Construction method and application of a recombinant Singapore grouper iridovirus with miR-122 target gene SGIV163 deletion
By constructing a recombinant Singapore grouper iridovirus with the miR-122 target gene SGIV163 missing, the problem of low construction efficiency of aquatic animal DNA virus vector systems was solved, and the viral replication capacity was reduced while the immune effect was improved. This provides experimental evidence for studying the mechanism of action of miR-122 on SGIV virus.
Patent Information
- Application Number
- CN202411476780.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-22
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2044-10-22
AI Technical Summary
Existing aquatic animal DNA virus vector systems are cumbersome, time-consuming, and inefficient to construct, and they also have the problem of introducing exogenous sequences. Furthermore, the direct mechanism of action of miR-122 on SGIV virus is unclear.
A recombinant Singapore grouper iridovirus with the miR-122 target gene SGIV163 deleted was constructed. The viral gene fragment was amplified by primer design, and the fragment was cut and ligated using restriction enzymes. The virus was then transfected into cells and the recombinant virus was obtained by resistance selection. The direct effect of miR-122 on SGIV virus was studied.
The recombinant virus was constructed efficiently, its replication ability was reduced, and its stability was good. It also provided an experimental basis for studying the mechanism of action of miR-122 on SGIV virus and improved the viral immune effect.
Smart Images

Figure CN119552891B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biochemistry and molecular biology, specifically to a method for constructing and applying a recombinant Singapore grouper iridovirus with the miR-122 target gene SGIV163 deleted. Background Technology
[0002] Grouper is an important and valuable commercially valuable marine aquaculture fish in the coastal areas of southern China and Southeast Asia. Its delicious flesh and rich nutritional value make it highly sought after by consumers. However, intensive farming and inadequate management practices have led to frequent outbreaks of grouper diseases, causing severe losses to the industry and seriously hindering its sustainable development. Singapore grouper iridovirus (SGIV) is a highly pathogenic iridovirus isolated by Qin et al. in 2003 from the spleen of diseased grouper in Singapore. The main symptoms in infected fish are spleen hemorrhage and swelling, and the mortality rate of grouper exceeds 90% within one week of infection. Due to the virus's high infectivity and mortality rate, finding an effective prevention and control method is urgently needed.
[0003] Existing aquatic animal DNA virus vector systems all have varying degrees of shortcomings, mainly manifested in cumbersome construction steps, excessive time consumption, or low efficiency. Some systems introduce unnecessary exogenous sequences into recombinant viruses, impacting subsequent research to varying degrees. Traditionally, the construction of aquatic animal DNA viruses mainly utilizes homologous recombination combined with efficient gradient screening, or uses the lactose operon to restrict the expression of a specific viral gene, thereby reducing the expression of that viral gene to achieve the effect of recombinant viruses. However, the construction of aquatic animal DNA viruses using homologous recombination combined with efficient gradient screening often introduces an exogenous drug resistance gene. Using this drug resistance gene for screening is cumbersome, and efficient gradient screening is inefficient. Although the lactose operon inhibits the expression of specific viral genes, the inhibitory effect is not particularly significant. Furthermore, in recent years, new biological characteristics of different aquatic DNA viruses have been continuously discovered. Therefore, there is a great demand in this field for a more convenient, faster, more efficient, and flexible method for constructing aquatic DNA recombinant viruses.
[0004] MicroRNAs (miRNAs) are a class of small non-coding RNAs, approximately 18-25 nucleotides in length, that participate in gene expression regulation post-transcriptionally by binding complementary to target gene sequences. Currently, the effects of miRNAs on SGIV virus function are only validated in vivo; the mechanism by which miRNAs directly act on SGIV remains unclear. It has been reported that miR-122 can promote SGIV virus replication in vitro and inhibit SGIV-induced apoptosis in vitro. Furthermore, miR-122 can suppress the expression of inflammatory factors in vivo when SGIV infects the host. However, the mechanism by which miR-122 directly acts on SGIV remains ambiguous. Summary of the Invention
[0005] The first objective of this invention is to provide a gene for the Singapore grouper iridovirus SGIV163, the nucleotide sequence of which is shown in SEQ ID NO.5.
[0006] A second objective of this invention is to provide the application of SGIV163 gene deletion in reducing the replication capacity of iridovirus in Singapore grouper.
[0007] The third objective of this invention is to provide the application of SGIV163 gene deletion in inhibiting grouper miR-122 to enhance the expression of SGIV virus protein MCP.
[0008] A fourth objective of this invention is to provide a recombinant viral vector plasmid for inducing the deletion of the SGIV163 gene, comprising an SGIV viral gene fragment SGIV162L, a green fluorescent protein gene EGFP, an SGIV viral ICP18 promoter, and an SGIV viral gene fragment SGIV1. The nucleotide sequence of SGIV162L is shown in SEQ ID NO.1, the nucleotide sequence of EGFP is shown in SEQ ID NO.2, the nucleotide sequence of the ICP18 promoter is shown in SEQ ID NO.3, and the nucleotide sequence of SGIV1 is shown in SEQ ID NO.4.
