preferably, the component is involved in the biological mechanism by which the vector infects or transduces a target cell and expresses the NOI.

[0445] Lentiviral vectors can be used to replicate the NOI in compatible target cells in vitro. Thus, described herein are methods for producing proteins in vitro by introducing the vectors of the invention into compatible target cells in vitro and growing the target cells under conditions that cause expression of the NOI. The protein and NOI can be recovered from the target cells by methods known in the art. Suitable target cells include mammalian cell lines and other eukaryotic cell lines.

[0446] In some aspects, the vector can have "insulators," ie, gene sequences that block the interaction between promoters and enhancers and act as a barrier to reduce read-through from neighboring genes.

[0447] In one embodiment, an insulator is present between one or more lentiviral nucleic acid sequences to prevent promoter interference and read-through from adjacent genes. If an insulator is present in a vector between one or more lentiviral nucleic acid sequences, each of these insulated genes can be arranged as a separate expression unit.

[0448] The basic structure of retroviral and lentiviral genomes has many common features, such as 5'LTR and 3'LTR, with packaging signals between or within them that enable the genome to be packaged, primer binding sites, integration sites that enable integration into the target cell genome, and gag / pol and env genes encoding packaging components, which are polypeptides required for viral particle assembly. Lentiviruses have other features, such as the rev gene and RRE sequence in HIV, which enable efficient export of the RNA transcripts of the integrated provirus from the nucleus to the cytoplasm of the infected target cell.

[0449] In the provirus, these genes are flanked at both ends by regions called long terminal repeats (LTRs). The LTRs are responsible for proviral integration and transcription. The LTRs also act as enhancer-promoter sequences and are able to control the expression of viral genes.

[0450] The LTR itself is an identical sequence that can be divided into three elements, called U3, R, and U5. U3 is derived from a sequence unique to the 3' end of the RNA. R is derived from a sequence repeated at both ends of the RNA, and U5 is derived from a sequence unique to the 5' end of the RNA. The sizes of the three elements can vary significantly in different retroviruses.

[0451] In a typical retroviral vector as described herein, at least a portion of one or more proteins encoding regions necessary for replication may be removed from the virus; for example, the gag / pol and env genes may be absent or may be functionally disabled. This renders the viral vector a replication-defective virus.

[0452] Lentiviral vectors can be derived from primate lentiviruses (eg, HIV-1) or non-primate lentiviruses (eg, EIAV).

[0453] In general, a typical retroviral vector production system involves separating the viral genome from the necessary viral packaging functions. These elements are usually provided to production cells in the form of a separate DNA expression cassette (alternatively referred to as a plasmid, expression plasmid, DNA construct or expression construct).

[0454] The vector genome comprises NOI. The vector genome generally requires a packaging signal (ψ), an internal expression cassette containing NOI, (optional) a post-transcription element (PRE), a conventional central polypurine tract (cppt), 3'-ppu and self-inactivation (SIN) LTR. The R-U5 region is necessary for correct polyadenylation and reverse transcription processing of the vector genome RNA and NOI mRNA. The vector genome optionally comprises an open reading frame, as described in WO2003 / 064665, which allows the production of vectors without rev.

[0455] The packaging functional bodies include gag / pol and env genes. These genes are necessary for the production of vector particles by production cells. Providing these functional bodies to the genome in trans is conducive to the production of replication-defective viral vectors.

[0456] The production system of gamma retroviral vectors is generally a 3-component system requiring a genome, gag / pol and env expression constructs. The production system of HIV-1 based lentiviral vectors may also require the provision of the auxiliary gene rev, and for the vector genome, the rev-response element (RRE) is included. If an open reading frame (ORF) is present in the genome, it is not necessary to provide rev in trans to EIAV based lentiviral vectors (see WO 2003 / 064665).

[0457] Generally speaking, the "external" promoter (which drives the vector genome cassette) and the "internal" promoter (which drives the NOI cassette) encoded within the vector genome cassette are strong eukaryotic or viral promoters, like those that drive other vector system elements. Examples of such promoters include CMV, EF1α, PGK, CAG, TK, SV40, and ubiquitin promoters. Strong "synthetic" promoters, such as those generated from DNA libraries (e.g., JeT promoter), can also be used to drive transcription. Alternatively, tissue-specific promoters such as rhodopsin (Rho), rhodopsin kinase (RhoK), cone-rod homeobox containing gene (CRX), neural retina-specific leucine zipper protein (NRL), vitelliform macular dystrophy 2 (VMD2), tyrosine hydroxylase, neuron-specific enolase (NSE) promoter, astrocyte-specific glial fibrillary acidic protein (GFAP) promoter, human alpha 1 antitrypsin (hAAT) promoter, phosphoenolpyruvate carboxykinase (PEPCK) promoter can be used to drive transcription. ), liver fatty acid binding protein promoter, Flt-1 promoter, INF-β promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV40 / hAlb promoter, SV40 / CD43, SV40 / CD45, NSE / RU5' promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, fibronectin promoter, endoglin promoter, elastase-1 promoter, desmin promoter, CD68 promoter, CD14 promoter and B29 promoter.

[0458] The production of retroviral vectors involves transient co-transfection of production cells with these DNA components, or the use of stable production cell lines in which all of these components are stably integrated into the production cell genome (e.g., Stewart HJ, Fong-Wong L, Strickland I, Chipchase D, Kelleher M, Stevenson L, Thoree V, McCarthy J, Ralph GS, Mitrophanous KA and Radcliffe PA. (2011). Hum Gene Ther. Mar; 22(3): 357-69). An alternative approach is to use stable packaging cells (in which the packaging components have been stably integrated) and then transiently transfect the vector genome plasmid as needed (e.g., Stewart, HJ, MA Losx-Carlucci, CJ Sion, KA Mitrophanous and PA Radcliffe (2009). Gene Ther. Jun; 16(6): 805-14). It is also feasible to generate alternative, incomplete packaging cell lines (only one or two packaging components are stably integrated into the cell line) and transiently transfect the resulting vectors lacking the components. The production cells may also express regulatory proteins, such as members of the tet repressor (TetR) protein group of transcriptional regulators (e.g., T-Rex, Tet-On and Tet-Off), members of the 4-isopropylbenzoic acid (cumate) inducible switch system group of transcriptional regulators (e.g., 4-isopropylbenzoic acid repressor (CymR) proteins), or RNA binding proteins (e.g., TRAP-tryptophan activated RNA binding protein).

[0459] In one embodiment of the present invention, the viral vector is derived from EIAV. EIAV has the simplest genome structure of a slow virus and is therefore particularly preferred for use in the present invention. In addition to the gag / pol and env genes, EIAV also encodes three other genes: tat, rev and S2. Tat acts as a transcriptional activator of viral LTR (Derse and Newbold (1993) Virology 194 (2): 530-536 and Maury et al (1994) Virology 200 (2): 632-642), and rev regulates and coordinates the expression of viral genes through the rev-response element (RRE) (Martarano et al. (1994) J Virol 68 (5): 3102-3111). It is believed that the mechanism of action of these two proteins is generally similar to that of similar mechanisms in primate viruses (Martarano et al. (1994) J Virol 68 (5): 3102-3111). The function of S2 is unknown. In addition, an EIAV protein called Ttm has been identified which is encoded by the first exon of tat spliced ​​to the env coding sequence at the start of the transmembrane protein. In an alternative embodiment of the invention, the viral vector is derived from HIV: HIV differs from EIAV in that it does not encode S2, but unlike EIAV, it encodes vif, vpr, vpu and nef.

[0460] The term "recombinant retroviral or lentiviral vector" (RRV) refers to a vector that has sufficient retroviral genetic information to allow the RNA genome to be packaged into viral particles capable of transducing target cells in the presence of packaging components. Transduction of target cells may include reverse transcription, and integration into the target cell genome. RRV carries non-viral coding sequences to be delivered to target cells by the vector. RRV is not capable of independent replication to produce infectious retroviral particles in target cells. Typically, RRV lacks functional gag / pol genes and / or env genes and / or other genes necessary for replication.

[0461] Preferably, the RRV vector of the present invention has a minimal viral genome.

[0462] The term "minimal viral genome" as used herein means that the viral vector has been manipulated to remove non-essential elements while retaining essential elements to provide the functionality required for infection, transduction and delivery of the NOI to target cells. More details of this strategy can be found in WO 1998 / 17815 and WO 99 / 32646. Minimal EIAV vectors lack tat, S2 genes, and optionally rev, and none of these genes are present in trans in the production system. Minimal HIV vectors lack vif, vpr, vpu, tat and nef.

[0463] The expression plasmid for producing the vector genome in the production cell may include a transcriptional regulatory sequence that can be connected to the retroviral genome, thereby directly transcribing the genome in the production cell / packaging cell. All third-generation slow virus vectors are deleted in the 5'U3 enhancer-promoter region, and the transcription of the vector genome RNA is driven by a heterologous promoter such as another viral promoter, such as the CMV promoter, as described below. This feature enables vector production to be independent of tat. Some slow virus vector genomes require additional sequences in order to effectively produce viruses. For example, in the case of HIV, the RRE sequence may be included. However, the codon optimization of the GagPol ORF can be used to reduce or eliminate the demand for RRE (and the dependence on rev provided in trans) of the (independent) GagPol box. Further details of this strategy can be found in WO 2001 / 79518.

[0464] Alternative sequences that perform the same function as the rev / RRE system are also known. For example, a functional analog of the rev / RRE system has been found in the Mason Pfizer monkey virus. This is called a constitutive transport element (CTE), and includes an RRE-type sequence believed to interact with factors in infected cells within the genome. Cytokines can be considered as rev analogs. Therefore, CTE can be used as a substitute for the rev / RRE system. Any known or available other functional equivalents of Rev protein can be relevant to the present invention. For example, it is also known that the Rex protein of HTLV-I can functionally replace the Rev protein of HIV-1. In the vector used in the inventive method, Rev and RRE may not exist or be non-functional; in an alternative scheme, rev and RRE or a functional equivalent system may be present.

[0465] As used herein, the term "functional substitute" refers to a protein or sequence having an alternative sequence that performs the same function as another protein or sequence. The term "functional substitute" is used interchangeably herein with "functional equivalents" and "functional analogs" having the same meaning.

[0466] SIN carrier

[0467] As used herein, lentiviral vectors can be used in self-inactivation (SIN) structures, in which viral enhancer and promoter sequences have been deleted. SIN vectors can be produced and transduced into non-dividing target cells in vivo, in vitro or in vitro with efficiencies similar to non-SIN vectors. Transcriptional inactivation of the long terminal repeats (LTRs) of the SIN provirus will inhibit the metabolism of vRNA and is a feature that further reduces the possibility of forming a virus with replication ability. This can also regulate gene expression initiated by an internal promoter by removing any cis-acting effects of the LTR.

[0468] For example, self-inactivating retroviral vector systems have been constructed to delete enhancers or promoters within the U3 region of the transcription enhancer or 3'LTR. After a round of vector reverse transcription and integration, these changes will be copied into the 5'LTR and 3'LTR of the "original virus" that produces no transcription activity. However, any internal promoter of the LTR in this vector will still maintain transcription activity. This strategy has been used to remove the effects of enhancers and promoters within the viral LTR on the transcription of genes placed internally. These effects include increased transcription or inhibition of transcription. This strategy can also be used to remove transcription from the downstream of the 3'LTR into genomic DNA. This is of particular concern in human gene therapy, where it is important to prevent exogenous activation of any endogenous oncogenes. Yu et al., (1986) PNAS 83:3194-98; Marty et al., (1990) Biochimie 72:885-7; Naviaux et al., (1996) J. Virol. 70:5701-5; Iwakuma et al., (1999) Virol. 261:120-32; Deglon et al., (2000) Human Gene Therapy 11:179-90. SIN lentiviral vectors are described in US 6,924,123 and US 7,056,699.

[0469] Replication-defective lentiviral vector

[0470] In the genome of the replication-defective lentiviral vector, the gag / pol and / or env sequences may be mutated and / or non-functional.

[0471] In a typical lentiviral vector as described herein, at least a portion of one or more coding regions for proteins essential for viral replication may be removed from the vector. This renders the viral vector replication-defective. Portions of the viral genome may also be replaced by a NOI to generate a vector comprising a NOI that is capable of transducing non-dividing target cells and / or integrating its genome into the target cell genome.

[0472] In one embodiment, the lentiviral vector is a non-integrating vector as described in WO 2006 / 010834 and WO 2007 / 071994.

[0473] In another embodiment, the vector has the ability to deliver no or lacking viral RNA sequences. In another embodiment, a heterologous binding domain (heterologous to gag) located on the RNA to be delivered and a homologous binding domain located on Gag or GagPol can be used to ensure packaging of the RNA to be delivered. These vectors are described in WO 2007 / 072056.

[0474] NOI and polynucleotides

[0475] The polynucleotides of the present invention may comprise DNA or RNA. They may be single-stranded or double-stranded. The skilled person will appreciate that, due to the degeneracy of the genetic code, many different polynucleotides may encode the same polypeptide. In addition, it will be appreciated that the skilled person may use conventional techniques to perform nucleotide substitutions to reflect the codon usage of any specific host organism in which the polypeptide of the present invention is expressed, without affecting the polypeptide sequence encoded by the polynucleotide of the present invention.

[0476] The polynucleotides may be modified by any method available in the art. Such modifications may be performed to increase the in vivo activity or lifespan of the polynucleotides of the invention.

[0477] Polynucleotides such as DNA polynucleotides can be produced by recombinant methods, synthetic methods or any method available to those skilled in the art. They can also be cloned by standard techniques.

[0478] Longer polynucleotides are usually produced using recombinant methods, such as polymerase chain reaction (PCR) cloning techniques. This involves preparing a pair of primers (e.g., about 15 to 30 nucleotides) that flank the target sequence to be cloned, contacting the primers with mRNA or cDNA obtained from animal cells or human cells, performing PCR under conditions that result in amplification of the desired region, isolating the amplified fragments (e.g., by purifying the reaction mixture on an agarose gel), and recovering the amplified DNA. The primers can be designed to contain appropriate restriction enzyme recognition sites so that the amplified DNA can be cloned into an appropriate vector.

[0479] Common retroviral vector elements

[0480] Promoters and enhancers

[0481] The expression of the NOI and polynucleotides can be controlled using control sequences, such as transcriptional regulatory elements or translational repressor elements, including promoters, enhancers and other expression regulation signals (e.g., the tet repressor (TetR) system) or the transgene repression system (TRIP) in vector production cells or other regulators of the NOI described herein.

[0482] Prokaryotic promoters and promoters that function in eukaryotic cells can be used. Tissue-specific promoters or stimulus-specific promoters can be used. Chimeric promoters containing sequence elements from two or more different promoters can also be used.

[0483] Suitable promoting sequences are strong promoters, including those derived from the genomes of viruses such as polyoma virus, adenovirus, fowlpox virus, bovine papilloma virus, avian sarcoma virus, cytomegalovirus (CMV), retroviruses, and simian virus 40 (SV40), or from heterologous mammalian promoters such as the actin promoter, EF1α, CAG, TK, SV40, ubiquitin, PGK, or ribosomal protein promoters. Alternatively, the following tissue-specific promoters can be used to drive transcription, such as rhodopsin (Rho), rhodopsin kinase (RhoK), cone-rod homeobox containing gene (CRX), neural retina-specific leucine zipper protein (NRL), vitelliform macular dystrophy 2 (VMD2), tyrosine hydroxylase, neuron-specific enolase (NSE) promoter, astrocyte-specific glial fibrillary acidic protein (GFAP) promoter, human alpha 1 antitrypsin (hAAT) promoter, phosphoenolpyruvate carboxykinase (PEPCK) promoter. , liver fatty acid binding protein promoter, Flt-1 promoter, INF-β promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV40 / hAlb promoter, SV40 / CD43, SV40 / CD45, NSE / RU5' promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, fibronectin promoter, endoglin promoter, elastase-1 promoter, desmin promoter, CD68 promoter, CD14 promoter and B29 promoter.

[0484] Transcription of the NOI can be further increased by inserting an enhancer sequence into the vector. Enhancers are relatively independent of orientation and position; however, enhancers from eukaryotic cell viruses, such as the SV40 enhancer and the CMV early promoter enhancer, can be used. The enhancer can be spliced ​​into the vector at a position 5' or 3' relative to the promoter, but is preferably located at a 5' site relative to the promoter.

[0485] The promoter may additionally include features to ensure or improve expression in suitable target cells. For example, the feature may be a conserved region, such as a Pribnow box or a TATA box. The promoter may contain other sequences to affect (such as maintain, improve or reduce) the expression level of the nucleotide sequence. Suitable other sequences include Sh1 introns or ADH introns. Other sequences include inducible elements, such as temperature, chemical, light and stress inducible elements. Suitable elements to improve transcription or translation may also be present.

[0486] NOI regulator

[0487] The complicating factor in producing retroviral packaging / producer cell lines and retroviral vector production is that the constitutive expression of some retroviral vector components and NOIs is cytotoxic, thereby causing the death of cells expressing these components, and thus the vector cannot be produced. Therefore, the expression of these components (e.g., gag-pol and envelope proteins, such as VSV-G) must be regulated. The expression of other non-cytotoxic vector components (e.g., rev) can also be regulated to minimize the metabolic burden of the cell. Therefore, the modular constructs or nucleotide sequences encoding vector components and / or cells as described herein can include cytotoxic vector components and / or non-cytotoxic vector components combined with at least one regulatory element. As used herein, the term "regulatory element" refers to any element that can affect (increase or decrease) the expression of a related gene or protein. Regulatory elements include gene switch systems, transcriptional regulatory elements, and translational repressor elements.

