Yellow fever virus monoclonal antibody and application thereof
By using monoclonal antibodies against New Zealand white rabbits to block the yellow fever virus envelope protein E, the problem of the lack of specific drugs for yellow fever virus infection in existing technologies has been solved, and the effect of highly efficient neutralization of viral infection has been achieved.
Patent Information
- Application Number
- CN202511858113.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-10
- Publication Date
- 2026-02-10
AI Technical Summary
Currently, there is a lack of effective drugs to treat yellow fever virus infection. Existing monoclonal antibodies have insufficient neutralizing activity or limited cross-neutralizing ability between viral subtypes, and research on the application of rabbit monoclonal antibodies is extremely limited.
A rabbit monoclonal antibody against yellow fever virus envelope protein E was prepared. By immunizing New Zealand white rabbits and constructing a recombinant expression system, an antibody with highly efficient neutralizing activity was obtained to block yellow fever virus infection.
It exhibited highly effective neutralization of yellow fever virus in both in vitro and in vivo, protecting mice from lethal infection and demonstrating significant therapeutic and preventative effects.
Smart Images

Figure CN121494971A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical engineering technology. Specifically, this invention provides an amino acid sequence of a monoclonal antibody against yellow fever virus envelope protein E and its application in the development of therapeutic antibodies against yellow fever virus infection. Background Technology
[0002] Yellow fever virus (YFV) is an enveloped, single-stranded, positive-sense RNA virus belonging to the genus Flaviviridae in the family Flaviviridae. It shares the same genus with other important pathogens such as dengue virus, Zika virus, and West Nile virus. Yellow fever is transmitted through mosquito bites, causing the disease known as yellow fever. It is endemic in tropical and subtropical regions of Africa and South America and poses a persistent threat to global public health. The clinical manifestations of yellow fever are diverse, ranging from asymptomatic infection and self-limiting influenza-like illness to fatal hemorrhagic fever and hepatitis. Typical severe yellow fever is characterized by high fever, jaundice, proteinuria, and bleeding tendency; the liver and kidneys are its primary target organs, and the mortality rate is extremely high. Currently, there are no specific antiviral drugs for this disease.
[0003] Yellow fever virus particles are mainly composed of three structural proteins: capsid protein (C), membrane protein (M), and envelope protein (E). Among these, the envelope E protein is a key protein mediating viral infection and inducing antiviral humoral immune responses. The envelope E protein plays multiple core roles in the viral life cycle: 1. Receptor binding: The E protein is responsible for recognizing and binding to specific receptors on the surface of host cells, mediating the initial attachment of the virus to target cells and initiating endocytosis of the host cell membrane; 2. Membrane fusion: During viral entry into the cell, the E protein undergoes irreversible conformational rearrangement in an acidic environment, mediating the fusion of the viral envelope with the host cell inner membrane, thereby releasing the viral genome into the cytoplasm and initiating infection; 3. Target antigen for neutralizing antibodies: The E protein is the most important antigen on the viral surface, capable of stimulating a humoral immune response in the host, producing neutralizing antibodies. These neutralizing antibodies effectively neutralize viral infectivity by binding to specific epitopes on the E protein, blocking viral binding to receptors or inhibiting membrane fusion. Therefore, the E protein is a highly attractive target for vaccine and therapeutic antibody development.
[0004] For patients with yellow fever, currently only supportive and symptomatic treatment is available, such as fluid replacement, correction of electrolyte imbalances, and management of bleeding and liver failure. This approach cannot directly eliminate the virus or block viral replication, and its effectiveness in reducing the mortality rate of severely ill patients is limited.
[0005] Antibody therapy is an effective method for treating severe viral infections, showing good results in treating Ebola virus, respiratory syncytial virus, and other viral infections. Monoclonal antibodies have emerged as a new class of highly effective drugs for treating viral infections and are currently a hot topic in antiviral drug development. Specific monoclonal antibodies against yellow fever virus have attracted widespread attention as a potential novel treatment. Although some monoclonal antibodies targeting the E protein of yellow fever virus or other flaviviruses have been reported, they suffer from insufficient neutralizing activity or limited cross-neutralizing ability between viral subtypes, and the efficacy of monoclonal antibodies evaluated in non-human primates is extremely limited. Therefore, developing new therapeutic antibodies against yellow fever virus is of urgent practical significance in filling the gap in specific drugs for yellow fever virus.