[0009] Preferably, the nucleotide sequences shown in SEQ ID NO.1-4 are sequentially inserted into the pDsRed2-C1 vector.
[0010] The fifth objective of this invention is to provide a method for constructing a recombinant Singapore grouper iridovirus with the miR-122 target gene SGIV163 deleted, which includes the following steps: transfecting GS or FHM cells with the above-mentioned recombinant viral vector plasmid, mixing and incubating with Singapore grouper iridovirus solution, and collecting cells with green fluorescence to obtain the recombinant Singapore grouper iridovirus with SGIV163 deleted.
[0011] Preferably, the specific steps are as follows:
[0012] (1) Design primers, as shown in Table 1:
[0013] Table 1 Primer sequences
[0014]
[0015] (2) Obtain the amplification template:
[0016] The viral gene amplification template was obtained from cells infected with SGIV. Total RNA was extracted from the virus-infected cells, and then cDNA obtained by reverse transcription of the extracted and purified RNA was used as a template. The green fluorescent gene template was obtained from plasmid pEGFP-C1.
[0017] (3) Target gene amplification and double enzyme digestion:
[0018] The primers in step (1) and the template in step (2) were amplified by polymerase chain reaction, purified, and the amplification product was obtained. Then, the obtained recombinant gene and pDsRed2-C1 were double-digested by restriction enzymes XhoI and BamHI, and the digested fragments were recovered and purified.
[0019] (4) Fragment recombining, linking, and transformation:
[0020] The enzyme-digested fragments were ligated using T4 DNA ligase, and the ligated fragments were then transformed into competent E. coli cells. The competent E. coli cells containing the recombinant fragments were then revived in a shaker at 37°C for 1 hour. The bacterial culture was then centrifuged and spread evenly on LB medium containing kanamycin resistance using a spreader.
[0021] (5) Plasmid identification and extraction:
[0022] Positive clones were picked from kanamycin selection medium and detected by polymerase amplification reaction. Plasmids were extracted from the successfully detected positive clones to obtain the △SGIV163 recombinant viral vector plasmid.
[0023] (6) Screening for recombinant viruses:
[0024] The recombinant plasmid was transfected into healthy grouper spleen cells using the transfection reagent Lipofectamine 2000 liposome. The cells were then screened using G418 resistance. The screened cells were then infected with wild-type SGIV. After 3 days of infection, the expression of green fluorescence was observed, and progeny viruses were collected to obtain recombinant Singapore grouper iridovirus with SGIV163 deletion.
[0025] A sixth object of the present invention is to provide a recombinant Singapore grouper iridovirus obtained by the above-described construction method.
[0026] The seventh objective of this invention is to provide the application of the above-mentioned recombinant Singapore grouper iridovirus in the study of the mechanism of action of miR-122 on Singapore grouper iridovirus.
[0027] The eighth object of the present invention is to provide the application of the above-mentioned recombinant Singapore grouper iridovirus in antiviral immunization of Singapore grouper.
[0028] Advantages of this invention:
[0029] In this invention, we discovered that there is a target sequence for miR-122 on the SGIV virus and named this sequence SGIV163. By constructing a recombinant virus △163-SGIV with the SGIV163 gene missing, we can gain a more intuitive understanding of the role of miR-122 in the pathogenesis of the SGIV virus.
[0030] This invention constructs a Δ163-SGIV recombinant virus from the spleen cells of *Sinocyclocheilus spp.*, mediating the low expression of the viral gene SGIV163. This provides a sound experimental basis and evidence for studying the direct effects of miR-122 on *Sinocyclocheilus spp.* iridovirus, including viral infection, invasion, and replication. Furthermore, the reagents used in this experiment, such as the pDsRed2-C1 vector, pEGFP vector, pcDNA-3.1-3HA vector, pmiR-RB-Report vector, DNA polymerase, DNA ligase, nucleic acid extraction kit, and restriction endonucleases, are readily available, simple to operate, and quick to complete. The recombinant knockdown of the target gene is highly efficient, and the recombinant virus is stable. Moreover, this invention is the first to explore the role of miRNA in the direct targeting of *Sinocyclocheilus spp.* iridovirus, providing a reference for future in-depth research. Attached Figure Description
[0031] Figure 1 This is a map of the pDsRed2-C1 overexpression vector.
[0032] Figure 2 The structure diagram of the recombinant △163-SGIV sequence.
[0033] Figure 3 Fluorescence display results of spleen cells from obliquely banded grouper after infection with recombinant virus △163-SGIV overexpressing △SGIV163 vector.
[0034] Figure 4 The results show the relative expression levels of the SGIV163 gene in the MCP of the viral gene after infecting healthy splenic cells of the oblique grouper with wild-type SGIV (wt-SGIV) and recombinant virus Δ163-SGIV.