[0488] Many prokaryotic regulatory systems have been used to produce gene switches in mammalian cells. Many retroviral packaging and producer cell lines have been controlled using gene switch systems (e.g., tetracycline and 4-isopropylbenzoic acid inducible switch systems), so that the expression of one or more retroviral vector components can be turned on during vector production. Gene switch systems include those of the transcriptional regulator (TetR) protein group (e.g., T-Rex, Tet-On and Tet-Off) and those of the 4-isopropylbenzoic acid inducible switch system group of transcriptional regulators (e.g., CymR protein) and those related to RNA binding proteins (e.g., TRAP).

[0489] One such tetracycline-inducible system is based on T-REx TMTetracycline repressor (TetR) system of the system. For example, in such a system, the tetracycline operator (TetO2) is placed in such a position that the first nucleotide is 10 bp 3' from the last nucleotide of the TATATAA element of the major immediate early promoter of human cytomegalovirus (hCMVp), so that TetR can act as a repressor alone (Yao F, Svensjo T, Winkler T, Lu M, Eriksson C, Eriksson E., 1998, Hum Gene Ther; 9: 1939-1950). In such a system, the expression of NOI can be controlled by the CMV promoter, and the CMV promoter has two copies of the TetO2 sequence inserted in series. In the absence of an inducer (tetracycline or its analog doxycycline [dox]), the TetR homodimer binds to the TetO2 sequence and physically blocks transcription from the upstream CMV promoter. When an inducer is present, it binds to the TetR homodimer, causing an allosteric change so that it no longer binds to the TetO2 sequence, thereby causing gene expression. The TetR gene can be codon optimized, as this has been found to improve translation efficiency, allowing for tighter control of TetO2-controlled gene expression.

[0490] The TRIP system is described in WO 2015 / 092440, and provides another method for suppressing NOI expression in production cells during vector production. When constitutive and / or strong promoters (including tissue-specific promoters) are required to drive transgenes, and in particular when expression of transgenic proteins in production cells leads to reduced vector titers and / or when viral vector delivery of transgenic-derived proteins stimulates immune responses in vivo, TRAP binding sequences (e.g., TRAP-tbs) interact to form the basis of transgenic protein suppression systems for producing retroviral vectors (Maunder et al, Nat Commun. (2017) Mar 27; 8).

[0491] In short, the TRAP-tbs interaction forms a translation block, thereby repressing the translation of the transgenic protein (Maunder et al, Nat Commun. (2017) Mar 27; 8). Translation blockade is only effective in production cells and therefore does not hinder DNA or RNA-based vector systems. The TRiP system is able to repress translation when the transgenic protein is expressed from a constitutive and / or strong promoter, including a tissue-specific promoter from a monocistronic or polycistronic mRNA. It has been shown that unregulated expression of transgenic proteins can reduce vector titers and affect vector product quality. For transient and stable PaCL / PCL vector production systems, repression of transgenic proteins is beneficial for production cells to prevent reduction in vector titers in the following situations: when toxicity or molecular load issues may cause cell stress; when transgenic proteins stimulate immune responses in vivo due to viral vector delivery of transgenic-derived proteins; when the use of gene-editing transgenes may affect target on / off; when transgenic proteins may affect vector and / or envelope glycoprotein rejection.

[0492] Encapsulation and pseudotyping

[0493] In a preferred aspect, the lentiviral vectors as described herein have been pseudotyped. In this regard, pseudotyping can confer one or more advantages. For example, the env gene product of HIV-based vectors will limit these vectors to cells that only infect the protein called CD4. But if the env gene in these vectors is replaced by env sequences from other enveloped viruses, they may have a wider spectrum of infection (Verma and Somia (1997) Nature 389 (6648): 239-242). For example, workers have pseudotyped HIV-based vectors with glycoproteins from VSV (Verma and Somia (1997) Nature 389 (6648): 239-242).

[0494] In another alternative, the Env protein can be a modified Env protein, such as a mutant or engineered Env protein. The modification can be made or selected to introduce targeting ability or reduce toxicity or for other purposes (Valsesia-Wittman et al 1996 J Virol 70: 2056-64; Nilson et al (1996) Gene Ther 3 (4): 280-286; and Fielding et al (1998) Blood 91 (5): 1802-1809; and references cited therein).

[0495] The vector can be pseudotyped with any molecule of choice.

[0496] As used herein, "env" shall refer to the endogenous lentiviral envelope or a heterologous envelope as described herein.

[0497] VSV-G

[0498] The envelope glycoprotein (G) of vesicular stomatitis virus (VSV, a rhabdovirus) is an envelope protein that has been shown to be able to pseudotype certain enveloped viruses and viral vector viral particles.

[0499] Emi et al. (1991) Journal of Virology 65: 1202-1207 first demonstrated the ability to pseudotype MoMLV-based retroviral vectors in the absence of any retroviral envelope protein. WO1994 / 294440 taught that retroviral vectors can be successfully pseudotyped with VSV-G. These pseudotyped VSV-G vectors can be used to transduce a wide range of mammalian cells. More recently, Abe et al. (1998) J Virol 72 (8) 6356-6361 taught that non-infectious retroviral particles can be rendered infectious by the addition of VSV-G.

[0500] Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90: 8033-7 successfully used VSV-G to pseudotype the retrovirus MLV, which produced a vector with an altered host range compared to the native form of MLV. VSV-G pseudotyped vectors have been shown to infect not only mammalian cells, but also cell lines derived from fish, reptiles, and insects (Burns et al. (1993), supra). They have also been shown to be more effective than traditional amphotropic envelopes for a variety of cell lines (Yee et al., (1994) Proc. Natl. Acad. Sci. USA 91: 9564-9568; Emi et al. (1991) Journal of Virology 65: 1202-1207). The VSV-G protein can be used to pseudotype certain retroviruses because its cytoplasmic tail can interact with the retroviral core.

[0501] Providing a non-retroviral pseudotyped envelope (such as the VSV-G protein) can provide the advantage that vector particles can be concentrated to high titers without loss of infectivity (Akkina et al. (1996) J. Virol. 70: 2581-5). Retroviral envelope proteins are apparently unable to withstand the shear forces during ultracentrifugation, most likely because they consist of two non-covalently linked subunits. Centrifugation can disrupt the interactions between the subunits. In contrast, the VSV glycoprotein consists of a single unit. Therefore, VSV-G protein pseudotyping can provide potential advantages for efficient target cell infection / transduction and manufacturing processes.

[0502] WO 2000 / 52188 describes the production of pseudotyped retroviral vectors by a stable producer cell line having the vesicular stomatitis virus G protein (VSV-G) as a membrane-bound viral envelope protein and provides the gene sequence of the VSV-G protein.

[0503] Ross River Virus

[0504] Non-primate lentiviral vectors (FIV) were pseudotyped with the Ross River virus envelope and then systemically administered for primary liver transduction (Kang et al., 2002, J. Virol., 76:9378-9388). Efficiency was reported to be 20-fold higher than that obtained with VSV-G pseudotyped vectors and to produce less toxicity as measured by serum levels of liver enzymes indicative of hepatotoxicity.

[0505] Baculovirus GP64

[0506] The baculovirus GP64 protein has been demonstrated to be an alternative to VSV-G for viral vectors used in large-scale production of high-titer viruses required for clinical and commercial applications (Kumar M, Bradow BP, Zimmerberg J (2003) Hum Gene Ther. 14 (1): 67-77). GP64 pseudotyped vectors have similar broad tropism and similar natural titers compared to VSV-G pseudotyped vectors. Since the expression of GP64 does not kill cells, HEK293T-based cell lines that constitutively express GP64 can be prepared.

[0507] Optional film

[0508] Other envelopes that provided suitable titers when used to pseudotype EIAV included Mokola virus, Rabies virus, Ebola virus, and LCMV (lymphocytic choriomeningitis virus). Intravenous infusion of lentivirus pseudotyped with 4070A into mice resulted in maximal gene expression in the liver.

[0509] Packing sequence

[0510] The term "packaging signal" as used in the context of the present invention is used interchangeably with "packaging sequence" or "psi" and is used to refer to a non-coding, cis-acting sequence required for encapsidation of the retroviral RNA strand during viral particle formation. In HIV-1, this sequence has been mapped to a locus extending upstream from the major splice donor site (SD) to at least the gag start codon (which may include part or all of the 5' sequence from gag to nucleotide 688). In EIAV, the packaging signal includes the R region to the 5' coding region of Gag.

[0511] As used herein, the term "extended packaging signal" or "extended packaging sequence" refers to the use of sequences surrounding the psi sequence that extend further into the gag gene. The inclusion of these additional packaging sequences can increase the efficiency of vector RNA insertion into viral particles.

[0512] It has been demonstrated that the encapsidation determinants of feline immunodeficiency virus (FIV) RNA are discrete and non-continuous, including a region located at the 5' end of the genomic mRNA (R-U5) and another region located within approximately 311 nt of gag (Kaye et al., J Virol. Oct; 69(10): 6588-92 (1995)).

[0513] Internal ribosome entry site (IRES)

[0514] Insertion of RES elements allows expression of multiple coding regions to be initiated from a single promoter (Adam et al (supra); Koo et al (1992) Virology 186: 669-675; Chen et al 1993 J. Virol 67: 2142-2148). IRES elements were first discovered at the non-translated 5' end of picornaviruses, where they promote cap-independent translation of viral proteins (Jang et al (1990) Enzyme 44: 292-309). When located between open reading frames in RNA, IRES elements promote ribosome entry at the IRES element and subsequently initiate downstream translation, thereby allowing efficient translation of downstream open reading frames.

[0515] Mountford and Smith presented a review on IRES (TIG May 1995 vol11, No 5:179-184). Many different IRES sequences are known, including those from encephalomyocarditis virus (EMCV) (Ghattas, IR, et al., Mol. Cell. Biol., 11:5848-5859 (1991)); the BiP protein [Macejak and Sarnow, Nature 353:91 (1991)]; the Drosophila antennapedia gene (exons d and e) [Oh, et al., Genes & Development, 6:1643-1653 (1992)], and in poliovirus (PV) [Pelletier and Sonenberg, Nature 334:320-325 (1988); see also Mountford and Smith, TIG 11, 179-184 (1985)].

[0516] IRES elements from PV, EMCV, and swine vesicular disease virus have been used previously in retroviral vectors (Coffin et al., supra).

[0517] The term "IRES" includes any sequence or combination of sequences that function as an IRES or improve IRES function. IRES can be of viral origin (such as EMCV IRES, PV IRES or FMDV 2A-like sequence) or cellular origin (such as FGF2 IRES, NRF IRES, Notch 2IRES or EIF4 IRES).

[0518] In order for the IRES to be able to initiate translation of each polynucleotide, it should be located between or before the polynucleotides in the modular construct.

[0519] Nucleotide sequences used to develop stable cell lines require the addition of selectable markers to select for cells that have stably integrated. These selectable markers can be expressed as a single transcription unit in the nucleotide sequence, or it may be more preferred to use an IRES element to initiate translation of the selectable marker in a polycistronic message (Adam et al 1991 J. Virol. 65, 4985).

[0520] Gene orientation and insulators

[0521] It is well known that nucleic acids have a directionality, which ultimately affects mechanisms in the cell such as transcription and replication. Therefore, genes can have relative orientations with respect to each other when part of the same nucleic acid construct.

[0522] In certain embodiments of the present invention, at least two nucleic acid sequences present in the same locus in a cell or construct can be in reverse and / or interactive directions. In other words, in certain embodiments of the present invention, on this specific locus, continuous gene pairs will not have the same direction. When the region is expressed in the same physical location of a host cell, this can help prevent transcription and translation read-through.

[0523] When the nucleic acid required for vector production is based on the same genetic locus in the cell, the crossover orientation favors the production of retroviral vectors. This in turn can also improve the safety of the resulting constructs to prevent the generation of replication-competent retroviral vectors.

[0524] The use of insulators can prevent inappropriate expression or silencing of the NOI in its genetic environment when the nucleic acid sequences are in opposite and / or alternating orientations.

[0525] The term "insulator" refers to a class of DNA sequence elements that have the ability to protect genes from surrounding regulator signals when bound to insulator binding proteins. There are two types of insulators: enhancer blocking function and chromatin barrier function. When the insulator is located between the promoter and the enhancer, the enhancer blocking function of the insulator protects the promoter from the enhanced transcription of the enhancer (Geyer and Corces 1992; Kellum and Schedl 1992). Chromatin barrier insulators work by preventing the advancement of nearby condensed chromatin, which can cause transcriptionally active chromatin regions to become transcriptionally ineffective chromatin regions and lead to gene expression silencing. Insulators that inhibit heterochromatin diffusion and thus inhibit gene silencing will recruit enzymes involved in histone modification to prevent this process (Yang J, Corces VG.2011; 110: 43-76; Huang, Li et al.2007; Dhillon, Raab et al.2009). Insulators can have one or both of these two functions, and chicken β-globin insulator (cHS4) is such an example. This insulator is the most widely studied vertebrate insulator, rich in G+C, and has enhancer blocking and heterochromatin barrier functions (Chung JH, Whitely M, Felsenfeld G. Cell. 1993; 74: 505–514). Other such insulators with enhancer blocking functions are not limited to but include the following: human β-globin insulator 5 (HS5), human β-globin insulator 1 (HS1), and chicken β-globin insulator (cHS3) (Farrell CM1, West AG, Felsenfeld G., Mol Cell Biol. 2002 Jun; 22 (11): 3820-31; J Ellis et al. EMBO J. 1996 Feb 1; 15 (3): 562–568). In addition to reducing unwanted distal interactions, insulators also help prevent promoter interference between adjacent retroviral nucleic acid sequences (i.e., promoters from one transcription unit impair expression of adjacent transcription units). If an insulator is used between each retroviral vector nucleic acid sequence, the reduction in direct read-through will help prevent the formation of replication-competent retroviral vector particles.

[0526] Insulators may be present between each retroviral nucleic acid sequence. In one embodiment, the use of insulators prevents promoter-enhancer interactions from one NOI expression cassette from interacting with another NOI expression cassette in the nucleotide sequence encoding the vector components.

[0527] An insulator may be present between the vector genome and the gag-pol sequence. Thus, this limits the possibility of producing replication-competent retroviral vectors and "wild-type"-like DNA transcripts, thereby improving the safety properties of the construct. Moriarity et al, Nucleic Acids Res. 2013Apr; 41(8): e92 cited a method for improving the expression of stably integrated multigene vectors using insulator elements.

[0528] Vector titer

[0529] The skilled person will appreciate that there are many different methods for determining viral vector titer. Titer is usually described as transduction units / mL (TU / mL). Titer can be increased by increasing the number of vector particles and by increasing the specific activity of the vector preparation.

[0530] Therapeutic Uses

[0531] The lentiviral vectors as described herein or cells or tissues transduced with the lentiviral vectors as described herein can be used in medicine.

[0532] In addition, the lentiviral vectors described herein, the production cells of the present invention, or cells or tissues transduced with the lentiviral vectors described herein can be used to prepare a medicament to deliver a target nucleotide to a target site in need thereof. As previously described, such uses of the lentiviral vectors or transduced cells of the present invention can be used for therapeutic or diagnostic purposes.

[0533] Thus, provided are cells transduced by a lentiviral vector as described herein.

[0534] "Cell transduced by viral vector particles" is understood to be a cell, in particular a target cell, into which the nucleic acid carried by the viral vector particles has been transferred.

[0535] In preferred embodiments, the nucleotide of interest produces a therapeutic effect.

[0536] "Target cells" are understood to be cells that are expected to express the NOI. The NOI is introduced into the target cells using the viral vectors of the invention. Delivery to the target cells can be performed in vivo, ex vivo or in vitro.

[0537] NOI can have therapeutic or diagnostic applications. Suitable NOIs include, but are not limited to, sequences encoding the following substances: enzymes, cofactors, cytokines, chemokines, hormones, antibodies, antioxidant molecules, engineered immunoglobulin-like molecules, single-chain antibodies, fusion proteins, immune co-stimulatory molecules, immunomodulatory molecules, chimeric antigen receptors, cross-domain negative mutants of target proteins, toxins, conditional toxins, antigens, transcription factors, structural proteins, reporter proteins, subcellular localization signals, tumor suppressor proteins, growth factors, membrane proteins, receptors, vasoactive proteins and peptides, antiviral proteins and ribozymes, and their derivatives (such as derivatives with related reporter groups). NOI can also encode microRNAs. Without being bound by theory, it is believed that the processing of microRNAs is inhibited by TRAP.

[0538] In one embodiment, the NOI can be used to treat neurodegenerative diseases.

[0539] In another embodiment, the NOI is used to treat Parkinson's disease.

[0540] In another embodiment, the NOI may encode one or more enzymes involved in dopamine synthesis. For example, the enzyme may be one or more of the following: tyrosine hydroxylase, GTP cyclohydrolase I and / or aromatic amino acid dopa decarboxylase. The sequences of all three genes are available ( The accession numbers are X05290, U19523 and M76180 respectively).

[0541] In another embodiment, the NOI may encode vesicular monoamine transporter 2 (VMAT2). In an alternative embodiment, the viral genome may comprise a NOI encoding aromatic amino acid dopa decarboxylase and a NOI encoding VMAT2. Such a genome may be used to treat Parkinson's disease, particularly in combination with peripheral administration of L-DOPA.