[0006] Compared to mouse monoclonal antibodies, rabbit monoclonal antibodies have a series of unique advantages in terms of molecular structure, immune mechanism, and engineering: 1. Broader immune recognition spectrum: Rabbits have a larger B cell library, enabling the generation of a wider and more diverse antibody spectrum, which is beneficial for recognizing more types of antigenic epitopes; 2. Higher affinity and specificity: Rabbit antibodies mature for affinity through a dual mechanism of high-frequency somatic hypermutation and unique gene conversion, and their complementarity-determining region structure is unique. These characteristics together make them generally exhibit higher affinity and specificity for antigens; 3. Stronger structural stability: Rabbit antibodies contain an additional disulfide bond in the variable region of the heavy chain, and there is also a linking disulfide bond between the variable region and the constant region. This unique disulfide bond network significantly enhances the structural stability of the molecule; 4. Easier humanization: Rabbit monoclonal antibodies are easy to humanize, and several humanized rabbit monoclonal antibody drugs have already been marketed. Summary of the Invention
[0007] Yellow fever virus envelope protein E is a key viral protein that mediates viral invasion of host cells and induces neutralizing antibodies. In this invention, yellow fever virus envelope protein E is used as the target antigen to immunize New Zealand white rabbits and prepare rabbit monoclonal antibodies. A monoclonal antibody that can efficiently neutralize yellow fever virus attenuated vaccine strain 17D and West African wild strain FJYF03 / 2016 is obtained.
[0008] Specifically, this invention provides the variable region amino acid sequence of a rabbit monoclonal antibody against yellow fever virus envelope protein E and its uses. This monoclonal antibody can block infection of target cells by the attenuated yellow fever virus vaccine strain 17D and the West African wild-type strain FJYF03 / 2016 in vitro. In vivo, it can protect 3-4 week old C57BL / 6 mice against lethal infection by the West African wild-type strain FJYF03 / 2016. The deoxynucleotide sequences of the antibody heavy chain signal peptide and variable region gene are shown in SEQ ID NO:1, and the amino acid sequences of the antibody heavy chain signal peptide and variable region protein are shown in SEQ ID NO:2. The deoxynucleotide sequences of the antibody light chain signal peptide and variable region gene are shown in SEQ ID NO:3, and the amino acid sequences of the antibody light chain signal peptide and variable region protein are shown in SEQ ID NO:4.
[0009] More specifically, the present invention provides a monoclonal antibody against yellow fever virus envelope protein E, characterized in that: the amino acid sequence of the antibody includes a variable region of the antibody heavy chain and a variable region of the antibody light chain;
[0010] The amino acid sequence of the variable region of the antibody heavy chain is shown in SEQ ID NO:2;
[0011] The amino acid sequence of the variable region of the antibody light chain is shown in SEQ ID NO:4.
[0012] Furthermore, the present invention provides a monoclonal antibody against yellow fever virus envelope protein E, characterized in that:
[0013] The deoxynucleotide sequence of the variable region gene of the antibody heavy chain is shown in SEQ ID NO:1.
[0014] Furthermore, the present invention provides a monoclonal antibody against yellow fever virus envelope protein E, characterized in that:
[0015] The deoxynucleotide sequence of the variable region gene of the antibody light chain is shown in SEQ ID NO:3.
[0016] Furthermore, the present invention provides a monoclonal antibody against yellow fever virus envelope protein E, characterized in that:
[0017] The aforementioned antibody is used as a therapeutic or preventative ingredient, a drug, or for the preparation of a drug;
[0018] The above-mentioned therapeutic components / drugs can block the infection of target cells by yellow fever virus in vitro.
[0019] Furthermore, the rabbit monoclonal antibody against yellow fever virus envelope protein E provided by the present invention is characterized in that:
[0020] The aforementioned antibody is used as a therapeutic or preventative ingredient, a drug, or for the preparation of a drug;
[0021] The above-mentioned therapeutic ingredients / drugs can protect 3-4 week old C57BL / 6 mice against lethal infection by the West African wild-type strain FJYF03 / 2016 in vivo.