[0035] Figure 5 Western blot analysis of the MCP protein of the viral gene after infecting healthy splenic cells of oblique grouper with wild-type SGIV (wt-SGIV) and recombinant virus △163-SGIV.
[0036] Figure 6 Viral titer results for healthy grouper spleen cells infected with wild-type SGIV (wt-SGIV) and recombinant virus Δ163-SGIV.
[0037] Figure 7 The image shows the prediction results for miR-122 targeting SGIV163.
[0038] Figure 8 The results show the relative expression levels of SGIV163 after co-transfection of healthy grouper spleen cells with miR-122 mimic and SGIV163 overexpression vector.
[0039] Figure 9 The figure shows the results of dual-luciferase activity assays after co-transfecting healthy grouper spleen cells with miR-122 mimics and fluorescent vectors carrying wild-type or mutant target gene sequences of SGIV163.
[0040] Figure 10 The results show the relative mRNA expression levels of the viral gene MCP after transfecting healthy grouper spleen cells with miR-122 and infecting them with wild-type SGIV (wt-SGIV) and recombinant virus Δ163-SGIV.
[0041] Figure 11 Western blot analysis of MCP protein of the viral gene after transfecting healthy grouper spleen cells with miR-122 and infecting them with wild-type SGIV (wt-SGIV) and recombinant virus Δ163-SGIV. Detailed Implementation
[0042] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0043] Example:
[0044] I. Construction and Identification of Recombinant Viral Vector Plasmid pDsRed-C1-△163-SGIV
[0045] 1. Amplification of the target fragment
[0046] The △163-SGIV recombinant viral vector plasmid consists of four parts: the SGIV viral gene fragment SGIV162L (SEQ ID NO.1), the green fluorescent protein gene EGFP (SEQ ID NO.2), the SGIV viral ICP18 promoter (SEQ ID NO.3), and the SGIV viral gene fragment SGIV1 (SEQ ID NO.4). The structural diagram is shown below. Figure 2 Primers were designed (Table 1) to amplify the four gene fragments mentioned above. The templates were derived from cells infected with SGIV. Total RNA was extracted from the virus-infected cells, and the cDNA obtained by reverse transcription of the extracted and purified RNA was used as a template. The green fluorescent gene template was derived from plasmid pEGFP-C1.
[0047] The amplification system and procedure are as follows:
[0048] system: 100μL PrimeSTARHS (Premix) 50μL <![CDATA[ddH2O]]> 38μL Forward / Rewardprime 4 μL each Vector plasmid / cDNA template 4μL
[0049]
[0050] 2. Gel recovery and purification
[0051] Refer to the Omega gel recovery kit ( The Gel Extraction Kit (catalog number D2500010000L20W094) is used for gel recovery and purification. The specific steps are as follows:
[0052] (1) After DNA electrophoresis, use a clean blade to cut out the corresponding fragments of gel under a UV lamp and then place them in a 1.5mL centrifuge tube.
[0053] (2) Add 400 μL of Binding Buffer to the centrifuge tube, and then place it in a 60°C water bath and heat for 5-10 minutes until the gel is completely dissolved.
[0054] (3) Add the gel liquid into a centrifuge column with a sleeve, centrifuge at 10,000×g for 1 min, and discard the waste liquid.
[0055] (4) Add 700 μL DNA Wash Buffer to the centrifuge column, centrifuge at 13,400×g for 1 min, and discard the waste liquid.
[0056] (5) Repeat step (4).
[0057] (6) Transfer the centrifuge column to a new sleeve, centrifuge at 13,400×g for 2 min, discard the waste liquid, then transfer the centrifuge column to a new 1.5mL centrifuge tube, open the centrifuge column cap and let it stand at room temperature for 2 min.
[0058] (7) Add 30 μL of preheated ddH2O (free of nucleic acid) at 65 °C to the centrifuge column, let it stand at room temperature for 2 min, then centrifuge at 13,400 × g for 1 min, collect the liquid and measure the nucleic acid concentration on a Nanodrop 1000 spectrophotometer.
[0059] 3. Enzyme digestion of the target gene and vector plasmid
[0060] Using BamHI and XhoI as insertion sites, the pDsRed2-C1 vector ( Figure 1 The recombinant fragment gene was digested with the restriction enzymes BamHI and XhoI. The digestion system is as follows:
[0061] 10×Buffer 2μL BamHI 1μL HindIII 1μL Target gene / vector plasmid 1μg <![CDATA[ddH2O]]> Up to 20 μL
[0062] 20 μL system, incubated at 37 °C for 15 min.
[0063] 4. Recovery of enzyme digestion fragments
[0064] Refer to the Omega DNA purification and recovery kit ( DNA fragment recovery is performed using the Cycle-Pure Kit (catalog number D6492010000L18W096). The specific steps are as follows:
[0065] (1) Transfer the enzyme digestion product to a 1.5 mL centrifuge tube, add 5 times the volume of CP Buffer, shake the liquid to mix, transfer it to a centrifuge column, centrifuge at 10,000×g for 1 min, and discard the waste liquid.