[0542] In another embodiment, the NOI may encode a therapeutic protein or a combination of therapeutic proteins.

[0543] In another embodiment, the NOI may encode one or more proteins selected from the group consisting of glial cell-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF), neurotrophin-3 (NT-3), acidic fibroblast growth factor (aFGF), basic fibroblast growth factor (bFGF), interleukin-1β (IL-1β), tumor necrosis factor α (TNFα), insulin growth factor-2, VEGF-A, VEGF-B, VEGF-C / VEGF-2, VEGF-D, VEGF-E, PDGF-A, PDGF-B, PDFG-A and PDFG-B heterodimers and homodimers.

[0544] In another embodiment, the NOI may encode one or more anti-angiogenic proteins selected from the group consisting of angiostatin, endostatin, platelet factor 4, pigment epithelium-derived factor (PEDF), placental growth factor, restin, interferon-α, interferon-induced protein, gro-β and tubedown-1, interleukin-1 (IL-1), IL-12, retinoic acid, anti-VEGF antibodies or fragments / variants thereof, such as aflibercept, thrombospondin, VEGF receptor proteins (such as those described in US 5,952,199 and US 6,100,071), and anti-VEGF receptor antibodies.

[0545] In another embodiment, the NOI may encode an anti-inflammatory protein, antibody, or fragment / variant of a protein or antibody selected from the group consisting of: NF-kB inhibitor, IL1β inhibitor, TGFβ inhibitor, IL-6 inhibitor, IL-23 inhibitor, IL-18 inhibitor, tumor necrosis factor α and tumor necrosis factor β, lymphotoxin α and lymphotoxin β, LIGHT inhibitor, alpha synuclein inhibitor, Tau inhibitor, beta amyloid inhibitor, IL-17 inhibitor.

[0546] In another embodiment, the NOI may encode the cystic fibrosis transmembrane conductance regulator (CFTR).

[0547] In another embodiment, the NOI may encode a protein normally expressed in visual cells.

[0548] In another embodiment, the NOI may encode a protein normally expressed in photoreceptor cells and / or retinal pigment epithelial cells.

[0549] In another embodiment, the NOI may encode a protein selected from the group consisting of RPE65, aryl hydrocarbon interacting receptor protein-like 1 (AIPL1), CRB1, phosphatidylcholine retinal acetyltransferase (LRAT), photoreceptor-specific homeobox (CRX), retinal guanylate cyclase (GUCY2D), RPGR interacting protein 1 (RPGRIP1), LCA2, LCA3, LCA5, anti-trophin, PRPH2, CNTF, ABCR / ABCA4, EMP1, TIMP3, MERTK, ELOVL4, MYO7A, USH2A, VMD2, RLBP1, COX-2, FPR, harmonin, Rab guard protein 1, CNGB2, CNGA3, CEP 290, RPGR, RS1, RP1, PRELP, glutathione pathway enzymes, and opticin.

[0550] In other embodiments, the NOI may encode human coagulation Factor VIII or Factor IX.

[0551] In other embodiments, the NOI may encode one or more proteins involved in metabolism selected from the group consisting of phenylalanine hydroxylase (PAH), methylmalonyl-CoA mutase, propionyl-CoA carboxylase, isovaleryl-CoA dehydrogenase, branched-chain ketoacid dehydrogenase complex, glutaryl-CoA dehydrogenase, acetyl-CoA carboxylase, propionyl-CoA carboxylase, 3-methylcrotonyl-CoA carboxylase, pyruvate carboxylase, carbamoyl phosphate synthetase, ornithine transcarbamylase, glucose transporter, sucrose ... β-galactosidase, α-galactosidase A, glucosylceramidase β, cystine, glucosamine (N-acetyl)-6-sulfatase, N-acetyl-α-glucosaminidase, N-sulfoglucosamine sulfohydrolase, galactosamine-6-sulfatase, arylsulfatase A, cytochrome B-245β, ABCD1, ornithine carbamoyltransferase, argininosuccinate synthase, argininosuccinate lyase, arginase 1, alanine glycoxhylate aminotransferase, ATP binding cassette and subfamily B members.

[0552] In other embodiments, NOI can encode a chimeric antigen receptor (CAR) or a T cell receptor (TCR). In one embodiment, CAR is an anti-5T4 CAR. In other embodiments, NOI can encode B cell maturation antigen (BCMA), CD19, CD22, CD20, CD47, CD138, CD30, CD33, CD123, CD70, prostate-specific membrane antigen (PSMA), LewisY antigen (LeY), tyrosine protein kinase transmembrane receptor (ROR1), mucin 1, cell surface-associated protein (Muc1), epithelial cell adhesion molecule (EpCAM), endothelial growth factor receptor (EGFR), insulin, protein tyrosine phosphatase, non-receptor type 22, interleukin 2 receptor alpha, helicase C domain 1 induced interferon, human epidermal growth factor receptor (HER2), phosphatidylinositol proteoglycan 3 (GPC3), disialoganglioside (GD2), mesothelin (mesiothelin), vesicular endothelial growth factor receptor 2 (VEGFR2).

[0553] In one embodiment, the NOI encodes BCMA.

[0554] In one embodiment, the NOI encodes CD19.

[0555] In one embodiment, the NOI encodes CD22.

[0556] In one embodiment, the NOI encodes CD20.

[0557] In one embodiment, the NOI encodes CD47.

[0558] In one embodiment, the NOI encodes CD138.

[0559] In one embodiment, the NOI encodes CD30.

[0560] In one embodiment, the NOI encodes CD33.

[0561] In one embodiment, the NOI encodes CD123.

[0562] In one embodiment, the NOI encodes CD70.

[0563] In one embodiment, the NOI encodes PSMA.

[0564] In one embodiment, the NOI encodes LeY.

[0565] In one embodiment, the NOI encodes ROR1.

[0566] In one embodiment, the NOI encodes Mucin 1.

[0567] In one embodiment, the NOI encodes Mucl.

[0568] In one embodiment, the NOI encodes EpCAM.

[0569] In one embodiment, the NOI encodes EGFR.

[0570] In one embodiment, the NOI encodes insulin.

[0571] In one embodiment, the NOI encodes a protein tyrosine phosphatase.

[0572] In one embodiment, the NOI encodes non-receptor type 22.

[0573] In one embodiment, the NOI encodes interleukin 2 receptor alpha.

[0574] In one embodiment, the NOI encodes helicase C domain 1-induced interferon.

[0575] In one embodiment, the NOI encodes HER2.

[0576] In one embodiment, the NOI encodes GPC3.

[0577] In one embodiment, the NOI encodes GD2.

[0578] In one embodiment, the NOI encodes mesothelin.

[0579] In one embodiment, the NOI encodes VEGFR2.

[0580] In other embodiments, the NOI may encode a chimeric antigen receptor (CAR) against a NKG2D ligand selected from the group consisting of ULBP1, ULBP2, ULBP3, H60, Rae-1a, Rae-1b, Rae-1g, Rae-1d, MICA, MICB.

[0581] In another embodiment, the NOI may encode SGSH, SUMF1, GAA, common gamma chain (CD132), adenosine deaminase, WAS protein, globulin, alpha-galactosidase A, delta-aminolevulinic acid (ALA) synthase, delta-aminolevulinic acid dehydratase (ALAD), hydroxymethylbilane (HMB) synthase, uroporphyrinogen (URO) synthase, uroporphyrinogen (URO) decarboxylase, coproporphyrinogen (COPRO) oxidase, enzymes, protoporphyrinogen (PROTO) oxidase, ferrochelatase, α-L-iduronidase, iduronate sulfatase, heparan sulfamidase, N-acetylglucosaminidase, heparan-α-glucosamine N-acetyltransferase, 3N-acetylglucosamine-6-sulfatase, galactose-6-sulfate sulfatase, β-galactosidase, N-acetylgalactosamine-4-sulfatase, β-glucuronidase, and hyaluronidase.

[0582] In addition to the NOI, the vector may contain or encode siRNA, shRNA, or regulated shRNA (Dickins et al. (2005) Nature Genetics 37: 1289-1295; Silva et al. (2005) Nature Genetics 37: 1281-1288).

[0583] Indications

[0584] The vectors according to the present invention (including retroviral and AAV vectors) can be used to deliver one or more NOIs useful for treating the diseases listed in WO 1998 / 05635, WO 1998 / 07859, WO 1998 / 09985. The target nucleotide can be DNA or RNA. Examples of such diseases are given below:

[0585] Diseases that respond to: cytokine and cell proliferation / differentiation activity; immunosuppressive or immunostimulatory activity (e.g., for treatment of immunodeficiencies including infection with human immunodeficiency virus; regulation of lymphocyte growth; treatment of cancer and many autoimmune diseases, and prevention of transplant rejection or induction of tumor immunity); regulation of hematopoiesis (e.g., treatment of bone marrow or lymphoid disorders); promotion of growth of bone, cartilage, tendon, ligament, and nerve tissue (e.g., for wound healing, treatment of burns, ulcers, and periodontal disease, as well as neurodegeneration); inhibition or activation of follicle stimulating hormone (regulation of fertility); ); chemotactic / chemopromoting activity (e.g., for mobilizing specific cell types to sites of injury or infection); hemostatic and thrombolytic activity (e.g., for treating hemophilia and stroke); anti-inflammatory activity (e.g., for treating septic shock or Crohn's disease); macrophage inhibitory activity and / or T cell inhibitory activity, and the resulting anti-inflammatory activity; anti-immune activity (i.e., inhibition of cellular and / or humoral immune responses, including responses not related to inflammation); inhibition of the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, and upregulated fas receptor expression in T cells.

[0586] Malignant diseases, including cancer; leukemia; benign and malignant tumor growth, invasion and spread, angiogenesis, metastasis; ascites and malignant pleural effusions.

[0587] Autoimmune diseases, including arthritis (including rheumatoid arthritis), allergies, allergies, asthma, systemic lupus erythematosus, collagen diseases and other diseases.

[0588] Vascular diseases, including atherosclerosis, arteriosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vasculitic diseases, respiratory distress syndrome, cardiovascular effects, peripheral vascular disease, migraine and aspirin-dependent antithrombotic disease, stroke, cerebral ischemia, ischemic heart disease or other diseases.

[0589] Diseases of the gastrointestinal tract, including peptic ulcer, ulcerative colitis, Crohn's disease, and others.

[0590] Liver disease, including liver fibrosis and cirrhosis.

[0591] Inherited metabolic disorders, including phenylketonuria (PKU), Wilson disease, organic acidemias, urea cycle disorders, cholestasis, and others.

[0592] Renal and urinary disorders, including thyroiditis or other glandular diseases, glomerulonephritis, or other diseases.

[0593] Ear, nose and throat diseases, including otitis or other ear, nose and throat diseases, dermatitis or other skin diseases.

[0594] Dental and oral disease, including periodontal disease, periodontitis, gingivitis, or other dental / oral diseases.

[0595] Testicular disease, including orchitis or epididymo-orchitis, infertility, testicular trauma, or other testicular disease.

[0596] Gynecological diseases, including placental dysfunction, placental insufficiency, habitual miscarriage, eclampsia, preeclampsia, endometriosis and other gynecological diseases.

[0597] Ophthalmic diseases, such as Leber congenital amaurosis (LCA), including LCA10, etc.; posterior uveitis; intermediate uveitis; anterior uveitis; conjunctivitis; chorioretinitis; uveoretinitis; optic neuritis; glaucoma, including open-angle glaucoma and juvenile congenital glaucoma; intraocular inflammation, such as retinitis or cystoid macular edema; sympathetic ophthalmia; scleritis; retinitis pigmentosa; macular degeneration, including age-related macular degeneration (AMD) and juvenile macular degeneration, including Best's disease, Best's vitelliform macular degeneration, Stargardt's disease; Usher's syndrome; Dohn's honeycomb retinal dystrophy; Sorby macular dystrophy; ophthalmologic disorders; juvenile retinoschisis; cone-rod dystrophy; corneal dystrophy; Fuch dystrophy; Leber's congenital amaurosis; Leber's hereditary optic neuropathy (LHON); Ady syndrome; Oguchi's disease; degenerative fundus disease; visual impairment; ocular inflammation due to infection; proliferative vitreoretinopathy; acute ischemic optic neuropathy; excessive scarring, such as after glaucoma filtering surgery, in response to eye implants, corneal allograft transplant rejection; and other ophthalmic diseases, such as diabetic macular edema, retinal vein occlusion, RLBP1-related retinal dystrophy, choroideremia, and achromatopsia.

[0598] Neurological and neurodegenerative diseases, including Parkinson's disease, complications and / or side effects of treatment for Parkinson's disease, AIDS-related dementia complex, HIV-related encephalopathy, Devic's disease, Sydenham's chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, stroke, post-polio syndrome, psychiatric disorders, myelitis, encephalitis, subacute sclerosing panencephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Fabry disease, Gaucher disease, cystinosis, Pompe disease, metachromatic leukodystrophy, Wiscott's Aldrich syndrome, adrenoleukodystrophy, beta-thalassemia, sickle cell disease, Guillain-Barré syndrome, Sydenham's chorea, myasthenia gravis, pseudotumor cerebrum, Down syndrome, Huntington's chorea, CNS compression or CNS trauma or infection of the CNS, muscular dystrophy and nutritional disorders, diseases, conditions or disorders of the central and peripheral nervous systems, motor neurone diseases including amyotrophic lateral sclerosis, spinal muscular atrophy, spinal cord and laceration injuries.

[0599] Other diseases and conditions, such as cystic fibrosis; mucopolysaccharidoses, including Sanfilipo syndrome A, Sanfilipo syndrome B, Sanfilipo syndrome C, Sanfilipo syndrome D, Hunter syndrome, Hurler-Scheie syndrome, Morchau syndrome; ADA-SCID; X-linked SCID; X-linked chronic granulomatous disease; porphyria; hemophilia A; hemophilia B; post-traumatic inflammation, bleeding, coagulation and acute phase response; cachexia; anorexia; acute infection; septic shock; infectious diseases; diabetes; complications or side effects of surgery; bone marrow transplantation or other transplant complications and / or side effects; complications and side effects of gene therapy, such as due to infection with viral vectors, or AIDS, to suppress or inhibit humoral and / or cellular immune responses, thereby preventing and / or treating transplant rejection in the case of transplantation of natural or artificial cells, tissues and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.

[0600] siRNA, microRNA, and shRNA

[0601] In certain other embodiments, the NOI comprises a microRNA. MicroRNA is a very large group of small RNAs produced naturally in organisms, at least some of which can regulate the expression of target genes. The basic members of the microRNA family are let-7 and lin-4. The let-7 gene encodes a small, highly conserved RNA species that regulates the expression of endogenous protein-coding genes during worm development. This active RNA species is initially transcribed as a precursor of approximately 70 nt, which is processed into a mature form of approximately 21 nt after transcription. Both let-7 and lin-4 are transcribed into hairpin RNA precursors, which are processed into their mature forms by the Dicer enzyme.

[0602] In addition to the NOI, the vector may also contain or encode siRNA, shRNA, or regulated shRNA (Dickins et al. (2005) Nature Genetics 37: 1289-1295; Silva et al. (2005) Nature Genetics 37: 1281-1288).

[0603] Post-transcriptional gene silencing (PTGS) mediated by double-stranded RNA (dsRNA) is a conservative cellular defense mechanism that controls the expression of foreign genes. It is believed that random integration of elements (e.g., transposons) or viruses can cause the expression of dsRNA, which can activate sequence-specific degradation of homologous single-stranded mRNA or viral genomic RNA. This silencing effect is called RNA interference (RNAi) (Ralph et al. (2005) Nature Medicine 11: 429-433). The mechanism of RNAi involves processing long dsRNA into duplexes of RNA of about 21 to 25 nucleotides (nt). These products are called small interfering RNA or silencing RNA (siRNA), which are sequence-specific mediators of mRNA degradation. In differentiated mammalian cells, it has been found that dsRNA of >30 bp can activate the interferon response, resulting in the cessation of protein synthesis and non-specific mRNA degradation (Stark et al., Annu Rev Biochem 67: 227-64 (1998)). However, 21 nt siRNA duplexes can be used to circumvent this response (Elbashir et al., EMBO J. Dec 3; 20(23): 6877-88 (2001); Hutvagner et al., Science. Aug 3, 293(5531): 834-8. Eupub Jul 12 (2001)), allowing analysis of gene function in cultured mammalian cells.

[0604] Pharmaceutical composition

[0605] The present disclosure provides a pharmaceutical composition, which includes the lentiviral vector described herein or cells or tissues transduced with the viral vector described herein, and a pharmaceutically acceptable carrier, diluent or excipient.

[0606] The present disclosure provides a pharmaceutical composition for treating an individual by gene therapy, wherein the composition comprises a therapeutically effective amount of a lentiviral vector. The pharmaceutical composition can be used for human or animal use.

[0607] The composition may include a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The selection of a pharmaceutical carrier, excipient or diluent may be carried out according to a predetermined route of administration and standard pharmaceutical practice. The pharmaceutical composition may include or, in addition to a carrier, excipient or diluent, may include: any suitable adhesive, lubricant, suspending agent, coating agent, solubilizing agent and other carrier agents (such as lipid delivery systems) that may assist or increase the carrier's entry into the target site.

[0608] Where appropriate, the compositions may be administered by any one or more of the following: inhalation; in the form of suppositories or vaginal suppositories; topically in the form of lotions, solutions, creams, ointments or dusting powders; by use of a skin patch; orally in the form of tablets containing excipients such as starch or lactose, or in the form of capsules or ovules alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavoring or coloring agents; or they may be injected parenterally, for example intracavernosal, intravenously, intramuscularly, intracranially, intraocularly, intraperitoneally or subcutaneously. For parenteral administration, the compositions are preferably used in the form of sterile aqueous solutions which may contain other substances, such as sufficient salts or monosaccharides, to render the solution isotonic with the blood. For buccal or sublingual administration, the compositions may be administered in the form of tablets or lozenges formulated in conventional manner.

[0609] The lentiviral vectors described herein can be used to transduce target cells or target tissues ex vivo, and then transfer the target cells or target tissues into a patient in need of treatment. Examples of such cells can be autologous T cells, and examples of such tissues can be donor corneas.

[0610] Variants, derivatives, analogs, homologs and fragments

[0611] In addition to the specific proteins and nucleotides mentioned herein, the present invention also encompasses the use of variants, derivatives, analogs, homologs and fragments thereof.

[0612] In the context of the present invention, a variant of any given sequence is a sequence in which a specific sequence of residues (whether amino acid residues or nucleic acid residues) is modified in such a way that the polypeptide or polynucleotide in question retains at least one of its endogenous functions. Variant sequences may be obtained by adding, deleting, substituting, modifying, replacing and / or altering at least one residue present in the native protein.

[0613] The term "derivative" as used herein in connection with a protein or polypeptide of the present invention includes any replacement, alteration, modification, substitution, deletion and / or addition of one (or more) amino acid residues in the sequence, as long as the resulting protein or polypeptide retains at least one of its endogenous functions.

[0614] The term "analog" as used herein with respect to a polypeptide or polynucleotide includes any mimetic, ie, a compound that has at least one of the endogenous functions of the polypeptide or polynucleotide that it mimics.

[0615] Typically, from, for example, 1, 2 or 3 to 10 or 20 substitutions may be made to make amino acid substitutions, as long as the modified sequence retains the desired activity or ability. Amino acid substitutions may include the use of non-natural analogs.

[0616] The proteins used in the present invention may also have deletions, insertions or substitutions of amino acid residues that produce silent changes and result in functionally equivalent proteins. Careful amino acid substitutions may also be made based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic properties of the residues, as long as the endogenous function is maintained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values ​​include asparagine, glutamine, serine, threonine and tyrosine.

[0617] For example, conservative substitutions can be made according to the following table. Amino acids in the same cell of the second column, preferably in the same row of the third column, can be substituted for each other:

[0618]

[0619] The term "homolog" means an entity having a certain homology with a wild-type amino acid sequence and a wild-type nucleotide sequence. The term "homology" can be equivalent to "identity".

[0620] In this context, homologous sequences include amino acid sequences that may be at least 50%, 55%, 65%, 75%, 85% or 90% identical to the subject sequence, preferably at least 95%, 97% or 99% identical to the subject sequence. Typically, homology includes active sites that are identical to the subject amino acid sequence, etc. Although homology can also be considered in terms of similarity (i.e., amino acid residues with similar chemical properties / functions), in the context of the present invention, it is preferred to express homology in terms of sequence identity.

[0621] In the context of the present invention, homologous sequences include nucleotide sequences that may be at least 50%, 55%, 65%, 75%, 85% or 90% identical to the subject sequence, preferably at least 95%, 97%, 98% or 99% identical to the subject sequence. Although homology can also be considered in terms of similarity, in this context, it is preferred to express homology in terms of sequence identity.

[0622] Homology comparisons can be performed by eye, or more usually with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the homology or identity percentage between two or more sequences.

[0623] Percent homology can be calculated for contiguous sequences, i.e., one sequence is aligned with the other sequence and each amino acid in one sequence is compared directly to the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only for a relatively short number of residues.

[0624] Although this is a very simple and compatible approach, it does not take into account that, for example, an insertion or deletion in a nucleotide sequence in an otherwise identical pair of sequences will cause subsequent codons to not align, thereby potentially resulting in a greatly reduced homology percentage when the full sequence is aligned. Therefore, most sequence comparison methods are designed to produce an optimal alignment that takes into account possible insertions and deletions without deducting too much from the overall homology score. This is achieved by inserting "gaps" in the sequence alignment in an attempt to maximize local homology.

[0625] However, these more complex methods specify a "gap penalty" for each gap that occurs in the alignment, so that for the same number of identical amino acids, a sequence alignment with as few gaps as possible and reflecting a higher correlation between the two compared sequences will receive a higher score than a sequence alignment with many gaps. "Affine gap penalty" is usually used to impose a relatively high penalty on the presence of a gap, while the penalty for each subsequent residue in the gap is lower. This is the most commonly used gap scoring system. Of course, a high gap penalty will produce the best alignment with fewer gaps. Most alignment programs allow the gap penalty to be modified. However, when using this type of software for sequence comparison, it is best to use the default values. For example, when using the GCG Wisconsin Bestfit software package, the default gap penalty for amino acid sequences is: -12 for a gap and -4 for each extension.

[0626] Therefore, the calculation of the maximum homology percentage first needs to consider the gap penalty to produce the best comparison. The appropriate computer program for performing this comparison is the GCG Wisconsin Bestfit software package (University of Wisconsin, USA; Devereux et al. (1984) Nucleic Acids Research 12: 387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST software package (see Ausubel et al. (1999) supra-Ch. 18), FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410) and the GENEWORKS comparison tool program group. Both BLAST and FASTA can be used for offline and online searches (see Ausubel et al. (1999), supra, pp. 7-58 to pp. 7-60). However, for some applications, it is preferred to use the GCG Bestfit program. Another tool called BLAST 2 sequences can also be used to compare protein and nucleotide sequences (see FEMS Microbiol Lett (1999) 174(2):247-50; FEMS Microbiol Lett (1999) 177(1):187-8).

[0627] Although the final homology percentage can be measured according to identity, the alignment process itself is usually not based on an all-or-nothing paired comparison. Instead, a similarity score matrix drawn is usually used, and the score matrix specifies scores for each paired comparison according to chemical similarity or evolutionary distance. An example of this matrix commonly used is the BLOSUM62 matrix-the default matrix of the BLAST program group. The GCG Wisconsin program generally uses either public default values ​​or a user symbol comparison table (if provided) (for further details, see the user manual). For some applications, it is preferred to use the public default values ​​of the GCG software package, or in the case of other software, a default matrix, such as BLOSUM62, is used.

[0628] Once the software has produced an optimal alignment, the percent homology, preferably the percent sequence identity, can be calculated. The software typically does this as part of the sequence comparison and produces a numerical result.

[0629] "Fragment" is also a variant, and this term generally refers to a selected region of a polypeptide or polynucleotide that is of interest functionally or in, for example, an assay. Thus, a "fragment" refers to an amino acid or nucleic acid sequence that is a portion of a full-length polypeptide or polynucleotide.

[0630] Such variants can be prepared by standard recombinant DNA techniques such as site-directed mutagenesis. In the case of inserting, synthetic DNA can be prepared, which encodes the insertion and the 5' and 3' flanking regions of the native sequence corresponding to either side of the insertion site. The flanking regions contain convenient restriction sites corresponding to the sites in the native sequence, so that the sequence can be cut with a suitable enzyme, and the synthetic DNA can be connected to the nick. Then express the DNA according to the present invention to prepare the encoded protein. These methods are merely examples of many standard techniques known in the art for manipulating DNA sequences, and other known techniques also can be used.

[0631] All variants, fragments or homologues of regulatory proteins suitable for use in the cells and / or modular constructs of the invention will retain the ability to bind to the cognate binding site of the NOI, thereby repressing or preventing translation of the NOI in the viral vector production cell.

[0632] All variants, fragments or homologs of the binding site will retain the ability to bind to the cognate RNA binding protein, thereby repressing or preventing translation of the NOI in the viral vector production cell.

[0633] Codon optimization

[0634] The polynucleotides used in the present invention (including components of NOI and / or vector production systems) can be codon optimized. Previously, codon optimization has been described in WO 1999 / 41397 and WO 2001 / 79518. Different cells differ in their use of specific codons. This codon preference corresponds to the preference of the relative abundance of a specific tRNA in the cell type. By changing the codons in the sequence, they are customized to match the relative abundance of the corresponding tRNA, which can increase expression. Similarly, by intentionally selecting codons known to be rare in a specific cell type by the corresponding tRNA, expression can be reduced. Therefore, translation control can be performed to a greater extent.

[0635] Many viruses (including retroviruses) use a large number of rare codons, and by changing these codons to correspond to commonly used mammalian codons, increased expression of a gene of interest (e.g., a NOI or packaging component) in mammalian production cells can be achieved. Codon usage tables for mammalian cells and a variety of other organisms are known in the art.

[0636] Codon optimization of viral vector components has many other advantages. For the nucleotide sequences encoding the viral particle packaging components necessary for the assembly of viral particles in producer cells / packaging cells, RNA instability sequences (INS) can be removed therefrom due to changes in their sequences. At the same time, the amino acid sequence coding sequence of the packaging component is retained, so that the viral components encoded by the sequence remain the same or at least sufficiently similar, so that the function of the packaging component is not impaired. In lentiviral vectors, codon optimization can also overcome the need for Rev / RRE in export, so that the optimized sequence is independent of Rev. Codon optimization can also reduce homologous recombination between different constructs in the vector system (e.g., between the overlapping regions of the gag-pol open reading frame and the env open reading frame). Therefore, the overall effect of codon optimization is a significant increase in viral titer and improved safety.

[0637] In one embodiment, only the codons associated with INS are codon optimized. However, in a more preferred and practical embodiment, all sequences are codon optimized, with some exceptions, such as the sequence containing the frameshift site of gag-pol (see below).

[0638] The gag-pol gene of the lentiviral vector contains two overlapping reading frames encoding gag-pol proteins. The expression of both proteins depends on the frameshift during translation. The frameshift is caused by the "slipping" of the ribosome during translation. This sliding is believed to be caused at least in part by the ribosome-stalling RNA secondary structure. This secondary structure exists downstream of the frameshift site in the gag-pol gene. For HIV, the overlapping region extends from nucleotide 1222 (wherein nucleotide 1 is the A of gag ATG) downstream of the gag start end to the end of gag (nt 1503). Therefore, the 281bp fragment of the frameshift site and the overlapping region spanning the two reading frames is preferably not codon optimized. Retaining this fragment will enable more efficient expression of Gag-Pol protein. For EIAV, it is believed that the overlapping start end is nt 1262 (wherein nucleotide 1 is the A of gag ATG), and the overlapping end is nt 1461. To ensure retention of the frameshift site and gag-pol overlap, nt 1156 to 1465 of the wild-type sequence have been retained.

[0639] Deviations from optimal codon usage may be made, for example, to accommodate convenient restriction sites, and conservative amino acid changes may be introduced into the Gag-Pol protein.

[0640] In one embodiment, codon optimization is based on lightly expressed mammalian genes. The third base may be changed, and sometimes the second and third bases may be changed.

[0641] Due to the degeneracy of the genetic code, it will be appreciated that a wide variety of gag-pol sequences are available to the skilled person. In addition, there are many described retroviral variants that can be used as starting points for the generation of codon-optimized gag-pol sequences. The lentiviral genome can be quite variable. For example, there are many HIV-1 analogs that are still functional. The same is true for EIAV. These variants can be used to enhance specific parts of the transduction process. Examples of HIV-1 variants can be found in the HIV database (http: / / hiv-web.lanl.gov) operated by Los Alamos National Security. Details on EIAV cloning can be found in the National Center for Biotechnology Information (NCBI) database at http: / / www.ncbi.nlm.nih.gov.

[0642] The strategy for codon-optimized gag-pol sequences can be used for any retrovirus. This will apply to all lentiviruses, including EIAV, FIV, BIV, CAEV, VMR, SIV, HIV-1, and HIV-2. In addition, this method can be used to increase the expression of genes from HTLV-1, HTLV-2, HFV, HSRV, and human endogenous retroviruses (HERV), MLV, and other retroviruses.

[0643] Codon optimization can make gag-pol expression independent of Rev. However, in order to enable the use of anti-rev or RRE factors in lentiviral vectors, it is necessary to make the viral vector production system completely independent of Rev / RRE. Therefore, the genome also needs to be modified. This is achieved by optimizing the vector genome components. Advantageously, these modifications also lead to a safer system without all extra proteins in the producer cells and transduced cells.

[0644] It is demonstrated in the examples of the present invention that the modified U1 and related methods and uses of the present invention as described herein can advantageously result in an acceptable or favorable safety profile.

[0645] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that such publications constitute prior art for the appended claims.

[0646] The present invention will now be further described by way of examples, which are intended to help those skilled in the art to practice the present invention without limiting the scope of the present invention in any way.

[0647] Example

[0648] General molecular / cellular biology techniques and assays

[0649] Modified U1 snRNA expression construct

[0650] The DNA-based expression construct for the modified U1 snRNA contains conserved sequences in the endogenous U1 snRNA gene that drive RNA transcription and termination, highlighted in the following non-limiting example of 256U1 (also referred to as U1_256) snRNA:

[0651]

[0652] Legend: Uppercase only = U1 PolII promoter (nt1-392); Lowercase = redirection region (nt393-409); Lowercase bold = redirection sequence [nt256-270 in this case targeting the wild-type HIV-1 packaging signal] (nt395-409); Uppercase italics = primary U1 snRNA sequence [clover leaf] (nt410-562); Uppercase underline = transcription termination region (nt563-652)

[0653] The table below provides a summary of the initial modified U1 snRNAs and controls used in the study, indicating the new annealing sequences and target site sequences (sequences are presented in the 5' to 3' direction).

[0654] Table I. Sequence listing describing the target annealing sequences (heterologous sequences complementary to the target sequence) in the modified U1 snRNAs for testing and the control U1 snRNAs, as well as their target sequences used in the initial studies. The nucleotides are presented in DNA form as they will be encoded in the respective expression cassettes in the "redirecting region". The (AT) motif is present in all initial constructs, forming the first two nucleotides of the U1 snRNA molecule in each case. The target sequence numbers refer to the targets indicated in the NL4-3 (GenBank: M19921.2) or HXB2 (GenBank: K03455.1) strains of HIV-1, as the lentiviral vector genomes in this study contain a mixed packaging signal composed of these two highly conserved strains (the packaging sequence used in this study is most similar to the vector sequence in GenBank: MH782475.1).

[0655]

[0656]

[0657] *Numbering relative to the vector genome RNA sequence

[0658] **Lower case target sequences are for (HXB2), underlined target sequences are the AA>CGCG frameshift in the gag ORF (U1 376).

[0659] Adherent cell culture, transfection, and lentiviral vector production

[0660] HEK293T cells were maintained in complete medium (Dulbecco's modified Eagle's medium (DMEM) (Sigma) supplemented with 10% heat-inactivated (FBS) (Gibco), 2 mM L-glutamine (Sigma) and 1% non-essential amino acids (NEAA) (Sigma)) at 37°C, 5% CO2.

[0661] Standard scale production of HIV-1 vectors in adherent mode was performed in 10 cm dishes under the following conditions (all conditions were scaled by area when performed in other formats): HEK293T cells were grown at 3.5 × 10 5 Cells / mL were seeded in 10 mL complete medium and approximately 24 hours later, cells were transfected using the following mass ratios of plasmids / 10 cm plate: 4.5 μg genome, 1.4 μg Gag-Pol, 1.1 μg Rev, 0.7 μg VSV-G and between 0.01 μg and 2 μg of modified snRNA plasmid.

[0662] Transfection was mediated by mixing DNA with Lipofectamine 2000CD in Opti-MEM according to the manufacturer's protocol (Life Technologies). After approximately 18 hours, sodium butyrate (Sigma) was added to a final concentration of 10 mM for 5 to 6 hours, and then the transfection medium was replaced with 10 ml of fresh serum-free medium. Typically, vector supernatants were harvested after 20 to 24 hours, then filtered (0.22 μm) and frozen at -20 / -80°C. As a positive control for nuclease treatment, the cells were typically treated with 10 ml of 5% dapoxetine (Sigma) 1 hour before filtration. Add to harvest at 5 U / mL.

[0663] Suspension cell culture, transfection, and lentiviral vector production

[0664] HEK293T.1-65s suspension cells were grown in Freestyle + 0.1% CLC (Gibco) at 37°C, 5% CO2 in a shaking incubator (25 mm orbit set at 190 RPM). All vector production using suspensions was performed in 24-well plates (1 mL volume on a shaking platform), 25 mL shake flasks or bioreactors (≤5 L). HEK293Ts cells were grown at 8×10 5 Cells / ml were seeded in serum-free medium and cultured with shaking at 37°C, 5% CO2 throughout the vector production process. Approximately 24 hours after seeding, cells were transfected using the following ratio of plasmid mass / effective final culture volume at transfection: 0.95 μg / mL genome, 0.1 μg / mL Gag-Pol, 0.6 μg / mL Rev, 0.7 μg / mL VSV-G, and between 0.01 μg / mL and 0.2 μg / mL of modified U1 snRNA plasmid.

[0665] Transfection was mediated by mixing DNA with Lipofectamine 2000CD in Opti-MEM according to the manufacturer's protocol (Life Technologies). After approximately 18 hours, sodium butyrate (Sigma) was added to a final concentration of 10 mM. Typically, vector supernatants were harvested after 20 to 24 hours, then filtered (0.22 μm) and frozen at -20 / -80°C. As a positive control for nuclease treatment, the supernatant was typically added 1 hour before filtration. Add to harvest at 5 U / mL.