[0066] (2) Add 700 μL SPW Wash Buffer to the centrifuge column, centrifuge at 13,400×g for 1 min, and discard the waste liquid.
[0067] (3) Repeat step (2).
[0068] (4) Transfer the centrifuge column to a new sleeve, centrifuge at 13,400×g for 2 min, discard the waste liquid, then transfer the centrifuge column to a new 1.5mL centrifuge tube, open the centrifuge column cap and let it stand at room temperature for 2 min.
[0069] (5) Add 30 μL of preheated ddH2O without nucleic acid at 65℃ to the centrifuge column, let it stand at room temperature for 2 min, then centrifuge at 13,400×g for 1 min, collect the liquid and measure the nucleic acid concentration on a Nanodrop spectrophotometer.
[0070] 5. The recombinant fragment recovered from enzyme digestion in step 4 was ligated with the vector plasmid at 16°C overnight. The reaction system was as follows:
[0071] 20μL system: Recombinant fragments after enzyme digestion 400ng Enzyme-digested vector plasmid 100ng 10×T4 DNA ligase Buffer 2μL T4 DNA ligase 1μL <![CDATA[ddH2O]]> Up to 20 μL
[0072] 6. Transformation and Identification
[0073] (1) Take 100 μL of DH5α Escherichia coli competent cells and place them on ice to thaw for 5-10 min.
[0074] (2) Immediately after melting, add 10 μL of the ligation product from step 5 to the competent cells, mix gently, and incubate on ice for 30 min.
[0075] (3) Place competent cells in a 42°C water bath for 90 seconds, and then immediately place them on ice for 2-3 minutes.
[0076] (4) Add 900 μL of antibiotic-free LB medium to competent cells and activate them in a shaker at 37°C for 1 h.
[0077] (5) Centrifuge the activated bacterial solution at 6,500 rpm for 5 min, discard the supernatant until about 100 μL remains, resuspend the precipitate with a pipette, mix well, and then take an appropriate amount of the resuspended bacterial solution and spread it evenly on a kanamycin-resistant (0.05 ng / mL) LB medium plate. Place the plate in an incubator at 37°C and invert it overnight.
[0078] (6) Add 1 mL of LB liquid medium containing 100 μg / mL kanamycin to a 1.5 mL centrifuge tube. In a clean bench, use a pipette tip to pick up the single clones cultured on the plate and inoculate them into the medium in the centrifuge tube. Incubate at 37°C and 200 rpm for 6 h.
[0079] (7) The bacterial culture was identified by PCR. The PCR product of the recombinant sequence was about 1800 bp. The positive clone bacterial culture was sequenced. The primers used for the identification of positive clones in this experiment were universal primers for the vector pDsRed2-C1 (F: CGCAAATGGGCGGTAGGCGTG; R: GAAATTTGTGATGCTATTGC).
[0080] II. Extraction of recombinant viral plasmid pDsRed-C1-△163-SGIV
[0081] 1. Take 2 mL of the recombinant plasmid bacterial culture in the logarithmic growth phase and add it to 200 mL of liquid LB medium containing 100 μg / mL kanamycin. Incubate overnight at 37°C in a shaker.
[0082] 2. Distribute the bacterial culture evenly into 50mL centrifuge tubes, centrifuge at 5,000×g for 10min, and discard the supernatant.
[0083] 3. Plasmid extraction
[0084] Refer to the Omega plasmid extraction kit ( The instructions for using the Endo-free Plasmid Mini Kit II (product number D6950020000F13W022) to extract plasmids are as follows:
[0085] (1) Add 1 mL Solution I to the bacterial clump at the bottom of a 50 mL centrifuge tube, resuspend the bacterial clump thoroughly with a pipette, and then transfer 500 μL of the resuspended bacterial solution to a 2 mL centrifuge tube.
[0086] (2) Add 500 μL Solution II, invert the centrifuge tube several times, and let it stand at room temperature for 2 minutes.
[0087] (3) Add 250 μL N3 Buffer, invert the centrifuge tube several times until the white flocculent material is fully separated, and centrifuge at 13,400×g for 10 min.
[0088] (4) Transfer the supernatant to a 1.5 mL centrifuge tube, add 100 μL of ETR Solution, invert the centrifuge tube and place it on ice for 5 min, then place it in a 42 °C water bath for 5 min. The solution will become clear. Centrifuge at 13,400 × g for 3 min.
[0089] (5) Transfer the supernatant to a 2 mL centrifuge tube containing twice the volume of anhydrous ethanol. Invert the centrifuge tube several times and let it stand at room temperature for 2 min. Transfer the supernatant to a centrifuge column with a sleeve and centrifuge at 10,000×g for 1 min. Discard the waste liquid.
[0090] (6) Transfer the remaining liquid in the 2mL centrifuge tube to the centrifuge column, centrifuge at 10,000×g for 1min, and discard the waste liquid.
[0091] (7) Add 500 μL HBC Buffer, centrifuge at 10,000 × g for 1 min, and discard the waste liquid.
[0092] (8) Add 700 μL DNA Wash Buffer to the centrifuge column, centrifuge at 13,400×g for 1 min, and discard the waste liquid.
[0093] (9) Repeat step (8).
[0094] (10) Transfer the centrifuge column to a new sleeve, centrifuge at 13,400×g for 3 min, and discard the waste liquid.
[0095] (11) Transfer the centrifuge column to a 1.5 mL centrifuge tube, open the centrifuge column cap and let it stand at room temperature for 3 min. Add 100 μL of preheated 65℃ nucleic acid-free ddH2O to the centrifuge column, let it stand at room temperature for 5 min, centrifuge at 13,400×g for 2 min, collect the liquid, place the plasmid on a spectrophotometer to measure its concentration, and verify the plasmid extraction by gel electrophoresis.
[0096] III. Packaging, harvesting, and amplification of the recombinant △163-SGIV viral vector
[0097] 1. Cell Culture
[0098] Cells were cultured in L15 medium supplemented with 10% fetal bovine serum (FBS, Invitrogen), and cultured in 25 cm³ containers. 2 GS or FHM cells in culture flasks were digested into single cells using 0.25% trypsin digestion solution, transferred into 24-well cell culture plates, and incubated at 25°C for approximately 18-20 hours. Microscopic observation was performed until approximately 90% of the cells had formed a monolayer (approximately 2 x 10⁻⁶ cells). 5 Transfection can begin once a single sample is collected.
[0099] 2. Cell transfection
[0100] Transfect 800 ng of plasmid into each well of a 24-well plate, requiring 2 μL of Lipofectamine 2000 transfection reagent. The transfection steps are as follows:
[0101] (1) Take two sterile 1.5 mL centrifuge tubes, add 50 μL of serum-free Opti-MEM medium to each tube, then add 2 μL of Lipofectamine 2000 and 800 ng of target plasmid to each tube, mix gently with a pipette, and let stand at room temperature for 5 min.
[0102] (2) Mix the two solutions from the above tubes, gently tap to mix, and let stand at room temperature for 25 minutes.
[0103] (3) Carefully aspirate the culture medium from the wells of the culture plate, add 300 μL of culture medium to wash once, aspirate the washing solution, and then add 400 μL of serum-free L15 culture medium to each well.
[0104] (4) Add the above plasmid and Lipofectamine 2000 mixture to the wells of the culture plate and gently shake back and forth to mix.
[0105] (5) After culturing the cells in a 28℃ incubator for 6 hours, aspirate the culture medium, then add 500 μL of L15 culture medium containing 10% fetal bovine serum. Continue culturing for 12 hours, then carefully aspirate the culture medium, add 500 μL of L15 medium containing 500 μg / mL G418 resistance, and continue culturing for 12 hours. Figure 3 As shown, most of the cells emit red fluorescence under a fluorescence microscope at this time.
[0106] 3. Obtaining recombinant viruses
[0107] GS cells were infected with wt-SGIV at an MOI of 0.1 for 2 h. Subsequently, the pDsRed-C1-△163-SGIV recombinant plasmid was transfected into the cells (see step 2) to overexpress the △163-SGIV recombinant gene for 24 h. wt-SGIV virus at an MOI of 1 was added to L15 medium containing 500 μg / mL G418 resistance and 10% FBS (wt-SGIV virus titer 10). ^6.5 Add 5 μL to each well (approximately 500 μL), inverting the plate until the virus is thoroughly mixed in the culture medium. Gently aspirate the cell transfection culture medium from step 2 using a pipette, and add the culture medium and virus mixture to the 24-well plate. Figure 3 As shown, green fluorescence excited by the recombinant virus in the cells can be seen under a fluorescence microscope 3 days after infection. The virus solution is collected thoroughly with a pipette, and then subjected to repeated freeze-thaw cycles at -80℃ at least 3 times. After centrifugation at 1,000×g for 2 min, the supernatant is collected for later use, which is regarded as the first-generation recombinant virus (Passage 1, P1) P1-△163-SGIV. Next, healthy GS cells cultured in 24-well plates are infected with P1-△163-SGIV for 2 h. Then, the pDsRed-C1-△163-SGIV recombinant plasmid is transfected into the cells (see step 2) to overexpress the △163-SGIV recombinant gene for 24 h. The original culture medium is then discarded. P1-Δ163-SGIV was mixed into culture medium containing serum and G418 resistance. The mixed medium was then added to cells in 24-well plates. After infection for 3 days, fluorescence was observed. The virus solution and cells were collected and subjected to three freeze-thaw cycles at -80°C. The cells were centrifuged at 1000×g for 2 minutes, and the supernatant was collected to obtain P2-Δ163-SGIV. This process was repeated until P10-Δ163-SGIV was obtained, thus obtaining a relatively pure recombinant virus.