[0666] Lentiviral vector titration assay

[0667] For titration of lentiviral vectors containing a GFP-tagged cassette, HEK293T cells were cultured at 1.2 × 10 4 Cells were seeded at 100 cells / well in a 96-well plate. Cells were transduced with a viral vector encoding GFP in complete medium containing 8 mg / ml polybrene and 1x penicillin-streptomycin for approximately 5 to 6 hours, and fresh medium was then added. Transduced cells were cultured at 37°C, 5% CO2 for 2 days. The cultures were then prepared for flow cytometry using Attune-NxT (Thermofisher). The percentage of GFP expression was determined and the 2×10 4 The vector titer was calculated based on the predicted cell count of each cell (based on typical growth rate), the dilution factor of the vector sample, the percentage of the GFP-positive population, and the total volume at the time of transduction.

[0668] Titration of lentiviral vectors by integration-assay

[0669] For lentiviral vector titration by integration assay, 1 × 10 cells were transduced in 12-well scale using 0.5 mL volumes of neat vector supernatant to 1:5 dilutions of vector supernatant in the presence of 8 μg / mL polybrene. 5 HEK293T cells. 6 Cultures were passaged for 10 days (1:5 splits every 2 to 3 days) before host DNA was extracted from cell pellets. Duplex quantitative PCR was performed using FAM primers / probes set to HIV packaging signal (ψ) and RRP1, and vector titers (TU / mL) were calculated using the following factors: transduction volume, vector dilution, and HIV-1ψ copies normalized to RRP1 detected per reaction.

[0670] SDS-PAGE and immunoblotting

[0671] Standard SDS-PAGE and immunoblotting protocols were performed primarily on end-of-vector production cells after vector harvest. For immunoblot analysis of vector particles, approximately 2 mL of filtered vector supernatant was centrifuged at 21,000 rpm at 4°C for 1 to 2 hours in a microcentrifuge and the "cell pellet" was resuspended in 20 μL to 30 μL PBS. The vector was then loaded onto 7 × 10 cells per well of an SDS-PAGE gel by PERT assay (see below). 4 PERT-predicted TUs were quantified for these concentrated vector preparations. Approximately 1 × 10 6 The vector is completed to the production cells and the nuclei are removed by centrifugation. Protein samples are characterized by the BioRad assay and typically 5 μg of protein is loaded onto a precast 12 to 15 well 4% to 20% acrylamide gel. Proteins are transferred at 45V for 3 hours on ice. Blots are blocked overnight at 4°C in 5% milk PBS / Tween-20. Blots are probed with primary antibodies and HRP-secondary antibodies typically diluted 1:100 in blocking buffer. Immunoblots are analyzed by ECL detection and subsequent X-ray film exposure.

[0672] RNA extraction and RT-qPCR assay

[0673] Total RNA was extracted and purified from cells or LV samples using the RNeasy Mini Kit (QIAGEN). 1 μg of RNA was treated with DNAse I (Ambion) for 1 hour before inactivation. QuantStudio TM 6 (Life Technologies) under standard chemical RT-PCR cycling conditions, 50 ng of RNA treated with DNAase I was used in a qRT-PCR reaction containing One-step RT-PCR master mix (Life Technologies) was used with target-specific primer / probe sets. Negative control reactions were performed without RT to control for DNA contamination.

[0674] Protein analysis by mass spectrometry

[0675] Sample preparation

[0676] Samples for MS analysis were prepared by in-solution trypsin digestion followed by peptide cleanup. Briefly, samples were denatured using a high molar urea buffer before adding dithiothreitol (DTT) as a reducing agent and iodoacetamide as an alkylating agent, respectively. After protein linearization, trypsin was added to each sample after dilution to reduce the urea concentration. Protein digestion was completed by incubation at 37°C overnight. Trypsin activity was then neutralized by acidic pH by adding trifluoroacetic acid (TFA). The digested peptides were cleaned up and desalted on a C18 column. The column was initially activated with acetonitrile (ACN) and washed thoroughly with a 0.1% TFA solution before loading the digested peptides. After an additional wash with a 0.1% TFA solution, the peptides were eluted with an acidified 70% ACN solution and collected in a low binding tube. Next, the ACN was removed by evaporation using a SpeedVac, and the clean, desalted, dried peptides were resuspended in a solution containing 2% ACN and 0.1% formic acid (FA).

[0677] Liquid chromatography and mass spectrometry.

[0678] In conjunction with Q Exactive TM The peptides were analyzed on an HF mass spectrometer (Thermo Fisher Scientific) coupled online to an UltiMate 3000 (Thermo Fisher Scientific). The peptides were loaded onto the μPAC at a flow rate of 5 μL / min. TM The precipitate was filtered on a trapping column (PharmaFluidics, Ghent, Belgium) for 3 min and then filtered on a 50 cm μPAC column. TM Separation was performed on a Q Exactive ® column (PharmaFluidics) using a non-linear gradient of acetonitrile in 0.1% formic acid over 120 min from 0.8% to 78%. The column temperature was maintained at 50°C using an UltiMate 3000 column oven. TM HF was operated in data-independent (DIA) mode from 350 m / z to 1,150 m / z. 6 Full scan spectra were recorded at a resolution of 120,000 with an automatic gain control (AGC) target value of 100 and a maximum injection time of 20 ms. The full scan was followed by 100 windows of 8.5 Th width with an overlap of 0.5 Th. DIA spectra were recorded at a resolution of 30 000 using 2 × 10 5The AGC target value was 2.0 kV, the maximum injection time was 60 ms, and the first mass was fixed at 200 Th. The normalized collision energy (NCE) was set to 28%, and the default charge state was set to 3. The peptides were ionized using an EASY-spray electrospray emitter (Thermo Fisher Scientific) at a spray voltage of 2.0 kV and a heated capillary temperature of 250 °C.

[0679] Data analysis was performed using DIA-NN.

[0680] Protein sequences of the human uniprot reference proteome were concatenated with lentiviral proteins (GAG, POL) and common contaminants to generate a library of predictions for this project. The library predicts all possible peptides with strict trypsin specificity (KR instead of P) in the range of 350 m / z to 1,150 m / z, allowing for up to one missing cleavage site. Mass spectra were analyzed in DIA-NN (version 1.7) using a fixed mass tolerance of 5 ppm for MS1 and 10 ppm for MS2 spectra, with ‘RT analysis’ enabled using the ‘Any LC’ quantification strategy. The false discovery rate for precursor identification was set to 0.1% and proteins were grouped according to their respective genes. Proteins were quantified using ‘normalised.unique’ intensities.

[0681] Differential expression analysis

[0682] Differential expression analysis was performed in R using the BioConductor DEP package. Proteins with missing values ​​were first filtered so that at least one condition was quantified for all replicates. Variance stabilization normalization was performed using the BioConductor VSN package. Missing values ​​were then interpolated using quantile regression interpolation for left-censored data (QRILC). Differential expression analysis was performed using a protein-wise linear model with empirical Bayesian statistics. P values ​​were adjusted for multiple testing using the Benjamini & Hochberg method.

[0683] Generation and functional evaluation of CAR-T cells

[0684] Cell transduction

[0685] Peripheral blood mononuclear cells (PBMCs) from three healthy human donors were obtained from a commercial supplier. 1.5 × 10 cells / well were plated in modified T cell medium (12-well plate) containing 100 IU / mL recombinant human IL-2. 6 PBMC and 4.5×10 6CD3 / CD28 T cell expander beads were incubated together. LV-CAR / LV-CAR[+256U1] was added to the relevant wells at an estimated multiplicity of infection (MOI) of 1.25 or 0.3 as described. Cells were maintained at 1.0 × 10 by increasing the volume of modified T cell medium containing 100 IU / mL recombinant human IL-2. 5 After 13 days in culture, the cells were cultured at a concentration of 1.0 × 10 viable cells / mL in cell freezing medium. 7 The percentage of transduced cells was measured by flow cytometry 8 days after initial expansion and 5 days after thawing.

[0686] Functional testing

[0687] The cell lines used to test CAR-T cell responses were SKOV-3, an ovarian cancer cell line that expresses 5T4l at high levels, and three acute myeloid leukemia (AML) cell lines, THP-1, Kasumi-1, and AML-193, the latter being a 5T4-negative cell line. Target cell lines were labeled with a fluorescent cell tracking dye for subsequent identification by flow cytometry. Approximately 1×10 5 CAR-T cells and 1×10 5 Each cell line was co-cultured in triplicate in 96-well round-bottom plates. After 24 hours, a volume of culture supernatant was removed from each well for analysis of interferon-γ and granzyme B by cytometric bead array. After 40 hours, cells were harvested and stained with fluorescent viability dyes. The percentage of non-viable target cells in each experimental well was measured by flow cytometry.

[0688] Example 1

[0689] The GFP-polyA-GLuciferase reporter cassette was designed to evaluate the effect of polyA signal mutants on transcriptional readthrough of the HIV-1 polyA site. The reporter gene encodes the upstream GFP ORF (to enable normalization for transfection efficiency), a standard 3' SIN-LTR sequence (including the RU5 sequence carrying the HIV-1 polyA signal), followed by an IRES-Gluc sequence and the SV40 polyA signal. Therefore, any readthrough HIV-1 polyA signal can be measured by luciferase activity, which is normalized by GFP expression. The effects of two polyA signal mutants (pAM1 = AAUAAA>AACAAA; pAKO = AAUAAAA deletion) and the wild-type polyA signal (wt pA = AAUAAA) were measured. Figure 2 A).

[0690] Vector particles were produced in the absence or presence of modified U1 snRNA (256_U1, provided in parallel during production) using one standard lentiviral vector genome and two genomes containing different 5'LTR polyA signal mutants (pAM1 or pAM2) and then titrated. Vector production in the presence of modified U1 snRNA was 3 to 6 times higher than in the absence of modified U1 snRNA and was independent of the presence or absence of a functional polyA site in the 5'LTR ( Figure 2 B). This suggests that the modified U1 snRNA has no effect on suppressing any missed readthrough of polyA (i.e., endogenous U1 snRNA binds to the major splice donor site and completely suppresses premature polyadenylation), and therefore must increase vector titer via some other novel mechanism (perhaps by improving vRNA stability / nuclear export).

[0691] Example 2

[0692] Experiments were performed to evaluate other features of the U1 snRNA molecule that may be desirable in the present invention. Several modified U1 snRNA expression cassettes were constructed, all with a target sequence located at position "256" ( Figure 3 A). Two variants contained published mutations in the stem-loop I region to eliminate U1-70K protein binding (256_70K_m1 and 256_70K_m2), two variants contained published mutations in the stem-loop II region to eliminate U1A protein binding (256_U1A_m1 and 256_U1A_m2), and one variant contained a mutated Sm protein binding motif (256_SM_m1) (Alexander, MR et al., 2010, Nucleic Acids Res., 38:3041-53; Ashe, MP et al., 2000, RNA, 6:170-7). Three other cassettes expressing native U1 snRNA were also constructed (U1A5, U1A6, and U1A7), which have conserved Sm binding regions but very different sequences in the cloverleaf structure (and are therefore unlikely to bind U1-70K or U1A). Finally, two control U1 snRNA constructs targeting the lacZ gene sequence were generated as negative controls.

[0693] When these modified U1 snRNAs were co-transfected with lentiviral vector components (marker gene = GFP) into HEK293T producer cells, 256_U1 and 70K or U1A protein binding mutant U1, but not other variants, increased vector titers 2- to 4-fold ( Figure 3A). U1A-based snRNAs increase LV titers independently of functional U1A-70K and U1A binding loops, but titer enhancement depends on the Sm protein binding motif. snRNA variants U1A5, U1A6, and U1A7 did not increase LV titers, suggesting that some structural features of U1A snRNA are required for this effect.

[0694] Example 3

[0695] Experiments performed in an adherent HEK293T vector production environment. Standard lentiviral vectors encoding GFP were produced in the absence or presence of a modified U1 snRNA with a targeting sequence that binds to a site along the 5' length of the vector genome vRNA molecule, the targeting sequence comprising either a 15 nucleotide or a 9 nucleotide targeting complementary length. The modified U1 snRNAs were named according to the first nucleotide of the targeting sequence site along the 5' length of the vector genome vRNA molecule (see Table I). The data show that increases in vector titer enhancement correlated with target sites distal to the 5' polyA site, with an ideal target region encoded within the SL1 loop of the packaging signal ( Figure 4 ). The data also showed that targeting a complementary length of 15 nucleotides rather than 9 nucleotides (based on endogenous U1 snRNA) resulted in a more robust increase in vector titer.

[0696] Example 4

[0697] Experiments were performed in a suspension, serum-free HEK293T vector production environment. Standard lentiviral vectors encoding GFP were produced in the absence or presence of modified U1 snRNAs with targeting sequences that bind to sites along the 5' length of the vector genome vRNA molecule, including either 15 nucleotides or 9 nucleotides of targeting complementarity. The modified U1 snRNAs were named according to the first nucleotide of the targeting sequence site along the 5' length of the vector genome vRNA molecule. The data show that increased vector titer enhancement was associated with target sites distal to the 5' polyA site, with an ideal target region encoded within the SL1 loop of the packaging signal ( Figure 5 ).

[0698] Example 5

[0699] Experiments performed in an adherent HEK293T vector production environment. Standard lentiviral vectors encoding GFP (pHIV-EF1a-GFP) or CD19* chimeric antigen receptor (pHIV-EF1a-CD19) were produced in the absence or presence of modified U1 snRNA targeting either a site within the lentiviral vector packaging region (256U1 or 305U1) or a LacZ control (LacZU1). The modified U1 snRNAs were named according to the first nucleotide of the targeted sequence site within the lentiviral vector packaging region (see Table I). The modified U1 snRNA expression constructs were provided at two different doses: 1x and 4x. The data demonstrate that the present invention can be applied independently of the payload of the vector genome ( Figure 6 ).

[0700] *The CD19CAR in this and all other examples provided herein uses a scFV based on a publicly available sequence:

[0701] Heavy chain - GenBank CAA67618.1:

[0702]

[0703] Light chain (kappa) - GenBank AAB34430.1:

[0704]

[0705] Example 6 - Promiscuous splicing from MSD, reduction in MSD-2KO lentiviral vector titer and restoration / enhancement of titer by redirected U1 snRNA.

[0706] The general structure of the lentiviral vector genome remains consistent in all three generations of vector systems (Toshie SAKUMA, Michael A. BARRY and Yasuhiro IKEDA. Biochem. J. (2012) 443, 603–618), retaining the 5' region of the HIV-1 provirus, which contains the packaging sequence and the location of the RRE upstream of the transgene cassette, but otherwise differing from the subsequent generations, becoming independent of U3 / tat, self-inactivating in the 3' LTR, and using a combination of cppt and wPRE. The apparent lack of examples in the engineering of the 5' packaging sequence may be due to its complex structure and the dense information encoded therein that is essential for many aspects of HIV-1 replication: transcription, splicing balance, translation of GagPol, genome dimerization, assembly, reverse transcription, and integration. Within this complex region, the major splicing donor (MSD) is embedded in the stem-loop 2 (SL2) region between SL1 (dimerization loop) and SL3 (binding to Gag). It is thought that in the lentiviral vector genome, the RRE sequence (and the associated splice acceptor 7 (sa7) within the envelope region) is relocated immediately downstream of the packaging region, thereby "providing" the MSD for the splice acceptor (sa7) in the absence of rev. It is hypothesized that during lentiviral vector production, the supply of rev causes rev to bind to the RRE and inhibit splicing of sa7 by the MSD, thereby generating unspliced ​​full-length lentiviral vector genome vRNA ( Figure 7 A). However, the inventors ( Fig. 9 Bii and others (e.g., Cui et al. (1999), J. Virol., 73:6171-6176) have suggested that aberrant splicing from the MSD to splice acceptor sites within the transgene sequence may be substantial, thereby generating relatively adequate levels of unspliced ​​vRNA (relative to the total amount—see Figure 7 B), in some cases less than 5%.

[0707] Low efficiency in producing vRNA for packaging is not always directly observed in the titers of lentiviral vectors produced in transient transfection methods due to the large amount of vector genome plasmid delivered to the cells; titers of standard 3rd generation vectors can often be higher than 1x10 7 TU / mL, even if this type of aberrant splicing occurs. However, the inventors anticipate that in order to develop stable producer cell lines, in which the number of integrated vector genome cassettes that may be present is much smaller, the problem of aberrant splicing may actually be more severe. In fact, the inventors often found that genomic components were limited in stable producer clones, and hypothesized that MSD activity may contribute significantly to this limitation.

[0708] There is another, perhaps less obvious consequence of the generation of aberrantly spliced ​​mRNA generated by MSD into the transgene cassette: (increased) expression of the transgene cassette during production. Previously, the TRIP system was developed to repress transgene expression during lentiviral vector production (described in WO 2015 / 092440), which allows the recovery of vector titers in proportion to the negative impact of a particular transgene protein on vector production. The inventors have found that potent aberrant splicing (e.g. in a standard lentiviral vector containing an EF1a driver cassette, see Fig. 9 ) produces mRNA that usually encodes the transgene. Without wishing to be bound by theory, for the EF1a-driven cassette, MSD splices the strong EF1a splice acceptor, but for other promoter-UTR sequences, MSD "selects" the weaker cryptic splice acceptor, even in the presence of rev. MSD seems to "jump over" the RRE-sa7 sequence and favors other more central sites of the vector genome (i.e., in the transgene promoter region). This may be a "residual" property of the 5' packaging region of HIV-1, because in wild-type HIV-1, MSD usually splices splice acceptors located in the center and 3' end of the genome. MSD may be abnormally spliced ​​at many positions downstream of the vector sequence, but only mRNAs (i.e., they seem to be reasonable mRNAs because they encode proteins [transgenic proteins]) that are transported to the cytoplasm (and / or stabilized in the cytoplasm) through nonsense-mediated decay rules and then translated in the cytoplasm. In order to maintain the repression of mRNA encoding the transgene, an additional burden is placed on the TRIP system, resulting in weaker repressive control of a larger mRNA pool. Furthermore, the use of tissue-specific promoters (partly to avoid transgene expression during lentiviral vector production) may be "perturbed" by the cytoplasmic appearance of the translatable mRNA encoding the transgene brought about by this aberrant splicing mechanism. Essentially, transgene expression will be driven by the (usually strong) constitutive promoter driving expression of the vector genome vRNA.