[0108] IV. Application
[0109] 1. Real-time quantitative PCR detection of SGIV163 gene recombination efficiency in cells
[0110] Healthy grouper spleen cells were infected with wt-SGIV (control group) and recombinant virus Δ163-SGIV (experimental group), respectively. Infected cells were collected at 12h, 24h, 48h, and 72h after infection. Total RNA was extracted from the infected cells and reverse transcribed into cDNA. The expression of the SGIV163 gene was then detected by real-time quantitative PCR using the cDNA as a template. The real-time PCR system was prepared according to SYBR Green PCR enzyme (TOYOBO) (Table 2). The reaction program was: 95℃, 1min; 95℃, 15s; 60℃, 15s; 72℃, 45s; with 45 cycles of 95℃, 15; 60℃, 15s; 72℃, 45s. The primers were F: GCTATTGGAGCGAATACAA; R: GCCCCTGGAGGCGTTAT, and the internal control gene was β-actin.
[0111] Table 2 qPCR reaction system
[0112]
[0113]
[0114] One-way ANOVA was performed using Prism 7 statistical software. Figure 4 As shown in the figure (* indicates statistically significant difference), compared with healthy grouper cells infected with wt-SGIV, the expression level of SGIV163 in the spleen cells of grouper infected with Δ163-SGIV was significantly lower than that in the wt-SGIV infected group at 12h, 24h, 48h, and 72h. Furthermore, after 72h of infection, the expression level of SGIV163 was reduced by more than 50 times compared with the control group, indicating that the recombination efficiency of Δ163-SGIV was significant (P<0.05).
[0115] 2. Western blotting and viral titer assays were used to detect the differences in replication between recombinant virus △163-SGIV and wt-SGIV.
[0116] (1) Healthy grouper spleen cells were infected with wt-SGIV (control group) and recombinant virus Δ163-SGIV (experimental group), respectively. Infected cells were collected 24 hours after infection, and protein lysis buffer was added to lyse the cell proteins. The expression of the major capsid protein (MCP) of SGIV in the samples was then detected by Western blotting, and finally, protein grayscale analysis was performed using ImageJ software. Figure 5 As shown, compared with the control group, the protein expression level of SGIV-MCP in the experimental group was significantly reduced, indicating that the replication ability of the recombinant virus △163-SGIV was significantly decreased.
[0117] (2) Healthy grouper spleen cells were infected with wt-SGIV (control group) and recombinant virus Δ163-SGIV (experimental group), respectively. Infected cell suspensions were collected at 12h, 24h, 48h, and 72h after infection. The cell suspensions were subjected to three freeze-thaw cycles at -80℃ to ensure complete release of virus particles. The virus titer (TCID) was then determined using 96-well plates. 50 Experiment. For example... Figure 6 As shown in the figure (* indicates statistically significant difference), the viral titer in the experimental group was significantly lower than that in the control group, indicating that the virulence of the recombinant virus Δ163-SGIV was significantly reduced (P<0.05).
[0118] 3. Dual-luciferase activity verification of miR-122 targeting the SGIV163 gene
[0119] Sangon Biotech (Shanghai) Co., Ltd. synthesized the miR-122 mimic (miR-122), miR-122 mimic control (miR-con), miR-122 inhibitor (in-122), and miR-122 inhibitor control (in-con), catalog number R12438. The miR-122 mimic is a double-stranded RNA, including a sequence identical to the mature miR-122 sequence and a sequence complementary to the mature miRNA sequence. The miR-122 inhibitor is a single-stranded RNA, a chemically synthesized, methoxy-modified, complementary single-stranded design of mature miR-122. miR-con and in-con are negative controls for the miR-122 mimic and miR-122 inhibitor, respectively. The mature miR-122 sequence and the synthetic sequences of miR-122 are shown in Table 3.
[0120] Table 3 miR-122 related sequences
[0121]
[0122] like Figure 7As shown, the miRNA target site prediction website (https: / / bibiserv.cebitec.uni-bielefeld.de / rnahybrid / ) indicates that the SGIV163 gene contains a miR-122 target site. To verify the target relationship between miR-122 and SGIV163, the SGIV163 gene (SEQ ID NO.5) was cloned into the overexpression vector pcDNA-3.1-3HA (enzyme restriction sites: EcoRI and KpnI). Healthy grouper spleen cells were co-transfected with a miR-122 mimic or inhibitor and the SGIV163 pcDNA-3.1-3HA overexpression vector. Cell samples were collected 24 hours after transfection, and the expression level of SGIV163 was detected by real-time quantitative PCR (detection method as in step 4-1). The results are as follows. Figure 8 As shown, co-transfection with miR-122 mimic and SGIV163 overexpression vector significantly enhanced the expression of SGIV163 gene (P<0.05), while co-transfection with miR-122 inhibitor and SGIV163 overexpression vector significantly inhibited the expression of SGIV163 gene (P<0.05), indicating an interaction between miR-122 and SGIV163.
[0123] The restriction enzyme sites NotI and XhoI were inserted to clone the wild-type and mutant target sequences of SGIV163 (wild-type: 5'AACCATGGACATGGAGACGCTCTC3'; mutant: 5'ATGGTAGGACATGGAGTGTGAGGC3') into the luciferase vector pmiR-RB-Report. The recombinant vector, along with the miR-122 mimic (miR-122) and miR-122 mimic control (miR-con), were co-transfected into healthy grouper spleen cells. Cells were collected and lysed 24 hours after transfection, and their luciferase activity was detected. Results are as follows: Figure 9 As shown in the figure (* indicates statistically significant differences), in cells transfected with a vector carrying the wild-type target sequence of SGIV163, the luciferase activity of the recombinant vector co-transfected with miR-122 was significantly higher than that of the group co-transfected with miR-con (P<0.05). However, in cells transfected with a mutant vector of SGIV163, there was no significant difference in luciferase activity between co-transfecting the recombinant vector with miR-122 and co-transfecting with miR-con. This indicates that the mutant SGIV163 target sequence cannot bind to miR-122, and SGIV163 is a direct target of miR-122.
[0124] 4. Effects of miR-122 on the replication of wt-SGIV and Δ163-SGIV viruses
[0125] To investigate the effects of miR-122 on the replication of wt-SGIV and Δ163-SGIV viruses, miR-122 and miR-con were transfected into healthy grouper spleen cells for 24 hours, followed by infection with wt-SGIV and Δ163-SGIV, respectively. Samples were collected 24 and 48 hours after infection, and the mRNA expression of the SGIV-MCP gene was detected by real-time quantitative PCR (method as above). Figure 10 As shown in the figure (* indicates statistically significant difference), in wt-SGIV infected cells, especially 24 h after infection, the miR-122 transfection group significantly increased the mRNA expression level of the wt-SGIV viral gene MCP compared to the miR-con transfection group (P<0.05). However, in cells infected with Δ163-SGIV, there was no significant difference in MCP expression between the miR-122 and miR-con groups, meaning that the mRNA expression of MCP generated by mutant Δ163-SGIV was no longer affected by miR-122. Cell samples were collected 24 h after viral infection for Western blotting to detect the expression of SGIV viral protein MCP. Figure 11 As shown, in wt-SGIV cells, transfection with miR-122 significantly enhanced the expression of the viral protein MCP of wt-SGIV. However, in Δ163-SGIV cells, transfection with miR-122 had no significant effect on the expression of the viral protein MCP generated by wt-SGIV. This indicates that since the recombinant virus Δ163-SGIV lacks the target site of miR-122, the effect of miR-122 on it is not significant.
[0126] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.
[0127] SEQ ID NO.1(ORF162L)
[0128] AGCTGTGGTCATTCCACGTGGCTCTCAGGCATTTGACGAAAGCTCTCTTGAAGCTTCCGGGAGCTGCAGACCAAGATGATTTTGAAATGTCAAACTTTTTATTTGAGCAAATCATCCATTTGTCATCGTGATAAAACACGTTGACGACAGCTCCTTCAACAGCTGGATACACCAAACAGTCTTTGAGCGCGAGTTCTTTGGGAATCGTCTCGCGCACCAAAGGGTGTGGCAAGCTGCGAAAGATGACGTTCTTTCCGCAGTGTACGAGTCCGCGAACTGCCGGATACCGTTCCACGGCGTCGGCAGACGCGCAAGACATTGTGAGATTTTCTCGCTTGTCTGTGACGAAAGCCATTTTTAAATCTTCCACAAGGGCGATTTTTGTTCCGAGTTTGCGCAAACTCGCTAATCAAGTTTTTTTACACGATATTTTAACCTTTTAAAAGGTTAAAATATCGGAAATGCTCAATTATATTAACTTTTGCAATTTGGACACTGCCAATTGGTGATAGTCTTTSEQ IDNO.2(EGFP)
[0129] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGC CACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAASEQ ID NO.3(ICP18-promoter)