[0709] Thus, there are many reasons to generate lentiviral vectors with mutations in the MSD, and indeed, others have attempted to do so in U3 / tat-independent lentiviral vectors without success. The present inventors have discovered that mutations in the MSD in HIV-1 activate an adjacent cryptic splice donor site within SL2, resulting in significant levels of splicing. To this end, the present inventors employed mutations in both the MSD and the nearby cryptic splice donor (crSD) (see Fig.15 ), and this modification is referred to as "MSD-2KO" or "MSD2KO" or "functional modification of MSD". Fig. 9As shown, this double mutation is extremely effective in eliminating the aberrant splicing of the splicing region of SL2 (including MSD and CrSD) to the strong EF1a splicing acceptor during lentiviral vector production. The figure also shows that the MSD-2KO lentiviral vector genome containing three different promoter-GFP transgene cassettes resulted in reduced vector titer ( Figure 8 ), which is similar to what others have reported. Fig. 9 In Bi, it was also demonstrated that providing HIV-1tat in trans was able to rescue the observed reduction in titer of MSD-2KO lentiviral vector genomes, despite the increased amounts of “abnormal” splicing products (derived from a minor cryptic splice donor in SL4) ( Fig. 9 Importantly, the figure shows that modified U1 snRNA redirected to different regions of the vector packaging signal increased the MSD-2KO lentiviral vector genome titer without increasing minor splicing products ( Fig. 9 and 10 ).

[0710] Example 7 - The increase in the titer of the MSD-2KO lentiviral vector is not due to the suppression of the 5' polyA site within the vector genome cassette

[0711] To evaluate whether the present invention plays a role in inhibiting the 5'polyA site, a functional mutation of the 5'polyA site was introduced into the genome of the MSD-2KO lentiviral vector containing the EF1a or CMV-driven GFP transgenic cassette ( Fig.11 ); the pAm1polyA mutation is described in Figure 2 (For clarity, shown again in Fig.11 A), which shows complete ablation of polyadenylation activity. Surprisingly, the inventors found that mutation of the 5'polyA signal only partially increased the titer of the MSD-2KO lentiviral vector genome containing EF1a-GFP, while having almost no effect on the CMV-GFP MSD2KO lentiviral vector genome, which seems to be commensurate with the degree of attenuation effect of the MSD-2KO mutation (which is less pronounced for the genome containing EF1a). Importantly, the supply of 305U1 molecules in this experiment increased the titer of both the standard lentiviral vector genome (in which endogenous U1snRNA may be able to completely suppress any residual 5'polyA activity) and the MSD2KO / pAm1 lentiviral vector genome, the latter of which is unlikely to have 5'polyA activity. This provides convincing evidence that the modified U1 snRNA provided to restore the titer of the MSD mutant lentiviral vector acts at a post-transcriptional step, which has not been previously reported.

[0712] The inventors subsequently sought to mutate the 70K and U1A binding loops of 305U1 and 256U1 to assess whether these mutations affected the observed increase in titer of the MSD2KO lentiviral vector genome. Fig.12 showed that functional mutations in SL1 or SL2 in the modified U1 snRNA had no effect on the ability of these molecules to enhance MSD-2KO lentiviral titers when co-expressed during production; only Sm protein binding mutations prevented this activity. This suggests that the previously essential 70K binding properties of the redirected U1 snRNA are not essential in the present invention in inhibiting polyA activity and provides further evidence that the modified U1 snRNA used to increase the titers of MSD-mutated lentiviral vectors is acting through a novel mechanism.

[0713] To assess whether the titer increase mediated by modified U1 snRNA differs in its “preferred” target site when applied to MSD-2KO lentiviral vectors compared to standard lentiviral vectors (see Figure 4 and 5 ), a panel of modified U1 snRNAs targeting different sites along the 5' region of the MSD-2KO lentiviral vector genome (see Table I) were screened. Fig.14 ). This screen indicated that targeting the packaging region was preferred (SL1-3), with a possible "hotspot" within SL3. The screen was performed with modified U1 snRNAs that had 15 nucleotides complementary to the target site (or 9 nucleotides as described), and as we have previously demonstrated for standard lentiviral vectors, the increase in titer may be more pronounced when using complementary lengths greater than 9 nucleotides (see Figure 4 ). In fact, we performed another experiment to show that for the MSD-2KO lentiviral vector, the titer enhancement observed with the modified U1 snRNA (targeting the "305" sequence) was only observed at 7 nucleotides of complementarity, but in preferred use, using 10 to 15 nucleotides of complementarity was better, as the titer enhancement increased ( Fig.13 ), and also because this would minimize any possible "off-target" effects of the modified U1 snRNA.

[0714] Example 8 - The improvement of MSD-2KO lentiviral vector titer by modified U1 snRNA is independent of the type of splicing donor mutation

[0715] Fig.15A shows genetic modification of the SL2 loop of the “MSD2KO” variant of the packaging region of the MSD-mutated lentiviral vector genome, which mutates both the MSD and the downstream cryptic splice donor (the MSD2KO variant has been used in many non-limiting examples herein). To assess whether the titer-enhancing effect of using modified U1 snRNA is in any way dependent on the specific changes made to the MSD2KO variant, we generated three additional splice donor region mutants: [1] “MSD2KOv2”, which also introduced two specific changes within the MSD and cryptic donor sequences; [2] “MSD-2KOm5”, which replaced the entire SL2 loop with an artificial stem-loop; and [3] a complete SL2 deletion, thereby removing the entire splice donor region (also called the splice region). We then produced standard or MSD-mutated lentiviral vector variants (containing an EFS-GFP expression cassette) in HEK293T cells + / - modified U1 snRNA (256U1) and titrated the vector supernatant ( Fig.15 B). The results show that all four MSD-mutated lentiviral vector variants were attenuated compared to the standard vector, but all four MSD-mutated lentiviral vectors could be boosted by using modified U1 snRNA provided during lentiviral vector production, indicating that there is no specific sequence dependency for splice donor region mutations by modified U1 snRNA. Interestingly, the MSD-2KOm5 variant was the least attenuated and had the greatest increase in output titer when produced in the presence of the 256U1 molecule, independent of the identity of the internal promoter employed (EFS, EF1a, CMV and human PGK promoters were compared).

[0716] Example 9 - In the lentiviral vector genome plasmid DNA backbone Cis Use of the encoded modified U1 snRNA cassette.

[0717] Previous examples herein have disclosed the use of modified U1 snRNA molecules in trans during lentiviral vector production in HEK293T cells transiently co-transfected with lentiviral vector component plasmids and modified U1 snRNA encoding plasmids. To evaluate whether the MSD-mutated lentiviral vector genome cassette and the modified U1 snRNA cassette could be properly encoded within the same plasmid DNA molecule, three variant constructs ( Fig.16A). The MSD-mutated lentiviral genome cassette (MSD-2KO variant) was modified such that the 256U1 expression cassette was inserted in three different configurations relative to the lentiviral genome cassette and / or functional plasmid backbone sequence. These "cis" version plasmids were used to make MSD-mutated lentiviral vectors in HEK293T cells and compared to a "trans" format, in which the modified U1 snRNA plasmid was co-transfected with the unmodified MSD-mutated lentiviral genome ( Fig.16 B) The results show that the titers of these “cis” versions of the plasmids are similar to the unmodified MSD mutant lentiviral vector genome +256U1 provided in co-transfections.

[0718] Example 10 - Improving the production of standard lentiviral vectors or MSD-2KO lentiviral vectors using cell lines stably expressing modified U1 snRNA

[0719] The 305U1 expression cassette was stably integrated into HEK293T cells, and standard lentiviral vectors or MSD-2KO lentiviral vectors were produced by transient transfection + / - additional 305U1 plasmid DNA. The successful generation of stable cells revealed for the first time that modified U1 snRNA can be endogenously expressed in cells without cytotoxic effects, indicating that the modified U1 snRNA does not titrate-out cellular factors involved in U1 snRNA synthesis or spliceosome, or that no off-target occurs or that off-target effects do not affect normal cell activity. The output titers of the lentiviral vectors indicate that for both standard lentiviral vectors and MSD-2KO lentiviral vectors, titer increases mediated by modified U1 snRNA are possible under a stable supply of modified U1 snRNA ( Fig.18 ). This will allow the modified U1 snRNA to be easily integrated into lentiviral packaging and producer cell lines.

[0720] Example 11 - Additional Examples of Improving the Titer of Standard Lentiviral Vectors Encoding Therapeutic Transgene Cassettes Using Modified U1 snRNA

[0721] We produced standard lentiviral vectors in serum-free, suspension HEK293T cells at + / -256U1 encoding wild-type or codon-optimized human α1-antitrypsin (fused to a T2A-GFP reporter gene) or chimeric antigen receptor (for 5T4) driven by an EF1a promoter cassette. These vectors were titrated by integration assays or by flow cytometry to assess GFP expression in target cells ( Fig.17 ). These data indicate that 256U1 increased the titer of all vectors tested.

[0722] Example 12 - MSD mutant lentiviral vector produces less transgenic protein during production

[0723] Another advantage of removing aberrant splicing during lentiviral vector production is that it reduces the amount of transgene-encoding mRNA that results in transgene protein production. Transgene expression can significantly affect lentiviral vector production, which led us to previously develop the TRiP system to inhibit transgene translation during viral vector production (described in WO 2015 / 092440). Briefly, the bacterial protein "TRAP" is co-expressed during vector production and binds to the "TRAP binding sequence" (tbs) upstream of the transgene ORF inserted within the 5'UTR, thereby blocking ribosomal scanning.

[0724] In the course of this work, we unexpectedly discovered that the "external" (CMV) promoter driving the vector genome cassette efficiently produced mRNA encoding the transgene due to splicing from the major donor splice region of SL2 to an internal splice acceptor site. The extent to which this occurred depended on the internal sequence between the cppt and the transgene ORF (i.e., the promoter-5'UTR sequence). Use of the EF1a promoter (which contains a very strong splice acceptor) in the transgene cassette resulted in aberrant splicing from the MSD in more than 95% of the total transcripts from the external promoter (see Figure 7 ). By comparing total GFP expression in standard or MSD-2KO lentiviral production cultures ( Fig.19 ), we showed that up to 80% of the transgenic protein expressed during production is derived from aberrantly spliced ​​products. We found that combining the MSD-2KO genotype with the TRiP system enhanced the reduction in transgenic protein produced.

[0725] Example 13

[0726] Co-expression of modified U1 snRNA targeting lentiviral vector vRNA resulted in an increase in vRNA in vector particle samples.

[0727] Experiments were performed in an adherent HEK293T vector production environment. Standard lentiviral vectors encoding a chimeric antigen receptor for GFP (pHIV-EF1a-GFP) or CD19 (pHIV-EF1a-CD19) were produced in the presence or absence of a modified U1 snRNA that targets either a site within the packaging region of the lentiviral vector (256U1 or 305U1) or a LacZ control (LacZU1). The modified U1 snRNAs were named according to the first nucleotide of the targeted sequence site within the packaging region of the lentiviral vector (see Table I). The modified U1 snRNA expression constructs were provided at two different doses: 1x and 4x. Prior to extracting total RNA from the vector particles, the vector supernatant was treated with DNAase / RNAse and RT-qPCR was then performed against the packaging region (Psi) of the vRNA to quantify the total vRNA copy number present ( Fig. 20 ). The data indicate that co-expression of modified U1sRNA leads to an increase in vRNA within vector particles.

[0728] Embodiment 14

[0729] Coexpression of modified U1 snRNA targeting lentiviral vector vRNA can lead to reduced transgene expression during vector production. Experiments were performed in a suspension, serum-adapted HEK293T vector production environment. During evaluation of modified U1 snRNA-enhanced HIV-1-based lentiviral vector production encoding the α1-antitrypsin (α1AT) transgene fused to GFP ( Fig.21 and 22), a relative increase in LV titer was observed in vectors pseudotyped with the Sendai envelope (F / HN) (approximately 20-fold) greater than that observed with vectors pseudotyped with VSVG (approximately 3-fold). Vectors were produced in suspended HEK293T cells (and adherent HEK293T cells as shown) and then titrated in adherent HEK293T cells by integration assays and flow cytometry. Immunoblotting of cell lysates after production for transgene proteins (and GFP) as well as β-actin revealed a modest but sustained inhibition of transgene expression when 256U1 was provided in trans. Since the Sendai F protein requires trypsin activation prior to transduction, this result suggests that the presence of α1AT in the harvest material inhibits trypsin activation of the F protein. Thus, the apparent inhibition of α1AT expression in cells transfected with p256U1 provides an additional boost in active vector titer. Without wishing to be bound by theory, this result is consistent with the mechanism of action of 256U1, whereby vRNA is not only stable (potentially avoiding nuclear degradation) but also escapes translation, which would otherwise lead to the production of transgenic proteins. In fact, it has recently been reported that non-translated, full-length unspliced ​​wild-type HIV-1 pools are actively packaged into viral particles (Chen et al. (2020), PNAS; 117(11): 6145-6155). In this particular case, these two surprising effects of 256U1 are cumulative, resulting in a 10-fold increase in vector output / activity. For other therapeutic vector genomes, where transgene expression may be detrimental to output vector titers, this modest effect of reducing transgene expression by modified U1 snRNA may have a similar effect of promoting titer increases.

[0730] Embodiment 15

[0731] Modified U1 snRNA was used to increase the titer of lentiviral vectors containing transgene cassettes in reverse.

[0732] In some cases, it is necessary to use a lentiviral vector genome in which the transgene cassette is in reverse orientation, i.e., the transcription unit is opposite to the promoter driving the vector genome cassette. For example, most lentiviral vectors developed for the treatment of sickle cell disease or β-thalassemia contain the β-globin gene, in which an intron is encoded along with three exons (this is because external splicing of introns in terminally differentiated erythrocytes is required for efficient expression of β-globin). In most cases, introns can be retained in the packaged lentiviral vector vRNA containing the rev response element (RRE), because rev binds to the RRE in the nucleus resulting in the export of vRNA containing introns; however, this is not the case with the β-globin gene, and when the transgene cassette is in the "forward" orientation, these vRNAs lose introns even in the presence of rev / RRE. In addition, there may be situations where one component of the transgene cassette may be in reverse orientation and another in forward orientation, such as using a bidirectional transgene cassette or multiple separate cassettes.

[0733] To evaluate whether the use of modified U1 snRNAs could increase the expression of lentiviral vectors containing the transgene cassette in reverse orientation, lentiviral vectors containing the β-globin gene were produced in suspension (serum-free) HEK293T cells in the absence or presence of four different modified U1 snRNAs targeting the packaging region ( Fig.23 ). The experiments were performed in a suspension, serum-free HEK293T vector production environment. The data showed that modified U1snRNA can also enhance the titer of this type of lentiviral vector.

[0734] Example 16

[0735] The enhancement of lentiviral vector titer by modified U1 snRNA was measurable in concentrated vector preparations. Experiments were performed in a suspension, serum-free adapted HEK293T vector production environment. Lentiviral vectors encoding the firefly luciferase-GFP dual reporter transgene cassette were produced in suspension (serum-free) HEK293T cells in the absence or presence of 256U1. The clarified vector harvest was concentrated by centrifugation (approximately 20-fold concentration factor) and then the vector samples before and after concentration were titrated by transduction of adherent HEK293T cells followed by flow cytometry ( Fig.24 ). The data demonstrate that the titer increase caused by the modified U1 snRNA was observed in processed LV material, further demonstrating that the increase in vector titer is not an artifact associated with the crude vector material.

[0736] Embodiment 17

[0737] A highly sensitive method for the quantitative detection of modified U1 snRNA was developed to measure the amount of modified U1 snRNA remaining in lysates and carrier materials from post-production cells. After the precursor snRNA (pre-snRNA) is processed in the cytoplasm, it is transported back to the nucleus as part of the spliceosome, a key complex involved in pre-mRNA splicing. Therefore, the modified U1 snRNAs described herein are expected to be primarily localized in a nuclear location, and their potential for incorporation into viral particles is expected to be very low. In fact, others have shown that processed U1 snRNA is not actively packaged into HIV-1 virions and that the presence of pre-U1 snRNA is 100-fold lower than that of the most abundant cellular RNA detected in viral particles, such as 7SL (Eckwahl et al (2016); RNA, 22(8):1228–1238).

[0738] However, to be able to assess the expression of modified U1 snRNA in cells and to detect / quantify residual RNA derived from modified U1 snRNA in vector products, a Taqman-based RT-qPCR assay was developed ( Fig.25 To distinguish modified U1 snRNA from highly expressed endogenous U1 snRNA, the amplicon was designed such that the forward primer was homologous to the vRNA targeting sequence at the 5' end of the modified U1 snRNA molecule (see Fig.25 A). Thus, while the reverse primer will enable cDNA synthesis of both endogenous and modified U1 snRNA, the quantitative PCR step will only be performed from cDNA derived from the modified U1 snRNA. In this non-limiting example, an 88 bp amplicon was designed to amplify the 256U1 snRNA. To assess the sensitivity of the primer / probe set, suspension (serum-free) HEK293T cells were transfected with p256U1 and total RNA was extracted and purified from replicate cultures treated with Benzonase (to degrade residual p256U1 DNA). Taqman qPCR was performed on the purified total RNA + / - the reverse transcriptase step to assess the signal from undigested p256U1 DNA (see Fig.25 B). The p256U1 plasmid was used as a standard curve for the qPCR step and showed very good linearity and range. Diluted cDNA samples from untransfected cell RNA and p256U1 transfected cell RNA (+RT treatment) produced Ct values ​​that differed by 19 to 20 cycles, with the Ct value for -RT-treated p256U1 transfected cell RNA only about 2-fold lower than that for untransfected cell RNA. This indicates that the RT-qPCR assay is able to clearly detect and quantify modified U1 snRNA but not endogenous U1 snRNA.

[0739] Embodiment 18

[0740] Modified U1 snRNA dose response and use of multivariate modeling to optimize modified U1 snRNA plasmid and LV component plasmid ratios for maximal transient transfection of suspension (serum-free) HEK293T cells.

[0741] To evaluate the relationship between input of modified U1 snRNA plasmids, resulting modified U1 snRNA expression, and the effects on vector genomic RNA (vRNA) and output vector titers during transient transfection, a simple dose-response study was performed. LV encoding the EF1a promoter-driven CAR-CD19 expression cassette were produced in suspension (serum-free) HEK293T cells by transient transfection of LV component pDNAs, with input amounts of p256U1 set over a range of 0 to 600 ng / mL (effective final culture concentration at transfection). All LV pDNA ratios / amounts were kept constant, while total pDNA was kept constant by filling with pBlueScript. Post-treatment cells were analyzed by extracting total RNA and quantifying 256U1 snRNA and vRNA as well as endogenous transcripts (RPH1; data not shown) to normalize total RNA in the cDNA step ( Fig.26 A). In addition, clarified LV supernatant was titrated by integration assay ( Fig.26 B). The data show that there is a linear correlation (increased in a linear manner) between the input p256U1 amount, the expression level of 256U1 snRNA and the steady-state level of vRNA. The output titer of LV-CARCD19 is also linearly related to the input p256U1 amount (and the increase of vRNA in the production cell) until the input level is 300ng / mL, when the titer increases the most. This shows that the minimum input level of p256U1 for achieving the maximum titer increase (under these conditions and for the LV genome) is between 150ng / mL and 300ng / mL.

[0742] A design of experiments (DoE) was used to generate and test 28 conditions at 40 mL shake flask scale, in which p256U1, pGenome (in this case pHIV-EF1a-5T4CAR), and pVSVG were varied, and pGagPol / pRev input levels were kept constant ( Fig. 27). The clarified vector harvest was titrated by transduction of adherent HEK293T cells followed by immunoflow cytometry using a MAb against 5T4CAR. The optimal input of 180 ng / mL p256U1 determined by the DoE was then used to generate further HIV-EF1a-5T4CAR vector preparations, resulting in an average increase in LV output titer of approximately 10-fold compared to the absence of p256U1. The 180 ng / mL input of p256U1 is very consistent with the results of the dose-response experiment (see Fig.26 ).

[0743] Embodiment 19

[0744] Case study: generation and evaluation of CAR-T cells using concentrated / purified lentiviral vector preparations produced with or without 256U1. To evaluate the impact of the application of modified U1 snRNA on lentiviral gene therapy products, a small case study was performed in which a lentiviral vector encoding a chimeric antigen receptor targeting 5T4 (HIV-EF1a-5TACAR / 'LV-CAR') [1] was produced and purified with or without 256U1 ( Fig.28 ), [2] Quantify the amount of residual 256U1 snRNA in the concentrated product ( Fig.29 ), [3] a comparative protein analysis of two concentrated vector preparations ( Fig.30 and Table IV), [4] primary T cells expanded from PBMCs of three healthy donors were transduced and evaluated for their cytotoxic activity against 5T4-positive cells ( Figures 31 to 33 ), and [5] evaluating residual 256U1 and vRNA in CAR-T expansion cultures by RT-qPCR ( Fig.34 ).

[0745] Two concentrated HIV-EF1a-5TACAR vector preparations were produced at a 250 mL shake flask scale in suspended (serum-free) HEK293T cell cultures, with p256U1 plasmid DNA (+256U1) added or pBluescript used as a negative control. The clarified harvest (not treated with Benzonase) was then subjected to ion exchange chromatography to a concentration factor of about 125 times, followed by nuclease treatment. Finally, the vector preparation was centrifuged for about 45 minutes and then resuspended in TSSM to a total concentration of 250 times. The clarified harvest and concentrated vector samples ( Fig.28 ). These data confirm the titer increase mediated by the use of 256U1 snRNA.

[0746] Total RNA extraction was then performed on the vector samples during the concentration process, and the clarified harvest samples were treated with + / -Benzonase before extraction. vRNA and residual 256U1 snRNA were then quantified by RT-qPCR (for development of the 256U1 RT-qPCR assay, see Example 17). Fig.29 This data is presented, showing [1] the increase in vRNA in all vector samples from vector prepared in the presence of 256U1, [2] the effect of nuclease treatment on vRNA abundance compared to 256U1 snRNA, and [3] the relative ratio of 256U1 snRNA signal compared to vRNA within concentrated vector. This analysis suggests that the 256U1 snRNA signal present in clarified LV harvests is primarily "free" RNA, which likely originates from leaky / burst cells during production, as Benzonase treatment significantly reduced this detection. In concentrated LV material, the ratio of 256U1:vRNA signal was 1:32, indicating that for every 16 LV particles containing vRNA, there was a single 256U1 snRNA (or at least an 88 bp amplicon). This suggests that 256U1 snRNA is not actively packaged into LV particles and that the signal detected in concentrated LV material is likely due to residual 256U1 snRNA present outside of the particles. This also suggests that it may be possible to further reduce the 256U1 snRNA signal by optimizing the nuclease treatment and LV polishing steps.

[0747] The two concentrated LV-CAR vector preparations were then analyzed by mass spectrometry to assess any major effects of 256U1 snRNA expression during LV-CAR production on viral particle protein signature. Samples were prepared as described herein (see “ General molecular / cellular biology techniques and assays ” section) and in conjunction with Q Exactive TM Peptides were analyzed on an UltiMate 3000 coupled online to a HF mass spectrometer. Mass spectra were analyzed in DIA-NN (version 1.7). Protein sequences of the human uniprot reference proteome were concatenated with lentiviral proteins (gag, pol, rev) and VSV-G glycoprotein, as well as common contaminants, to generate a predicted spectral library for this project. The top 400 proteins detected in the LV-CAR[+256U1] vector sample were ranked and their relative abundance was plotted as a percentage of the total spectral abundance of the top 400 proteins ( Fig.17 , solid black circles). The relative abundance of the same protein hits in the LV-CAR vector samples was also plotted to assess whether any major differences in the protein profiles of the two vector preparations could be visualized ( Fig.17, open circles). These data confirm the presence of the expected lentiviral proteins gag (rank #1), VSV-G (rank #2), and pol (rank #37), with rev appearing at rank #400. Comparison of the distribution of the ratio of gag to pol peptides showed very similar ratios for both samples, approximately 16:1, close to the recognized differential translation ratio of gag / pol mRNA (in wild-type HIV-1) of 20:1 (gag polyprotein is the major product of translation, but approximately 1 in 20 times, frameshift events lead to translation of gagpol polyprotein). Also present are cellular proteins known to be incorporated into HIV-1-based lentiviral particles: basic immunoglobulins (rank #3), HSPc-71K (rank #5), and cyclophilin A (rank #22; specifically binds to the capsid). The analysis showed minimal differences between the two LV-CAR vectors, thereby indicating that overexpression of 256U1 snRNA during LV production does not result in any significant up / down regulation and / or incorporation of cellular proteins into LV viral particles.

[0748] Differential expression analysis of hits that differed significantly up to 2-fold between the two LV samples was performed in R using the BioConductor DEP package. Table IV shows the main hits selected from this analysis. This statistical analysis showed that the 2-fold increase in gag, pol, VSVG, and cyclophilin A was highly significant, indicating that these LV proteins were more abundant in the LV-CAR[+256U1] vector relative to other background (possible contamination) proteins.

[0749] Table IV: Proteins selected in the statistical analysis for hits with differences up to 2-fold in the comparative protein analysis of HIV-EF1a-5T4CAR (LV-CAR) concentrated / purified preparations produced at + / -256U. Differential expression analysis was performed in R using the BioConductor DEP package. Proteins with missing values ​​were initially filtered so that at least one condition was quantified for all replicates. Variance stabilization normalization was performed using the BioConductor VSN package. Missing values ​​were then imputed using quantile regression interpolation for left-censored data (QRILC). Differential expression analysis was performed using a protein linear model with empirical Bayesian statistics. P values ​​were adjusted for multiple testing using the Benjamini&Hochberg method. The ranking numbers are the top 400 proteins detected in the LV-CAR [+256U1] sample.

[0750]

[0751] Two concentrated HIV-EF1a-5TACAR / LV-CAR vector preparations were used to transduce peripheral blood mononuclear cells (PBMCs) from three healthy donors at an MOI of 1.25 (two vector preparations) or an MOI of 0.3 (HIV-EF1a-5TACAR+256U1 alone), and the transduced T cells were then expanded and stored on day 13. The cells were then revived and expanded for another 5 to 6 days. The total viable cells and the percentage of transduction of LV-CAR or LV-CAR[+256U1] vectors were monitored during expansion and after resuscitation ( Fig.31 ). This analysis showed that the LV-CAR[+256U1] vector generally transduced expanded T cells more efficiently than the LV-CAR vector, despite the use of a matched MOI of 1.25 for both LV preparations (this may be due to fewer contaminants in the LV CAR[+256U1] vector, see Fig.30 and Table IV). The percentage of transduction using the LV-CAR[+256U1] vector at an MOI of 0.3 was similar to that using the LV-CAR vector (MOI 1.25), so further comparisons were focused on these samples.

[0752] Then, the cells were co-cultured with an equal number of 5T4-positive cells (THP-1, Kasumi-1, SKOV-3) or 5T4-negative cells (AML-193), and cytokine release was analyzed 24 h after incubation ( Fig.32 ) and cell killing after 40 hours of incubation ( Fig.33 ), thereby evaluating the target cell killing activity of T cells expressing 5T4CAR. These results show that in the presence of 5T4-positive cells, CAR-T cells transduced with either of the two vector preparations can also be specifically activated by releasing granzyme-B and interferon-γ, thereby producing specific cell killing.

[0753] On days 8 and 13 post-transduction, cell samples were harvested and total RNA was extracted to assess the relative abundance of any remaining 256U1 snRNA compared to RPH1 mRNA, which was used as a cellular transcript loading control. Fig.34These data are presented, indicating that the residual 256U1 snRNA signal was 4 to 5 logs lower and the residual vRNA was 3 to 3.5 logs lower relative to the RPH1 transcript at each time point. The reduction in the residual 256U1 snRNA signal between days 8 and 13 was approximately 5-fold greater than that of vRNA, indicating that a large portion of the residual 256U1 snRNA was exposed (degraded) compared to vRNA (apparently protected within the capsid), which may reflect the low number of intact LV virus particles associated with T cells during amplification. In summary, the residual RNA analysis indicates that while modified U1 snRNA can be detected in low levels of processed LV material (1 per 16 intact virus particles at this research-grade production scale), at least 80% of this signal is likely present on the exterior of the virus particles. This means that this carryover may be further reduced by optimizing the nuclease treatment and purification steps.

[0754] Given that constitutive, long-term expression of modified U1 snRNA within the HEK293T cell line is possible without significant general cytotoxicity (see Example 21), delivery of full-length modified U1 snRNA to a small fraction of target cells during LV transduction will likely have no effect on target cell activity. Due to the design of the modified U1 snRNA, no specific interactions with host cell RNA are thought to be likely, and its relative abundance in target cells compared to the vast endogenous U1 snRNA pool means that it is highly unlikely to effectively compete with the association of RNP factors.

[0755] Embodiment 20

[0756] Modified U1 snRNA was used to increase LV production in suspension (serum-free) packaging cells. HIV-EF1a-CAR-CD19 vectors or GFP reporter variant vectors (HIV-EF1a-CAR-CD19-T2A-GFP) were produced in lentiviral vector packaging cell lines (PACs) in shake flasks or 250 mL bioreactors (AMBR250) in the presence or absence of p256U1. HEK293T cells transfected in parallel with all vector components were used as controls. The clarified vector harvest was titrated by transducing adherent HEK293T and then performing an integration assay; titers were plotted relative to "no 256U1" ( Fig.35 ). The data showed that the PAC cell line had the greatest increase in vector titer compared to HEK293T cells.

[0757] Embodiment 21

[0758] Suspension (serum-free) HEK293T cells were stably transfected with the 256U1 expression cassette to increase lentiviral vector titer. Suspension (serum-free) HEK293T cells were stably transfected with the 256U1-HygR expression cassette and clones were selected; clone 256U1c39 was selected for evaluation. Lentiviral vector titer increase was evaluated at 1, 5, and 10 weeks after isolation, and continued growth in + / - Hygromycin-B, and HIV-EF1a-5T4CAR vector was produced by transient transfection in the presence of + / - p256U1, and compared to parental HEK293T cells at each time point ( Fig.36 ). The data showed that 256U1 snRNA expression within the 256U1c39 clone was stable with or without hygromycin selection, indicating that long-term expression of these modified U1 snRNAs was not toxic to HEK293T cells. In addition, the level of vector titer increase in the 256U1c39 cell line was close to the maximum titer increase observed under all conditions.

[0759] Embodiment 22

[0760] The enhanced effect of modified U1 snRNA on lentiviral vectors appears to be independent of the conserved 5' dinucleotide "AU" present in endogenous U1 snRNA.

[0761] In Example 1 it was demonstrated that the mechanism of action of the modified U1 snRNA is not due to polyA suppression of the 5' polyA signal within the 5' LTR region of the lentiviral vector (a known property of endogenous U1 snRNA), since the modified U1 snRNA was still able to increase the titer of LV containing a functional mutation of this polyA site.

[0762] Others have characterized an aspect of U1 snRNA biology that appears to be important for its role in splicing (Yeh et al (2017) Nucleic Acids Res. 45(16):9679–9693). Endogenous U1 snRNA recruits the CAP binding complex (CBC) to its 5' end, which is important for the function of U1 snRNP in splicing; the authors found that the "AU" dinucleotide provides the best binding to the CBC compared to other dinucleotides and provide a strong reason why the "AU" dinucleotide is so widely conserved among eukaryotes.

[0763] To assess the importance of the conserved "AU" dinucleotide sequence in the context of modified U1 snRNAs targeting the lentiviral vector genome packaging signal, a number of variants based on the 256 U1 snRNA were generated (Table V).

[0764] Table V: Variant modified U1 snRNAs targeting HIV-1 LV vRNA genomic position 256 were generated to evaluate the effect of 5' terminal dinucleotide changes on increased vector titer. The table shows the 15 nucleotide variant 256U1 target sequence and base pairing in the vRNA, as well as a comparison of the 13 nucleotide variant targeting sequences. The 256U1_13 variant was designed to maintain 13 consecutive base pairs with the target when possible so that the calculated T melting temperature (Tm℃) was approximately 46℃. The dinucleotides at the 5' end of the modified U1 snRNA molecule are marked, and the underlined nucleotides represent possible transcription start sites based on the findings of Yeh et al. (2017); variants marked with an asterisk indicate that the first of the two described dinucleotides may not be the first nucleotide of the modified snRNA. The transcription start site of the U1 promoter is also indicated, showing the possible -1) TSS (gray box "C") for variants with "aa" and "cc".

[0765]

[0766]

[0767] Yeh and colleagues (2017) also reported effects on the transcription start site and abundance of U1 snRNA when the first 1 to 2 nucleotides were altered. They found that purines were more favored for transcription initiation than pyrimidines, so that when a pyrimidine-purine or pyrimidine-pyrimidine dinucleotide was at positions 1 and 2, the pyrimidine was “skipped” in favor of the next purine. The exceptions to this general rule were “UU,” for which transcription initiation occurred 19 or 29 nucleotides downstream), or “AA” / “CC,” for which transcription initiation occurred at the -1 position (i.e., “C”). The “UU” variant was not in the panel of 256 U1 variants tested. For the panel of variants, the targeting sequence length was reduced from 15 to 13 nucleotides to enable testing of many different dinucleotide variants in which either or both nucleotides could not participate in base pairing with the target sequence, depending on the predicted transcription start site (according to Yeh et al. (2017)). The results showed that modified U1 snRNAs carrying targeting sequences ranging from 9 to 15 nucleotides were all able to mediate increased titers ( F...