[0130] AAAATCGGAATTTGTTTTTACGTTATCTTCCGTTACCAGAAACGTAAACACTACCAA ACACCCCC
[0131] SEQ ID NO.4(ORF1L)
[0132] GCGCTCTGTTCATTTTTTCTTCAACGGTCACCAGCACCTAACGCGCCACAAGCTCGACACGTTTGAAGGTTCCACCGAGTACAGCGTCGTTTCGATCGCCTTTTTGTTAGCTGCTGCTAACTGCAACATATTTTGGTTAAAACCGGGAAGAACGCCAATTTCTTTCGTAGCCACGAAAACGGTGTGTTTTTTGCCGCAGGACGGAAACTCTTCCGGCCAAATTAGTTTTGCAGCGGGAAACTCTTGTTCAAACATTTTACGAAACGGTTTCCCATTTTTGGGCAATAAGATTGCCCATTCGTGAGGGTCCTTTTCCATGAGCGCGTGCAGTGTGGCGACGTATTTGGATTTGTATTCGGGATTCGCAAATTCTTCAGACACGCGCTGTTGAAGATACGGGTGGATAACACGATCGTTCATCACGAGTTTGGCGTAGCAGAAATGCGGAAAGTATGCCGCGTACGGATTGTTGATGTCCATGTCGGCGATGGCCTCTTCCSEQ ID NO.5 (SGIV163 sequence)
[0133] TTAAACGGTATAATACTCGAGCCAATCTCTGTACTTTATCATTTCGTACTCGCTGTATATTTTGTTGGCTTCCATTTCTGCAAAATCGTACTCTTTCATTTTGAAGAGTACGATGGGAATGCATTGGTCTGTGAGTTTTTCGCACAAATCCAGTTCTTCTTGGTACTCTGAAAGATTCCCTATAGCAATCAAGACCACGTCTGGTAAGGCGTAATTTGGGAGCTCGAGAATCTCTGCGTACGTGCGTACGAGCACGGTTTCTCCGAGTTTGCTGACCGCGTAGTCTTTTTGCGTCTCTGTTTGTACGACTACTACGGCGCAGTCTCGGTCGCGCTCGGCTCTGATTTTGATTGCCGAGAGCAACGAAGATGTCCATTCGGTTCCAAATTCTTGGGTCAGATCGTGTTTGTACTCTGGGCACCAGCGATAAATGCACTCCCTGTAATCGTCAAAAGTGTTGTCAGTCACTGCCATTTCTTCAACGGACTTGGCGGACAGCATGGGAATGGTGTCAGAGTTTTCTTGCATCATCATTTTGACGTAAGCAACATCTGGCCAAAACAGAGACTCTTCTGGAATCTCTCTGCGTTCTCGTACGTTCAAGTAGCATCTGTATTCGCCTGTGAAAACCGCAAATAGGAAACGTTCGCTGGCGCGTGTTTCGTACTCGACGATTTCCGAGACAGACCTGTTGAGCGAGATTACGGGATTGAACGTGGCACGACATTTGCGAGTTTCTATTTTCAGGTTTGTGAACGTTCTTCCCATATAGTACGTCAGTTCCATAAAGTACGTAGAGTTTACGTACCACCAGAGAGAGCACCCTGGAGGCGTTATAAATCTCTTGGAGAGCGTCTCCATGTCCATGGTTTCAATCCACACGAATGACACTGGAAGAGCTGCGGTGTTGATGTTTTGCAACTCTTCGACAGTGTACGCATATTTGTATTCGCTCCATAGCATGTAGCGACGAGCGTCGTTGGTTACAATCAGACACTTGTCGCGTTCGCGAGGAAAGATTTCAGCTTTTAATAACACAAACAGGTCTGCGTCATACTTGTAGCTGAGAATTCCCCCTTTGGGGTGTTTCTTCATCCTGGAGATCAACCATTCTCTCGAAAGCATTTTGTAACACGTATTTGTTCGTGTTGGCGATTTGGCGCTTTTTTTGCACAT
Claims
1. A gene of SGIV163, an iridovirus from Singapore grouper, characterized in that, The nucleotide sequence is shown in SEQ ID NO.
5.
2. A method for constructing a recombinant Singapore grouper iridovirus with the miR-122 target gene SGIV163 deleted, characterized in that, The procedure includes the following steps: transfecting GS or FHM cells with the recombinant viral vector plasmid, incubating it with Singapore grouper iris virus solution, collecting cells exhibiting green fluorescence, and obtaining recombinant Singapore grouper iris virus with SGIV163 gene deletion; the recombinant viral vector plasmid is the nucleotide sequence shown in SEQ ID NO.1-4 sequentially inserted into the pDsRed2-C1 vector.
3. The construction method according to claim 2, characterized in that, Includes the following steps: (1) Design primers; (2) Obtain the amplification template; (3) Amplification of the target gene and double enzyme digestion; (4) Recombination of fragments, connection and transformation; (5) Plasmid identification and extraction; (6) Screening of recombinant viruses.
4. Recombinant Singapore grouper iridovirus with SGIV163 gene deletion obtained by the construction method according to any one of claims 2-3.
5. The use of the recombinant Singapore grouper iridovirus according to claim 4 in the preparation of a drug for treating Singapore grouper iridovirus.
Citation Information
Patent Citations
Subunit vaccine for grouper iridovirus and preparation method and application of vaccine
CN108079287A
Multiple lamp primer set, detection method, and kit for simultaneous detection of multiple pathogens
US12110563B1