Claims

1. A modified U1 snRNA, wherein the modified U1 snRNA is modified to bind to a nucleotide sequence within a packaging region of a lentiviral vector genome sequence, wherein the packaging region of the lentiviral vector genome sequence starts from the 5' U5 domain to the end of a sequence derived from a gag gene. 2 . The modified U1 snRNA according to claim 1 , wherein the modified U1 snRNA is modified to introduce a heterologous sequence complementary to the nucleotide sequence. 3 . The modified U1 snRNA according to claim 1 , wherein the modified U1 snRNA is modified at the 5′ end to introduce the heterologous sequence within nine nucleotides at positions 3 to 11. 4 . 4 . The modified U1 snRNA according to claim 1 , wherein the modified U1 snRNA is modified at the 5′ end to introduce the heterologous sequence within the natural splice donor annealing sequence. 5 . The modified U1 snRNA according to claim 4 , wherein 1 to 9 nucleic acids of the native splice donor annealing sequence are replaced by the heterologous sequence. 6 . The modified U1 snRNA according to any one of claims 1 to 5 , wherein the modified U1 snRNA is modified at the 5′ end to replace a sequence comprising a natural splice donor annealing sequence with a heterologous sequence complementary to the nucleotide sequence.

7. The modified U1 snRNA according to any one of claims 2 to 6, wherein the heterologous sequence comprises at least 9 nucleotides that are complementary to the nucleotide sequence.

8. The modified U1 snRNA according to any one of claims 2 to 7, wherein the heterologous sequence comprises 15 nucleotides that are complementary to the nucleotide sequence.

9. The modified U1 snRNA according to any one of the preceding claims, wherein the nucleotide sequence is located within the 5' U5 domain, the PBS element, the SL1 element, the SL2 element, the SL3ψ element, the SL4 element and / or a sequence derived from the gag gene.

10. The modified U1 snRNA according to any one of the preceding claims, wherein the nucleotide sequence is located within the SL1, SL2 and / or SL3ψ element.

11. The modified U1 snRNA according to any one of the preceding claims, wherein the nucleotide sequence is located within the SL1 and / or SL2 element.

12. The modified U1 snRNA according to any one of the preceding claims, wherein the nucleotide sequence is located within the SL1 element.

13. The modified U1 snRNA according to any one of the preceding claims, wherein the modified U1 snRNA is a modified U1A snRNA or a modified U1AsnRNA variant.

14. The modified U1 snRNA according to any one of the preceding claims, wherein the first two nucleotides at the 5' end of the modified U1 snRNA are not AU.

15. The modified U1 snRNA according to any one of the preceding claims, wherein the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV or Vesna lentivirus.

16. The modified U1 snRNA according to any one of the preceding claims, wherein the lentiviral vector is derived from HIV-1, HIV-2 or EIAV.

17. The modified U1 snRNA according to any one of claims 1 to 16, wherein the lentiviral vector is derived from SIV.

18. An expression cassette comprising a nucleotide sequence encoding the modified U1 snRNA according to any one of claims 1 to 17.

19. A cell for producing a lentiviral vector, comprising nucleotide sequences encoding vector components, and at least one nucleotide sequence encoding a modified U1 snRNA according to any one of claims 1 to 17, wherein the vector components include gag, env, rev and RNA genome of the lentiviral vector, wherein the cell is a non-regenerative cell.

20. A cell comprising the modified U1 snRNA according to any one of claims 1 to 17, wherein the cell is a non-regenerative cell.

21. The cell of claim 20, wherein the cell further comprises a nucleotide sequence encoding an RNA genome of a lentiviral vector.

22. The cell of claim 20 or claim 21, wherein the cell further comprises a nucleotide sequence encoding a nucleotide of interest.

23. The cell of claim 22, wherein the nucleotide of interest produces a therapeutic effect.

24. A cell according to claim 23, wherein the target nucleotide encodes an enzyme, a cofactor, a cytokine, a chemokine, a hormone, an antibody, an antioxidant molecule, an engineered immunoglobulin-like molecule, a single-chain antibody, a fusion protein, an immune co-stimulatory molecule, an immune modulatory molecule, a chimeric antigen receptor, a cross-domain negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a transcription factor, a structural protein, a reporter protein, a subcellular localization signal, a tumor suppressor protein, a growth factor, a membrane protein, a receptor, a vasoactive protein or peptide, an antiviral protein or ribozyme, or a derivative thereof, or a microRNA.

25. The cell of claim 24, wherein the nucleotide of interest encodes a molecule that can be used to treat a disease selected from the group consisting of: (i) Diseases that respond to: cytokine and cell proliferation / differentiation activity; immunosuppressive or immunostimulatory activity (e.g., for the treatment of immunodeficiencies including infection with human immunodeficiency virus; regulation of lymphocyte growth; treatment of cancer and many autoimmune diseases, and prevention of transplant rejection or induction of tumor immunity); regulation of hematopoiesis (e.g., treatment of bone marrow or lymphoid disorders); promotion of growth of bone, cartilage, tendon, ligament, and nerve tissue (e.g., for wound healing, treatment of burns, ulcers and periodontal disease, and neurodegeneration); inhibition or activation of follicle stimulating hormone (fertility); chemotactic / chemopromoting activity (e.g., for mobilizing specific cell types to sites of injury or infection); hemostatic and thrombolytic activity (e.g., for treating hemophilia and stroke); anti-inflammatory activity (e.g., for treating septic shock or Crohn's disease); macrophage inhibitory activity and / or T cell inhibitory activity, and the resulting anti-inflammatory activity; anti-immunological activity (i.e., inhibition of cellular and / or humoral immune responses, including responses not related to inflammation); inhibition of the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, and upregulated fas receptor expression in T cells; (ii) malignant diseases, including cancer; leukemia; benign and malignant tumor growth, invasion and spread, angiogenesis, metastasis; ascites and malignant pleural effusions; (iii) autoimmune diseases, including arthritis, including rheumatoid arthritis, allergies, allergies, asthma, systemic lupus erythematosus, collagen diseases and other diseases; (vi) vascular disease, including atherosclerosis, arteriosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vasculitic diseases, respiratory distress syndrome, cardiovascular effects, peripheral vascular disease, migraine and aspirin-dependent antithrombotic disease, stroke, cerebral ischemia, ischemic heart disease or other diseases; (v) diseases of the gastrointestinal tract, including peptic ulcer, ulcerative colitis, Crohn's disease and others; (vi) liver disease, including liver fibrosis and cirrhosis; (vii) inherited metabolic disorders, including phenylketonuria (PKU), Wilson's disease, organic acidemias, urea cycle disorders, cholestasis, and other diseases; (viii) renal and urinary diseases, including thyroiditis or other glandular diseases, glomerulonephritis or other diseases; (ix) ear, nose and throat diseases, including otitis or other ear, nose and throat diseases, dermatitis or other skin diseases; (x) dental and oral diseases, including periodontal disease, periodontitis, gingivitis or other dental / oral diseases; (xi) testicular disease, including orchitis or epididymo-orchitis, infertility, testicular trauma or other testicular disease; (xii) gynecological diseases, including placental dysfunction, placental insufficiency, recurrent miscarriage, eclampsia, preeclampsia, endometriosis and other gynecological diseases; (xiii) ophthalmic diseases, such as Leber congenital amaurosis (LCA) including LCA10, etc.; posterior uveitis; intermediate uveitis; anterior uveitis; conjunctivitis; chorioretinitis; uveoretinitis; optic neuritis; Glaucoma, including open-angle glaucoma and juvenile congenital glaucoma; Intraocular inflammation, such as retinitis or cystoid macular edema; Sympathetic ophthalmia; Scleritis; Retinitis pigmentosa; macular degeneration, including age-related macular degeneration (AMD) and juvenile macular degeneration, including Best's disease, Best's vitelliform macular degeneration, Stargardt's disease; Usher's syndrome; Dohn's honeycomb retinal dystrophy; Sorby's macular dystrophy; juvenile retinoschisis; cone-rod dystrophy; corneal dystrophy; Fuch dystrophy; Leber's congenital amaurosis; Leber's hereditary optic neuropathy (LHON); Ady syndrome; Oguchi's disease; degenerative fundus diseases; visual impairment; eye inflammation caused by infection; proliferative vitreoretinopathy; acute ischemic optic neuropathy; excessive scarring, such as after glaucoma filtering surgery, reactions to eye implants, corneal allograft transplant rejection; and other ophthalmic diseases, such as diabetic macular edema, retinal vein occlusion, RLBP1-related retinal dystrophy, choroideremia, and color blindness; (xiv) Neurological and neurodegenerative diseases, including Parkinson's disease, complications and / or side effects of treatment for Parkinson's disease, AIDS-related dementia complex, HIV-related encephalopathy, Devic's disease, Sydenham's chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, stroke, post-polio syndrome, psychiatric disorders, myelitis, encephalitis, subacute sclerosing panencephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Fabry disease, Gaucher disease, cystinosis, Pompe disease, metachromatic leukodystrophy, Wiscott's disease, Aldrich syndrome, adrenoleukodystrophy, beta-thalassemia, sickle cell disease, Guillain-Barré syndrome, Sydenham's chorea, myasthenia gravis, pseudotumor cerebrum, Down syndrome, Huntington's chorea, CNS compression or CNS trauma or infection of the CNS, muscular dystrophy and nutritional disorders, diseases, conditions or disorders of the central and peripheral nervous systems, motor neuron diseases including amyotrophic lateral sclerosis, spinal muscular atrophy, spinal cord and laceration injuries; and (xv) cystic fibrosis; mucopolysaccharidoses, including Sanfilipo syndrome A, Sanfilipo syndrome B, Sanfilipo syndrome C, Sanfilipo syndrome D, Hunter syndrome, Hurler-Scheie syndrome, and Morchau syndrome; ADA-SCID; X-linked SCID; X-linked chronic granulomatous disease; porphyria; hemophilia A; hemophilia B; post-traumatic inflammation, bleeding, coagulation, and acute phase response; cachexia; anorexia; acute infection; septic shock; infectious diseases; diabetes; complications or side effects of surgery; bone marrow transplantation or other transplant complications and / or side effects; complications and side effects of gene therapy, for example due to infection with viral vectors, or AIDS, to suppress or inhibit humoral and / or cellular immune responses, thereby preventing and / or treating transplant rejection in the case of transplantation of natural or artificial cells, tissues, and organs, such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.

26. A stable or transient producer cell for producing a lentiviral vector, comprising at least one nucleotide sequence encoding the modified U1 snRNA according to any one of claims 1 to 17, wherein the cell is a non-regenerative cell.

27. The cell of any one of claims 20 to 26, wherein the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV or Vesna lentivirus.

28. The cell of claim 27, wherein the lentiviral vector is derived from HIV-1, HIV-2, or EIAV.

29. The cell of claim 27, wherein the lentiviral vector is derived from SIV.

30. A method for producing a lentiviral vector, comprising the following steps: a. introducing into a cell a nucleotide sequence encoding vector components, and at least one nucleotide sequence encoding a modified U1 snRNA according to any one of claims 1 to 15, wherein the vector components include gag, env, rev and RNA genome of the lentiviral vector; b. optionally selecting a cell comprising the nucleotide sequence encoding the vector components and at least one modified U1 snRNA; c. Culturing cells under conditions where the vector components are co-expressed with the modified U1 snRNA and a lentiviral vector is produced.

31. A lentiviral vector produced by the method according to claim 30.

32. The lentiviral vector of claim 31, wherein the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV or Vesna lentivirus.

33. The lentiviral vector of claim 32, wherein the lentiviral vector is derived from HIV-1, HIV-2 or EIAV.

34. The lentiviral vector of claim 32, wherein the lentiviral vector is derived from SIV.

35. Use of the modified U1 snRNA according to any one of claims 1 to 17 or the expression cassette according to claim 18 for producing a lentiviral vector.

36. The use according to claim 35, wherein the lentiviral vector comprises an inactivated major splice donor site in the RNA genome of the lentiviral vector.

37. The use according to claim 35 or claim 36, wherein the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV or Vesna lentivirus.

38. The cell of any one of claims 19, 21 to 25 or 27 to 29, the stable or transient producer cell of any one of claims 26 to 29, or the method of claim 30, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated.

39. The cell according to claim 38, the stable or transient production cell, or the method, or the use according to claim 36 or claim 37, wherein the major splice donor site and the cryptic splice donor site 3' to the major splice donor site in the RNA genome of the lentiviral vector are inactivated.

40. The cell according to claim 38, the stable or transient producer cell, or the method, or the use according to claim 36 or claim 37, wherein the lentiviral vector is a third generation lentiviral vector.

41. The cell according to claim 38, the stable or transient production cell, or the method, or the use according to claim 36 or claim 37, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is for a tat-independent lentiviral vector.

42. The cell according to claim 38, the stable or transient producer cell, or the method, or the use according to claim 36 or claim 37, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' of the major splice donor site is inactivated, and wherein the nucleotide sequence is produced in the absence of tat.

43. The cell according to claim 38, the stable or transient producer cell, or the method, or the use according to claim 36 or claim 37, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' of the major splice donor site is inactivated, and wherein the nucleotide sequence is no longer tat-dependently transcribed.

44. The cell according to claim 38, the stable or transient production cell, or the method, or the use according to claim 36 or claim 37, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' to the major splice donor site is inactivated, wherein the nucleotide sequence is for a U3-independent lentiviral vector.

45. The cell according to claim 38, the stable or transient production cell, or the method, or the use according to claim 36 or claim 37, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' to the major splice donor site is inactivated, and wherein the nucleotide sequence is no longer transcribed by the U3 promoter.

46. ​​The cell according to claim 38, the stable or transient producer cell, or the method, or the use according to claim 36 or claim 37, wherein the major splice donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splice donor site 3' to the major splice donor site is inactivated, and wherein the nucleotide sequence has been transcribed by a heterologous promoter.

47. The cell, the stable or transient producer cell, the method or the use according to any one of claims 39 to 46, wherein the cryptic splice donor site is the first cryptic splice donor site located 3' to the major splice donor site.

48. The cell, stable or transient production cell, method or use according to any one of claims 39 to 47, wherein the cryptic splice donor site is within 6 nucleotides of the major splice donor site.

49. The cell according to any one of claims 38 to 48, the stable or transient production cell, or the method, or the use according to any one of claims 37 or 46 to 48, wherein the major splice donor site and the cryptic splice donor site are mutated or deleted.

50. The cell according to any one of claims 38 to 49, the stable or transient production cell, the method, or the use according to any one of claims 37 or 46 to 49, wherein the nucleotide sequence encoding the RNA genome of the lentiviral vector comprises a sequence as shown in any one of SEQ ID NOs: 1, 3, 4, 9, 10 and / or 13 before the splice site is inactivated.

51. The cell, stable or transient production cell, or method according to any one of claims 38 to 50, or the use according to any one of claims 37 or 46 to 50, wherein the nucleotide sequence of the RNA genome encoding the lentiviral vector comprises a sequence having a mutation or deletion relative to the sequence shown in any one of SEQ ID NOs: 1, 3, 4, 9, 10 and / or 13.

52. The cell, stable or transient producer cell, or method according to any one of claims 38 to 51, or the use according to any one of claims 37 or 46 to 51, wherein the nucleotide sequence of the RNA genome encoding the lentiviral vector comprises an inactivated major splice donor site which would otherwise have a cleavage site between the nucleotides corresponding to nucleotides 13 and 14 of SEQ ID NO:

1.

53. The cell according to any one of claims 38 to 52, the stable or transient production cell, the method, or the use according to any one of claims 37 or 39 to 45, wherein the nucleotide sequence before inactivation of the major splice donor site comprises the sequence shown in SEQ ID NO:

4.

54. The cell, the stable or transient producer cell, the method or the use according to any one of claims 39 to 53, wherein the nucleotide sequence before the inactivation of the cryptic splice donor site comprises the sequence as shown in SEQ ID NO:

10.

55. The cell, stable or transient producer cell, method or use according to any one of claims 39 to 54, wherein the nucleotide sequence of the RNA genome encoding the lentiviral vector comprises an inactivated cryptic splice donor site which would otherwise have a cleavage site between the nucleotides corresponding to nucleotides 17 and 18 of SEQ ID NO:

1.

56. The cell, stable or transient production cell, or method according to any one of claims 38 to 55, or the use according to any one of claims 37 or 46 to 55, wherein the nucleotide sequence encoding the RNA genome of the lentiviral vector comprises a sequence as shown in any one of SEQ ID NO: 2, 5, 6, 7, 8, 11, 12 and / or 14.

57. The cell, the stable or transient production cell, the method, or the use according to any one of claims 38 to 56, wherein the nucleotide sequence encoding the RNA genome of the lentiviral vector does not include the sequence shown in SEQ ID NO:

9.

58. The cell, stable or transient producer cell, or method according to any one of claims 38 to 57, or the use according to any one of claims 37 or 46 to 57, wherein the splicing activity of the major splice donor site and the cryptic splice donor site from the RNA genome of the lentiviral vector is inhibited or removed.

59. The cell according to any one of claims 38 to 58, the stable or transient production cell, or the method, or the use according to any one of claims 37 or 46 to 58, wherein the splicing activity of the major splice donor site and the cryptic splice donor site from the RNA genome of the lentiviral vector is inhibited or ablated in the transfected or transduced cell.

60. The cell of any one of claims 19, 21 to 25, 27 to 29 or 38 to 59, the stable or transient producer cell of any one of claims 26 or 38 to 59, the method of any one of claims 37 or 38 to 59, or the use of any one of claims 37 or 39 to 59, wherein the nucleotide sequence encoding the RNA genome of a lentiviral vector can be linked to the nucleotide sequence encoding a modified U1 snRNA.

61. A lentiviral vector produced in the presence of a modified U1 snRNA as defined in any one of claims 1 to 17, wherein the lentiviral vector comprises an inactivated major splice donor site in the RNA genome of the lentiviral vector.

Images