[0022] Furthermore, the rabbit monoclonal antibody against yellow fever virus envelope protein E provided by the present invention is characterized in that:
[0023] Application in the development of therapeutic or preventative antibodies against yellow fever virus infection. Attached Figure Description
[0024] Figure 1 ELISA detection of the binding of monoclonal antibody 19A10 to yellow fever virus envelope protein E
[0025] Figure 2 Monoclonal antibody 19A10 can neutralize the infection of target cells Huh7 by the attenuated yellow fever virus vaccine strain 17D.
[0026] Figure 3 Monoclonal antibody 19A10 can neutralize the infection of target cells Huh7 by the West African wild-type yellow fever virus strain FJYF03 / 2016.
[0027] Figure 4 Weight changes in mice challenged with West African wild-type yellow fever virus strain FJYF03 / 2016.
[0028] Figure 5 Survival rate of mice challenged with West African wild-type yellow fever virus strain FJYF03 / 2016 Detailed Implementation
[0029] The implementation of the present invention will be described in detail below with reference to the embodiments and accompanying drawings. The following embodiments are implemented based on the technical solution of the present invention, providing specific implementation methods and operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments. All operations involving yellow fever virus in this invention are performed in the Biosafety Level 3 Laboratory of the Naval Medical University of the Chinese People's Liberation Army.
[0030] I. Main Experimental Materials
[0031] 1. Yellow fever virus envelope protein E is the full-length extracellular segment of the envelope protein E of the West African wild strain FJYF03 / 2016 yellow fever virus. The amino acid sequence can be found in GenBank: KY587416.1. It was recombinantly expressed by freestyle 293F cells grown in serum-free medium by the Department of Biomedical Protection, Naval Medical University of the Chinese People's Liberation Army.
[0032] 2. Yellow fever virus attenuated vaccine strain 17D and West African wild strain FJYF03 / 2016 were preserved in the biosafety level 3 laboratory of the Naval Medical University of the Chinese People's Liberation Army.
[0033] 3. Wild-type C57BL / 6 mice aged 3-4 weeks were purchased from Shanghai Jikai Experimental Animal Co., Ltd.
[0034] 4. Rabbit-human chimeric monoclonal antibody against yellow fever virus non-structural protein NS1 was prepared by the Department of Biomedical Protection, Naval Medical University of the Chinese People's Liberation Army.
[0035] II. Experimental Methods and Results
[0036] 1. Preparation and identification process of rabbit monoclonal antibodies
[0037] New Zealand rabbits were immunized with recombinant yellow fever virus envelope protein E in combination with complete Freund's adjuvant. 0.2 mg of yellow fever virus envelope protein E was dissolved in phosphate-buffered saline (PBS) to a final volume of 0.5 ml, and thoroughly emulsified with 0.5 ml of complete Freund's adjuvant. The mixture was administered subcutaneously at multiple sites. Booster immunizations were given at 3, 6, and 9 weeks after the initial immunization, for a total of three times. For booster immunizations, 0.1 mg of yellow fever virus envelope protein E was used, with incomplete Freund's adjuvant administered subcutaneously. Three weeks after each immunization, blood was collected from the marginal ear vein, and IgG antibodies in the rabbit serum were detected using ELISA (method described below). After week 12, rabbits were anesthetized with isoflurane, and blood was collected via cardiac puncture. After the rabbits died, their spleens were harvested, cut into small pieces, ground and filtered on a nylon mesh to prepare a single-cell suspension. Single spleen cells expressing yellow fever virus envelope protein E IgG antibodies were sorted using flow cytometry. These single spleen cells were seeded into 96-well plates and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and 100 μg / ml streptomycin. The 96-well plates were placed in a 37°C cell culture incubator with 5% CO2 and saturated humidity for approximately 7-10 days. When the cells covered the bottom of the wells, the presence of yellow fever virus envelope protein E IgG antibodies in the cell culture supernatant was detected by ELISA. Total RNA was extracted from antibody-positive cells, and the antibody heavy chain signal peptide and variable region gene (Signal-VH), and light chain signal peptide and variable region gene (Signal-VL) were amplified using reverse transcription polymerase chain reaction. PCR products were recovered by agarose gel electrophoresis and inserted into the pMD18T vector (Takara). After DNA sequencing, the antibody heavy chain Signal-VH was spliced with the rabbit IgG1CH1-human IgG1 heavy chain constant region CH2-CH3 to form the complete heavy chain gene, and the light chain Signal-VL gene was spliced with the rabbit light chain constant region gene to form the complete antibody light chain gene. The full-length heavy chain and light chain genes were inserted into the cloning site of the mammalian cell expression vector pcDNA3.4 to construct expression plasmids. The antibody heavy chain and light chain expression plasmids were co-transfected into 293T cells at a 1:2 mass ratio. ELISA was used to detect the presence of yellow fever virus envelope protein E IgG antibodies in the cell culture supernatant. The supernatant with positive IgG antibodies was used to determine its neutralizing activity using a viral microneutralization assay. If the monoclonal antibody exhibits virus-neutralizing activity, recombinant expression is performed on freestyle 293F cells grown in suspension culture in serum-free medium. Freestyle 293F cells are cultured to 300 ml (1L volume culture flask) until the cell density reaches 1×10⁻⁶ cells / mL. 6At a concentration of / ml, the antibody heavy chain and light chain expression plasmids were co-transfected into freestyle 293F cells using polyethylenimine (PEI) reagent. After culturing the cells for 72 hours, the antibody was purified from the culture supernatant using Staphylococcus aureus Protein A affinity chromatography and subjected to ELISA, virus neutralization assay, and mouse challenge protection assay.
[0038] 2. ELISA detection of rabbit anti-yellow fever virus envelope protein E IgG antibody
[0039] Yellow fever virus envelope protein E was diluted with 50 mM carbonate coating buffer (pH 9.6) to a concentration of 1 μg / ml. 0.1 ml of the solution was added to each well of an ELISA plate, containing 0.1 μg of yellow fever virus envelope protein E. The plate was incubated overnight at 4°C. The next day, the coating buffer was removed, and each well was washed once with 0.2 ml of PBS buffer. Then, 0.2 ml of PBS buffer (blocking buffer, pH 7.4) containing 3% bovine serum albumin, 5% goat serum, and 0.05% Tween 20 was added to each well. After incubation at room temperature for 2 hours, the blocking buffer was removed, and the wells were washed three times with PBS buffer (washing buffer) containing 0.05% Tween 20. Finally, 0.1 ml of rabbit spleen cell culture supernatant diluted with blocking buffer, culture supernatant co-transfected with antibody expression plasmid into 293T cells, or monoclonal antibody purified from culture supernatant co-transfected with antibody expression plasmid into freestyle 293F cells was added. Incubate the wells at room temperature on a gently shaking horizontal shaker for 30 minutes. Then discard the reaction solution in the wells, wash the wells 5 times with washing buffer, and add horseradish peroxidase-labeled anti-rabbit IgG (H+L) (Thermo Biotech product) diluted 1:2000 with blocking buffer. Incubate the wells at room temperature on a gently shaking horizontal shaker for 30 minutes. Then discard the enzyme-labeled antibody dilution in the wells, wash the wells 5 times with washing buffer, and add 0.1 ml of substrate solution containing 5,5'-tetramethylbenzidine (TMB) to each well. Incubate the wells at room temperature in the dark for 5 minutes, then add 50 μl of 2M sulfuric acid, mix well, and measure the absorbance at 450 nm using a microplate reader. The reference wavelength is 630 nm.
[0040] Figure 1 The ELISA absorbance values (A450-630) of different concentrations of a monoclonal antibody (numbered 19A10) against yellow fever virus envelope protein E, identified through screening, are shown. Rabbit IgG1 (Cell Signaling) was used as a negative control. The results demonstrate that monoclonal antibody 19A10 specifically binds to yellow fever virus envelope protein E. The deoxynucleotide sequence of the heavy chain variable region gene of this antibody is shown in SEQ ID NO:1.
[0041] SEQ ID NO:1: Deoxynucleotide sequence of the heavy chain signal peptide and variable region of monoclonal antibody 19A10 (1-60 are the deoxynucleotide sequence of the signal peptide, 61-405 are the deoxynucleotide sequence of the variable region)
[0042] 1ATGGAGACTG GGCTGCGCTG GCTTCTCCTG GTCGCTGTGC TCAAAGGTGT CCAGTGTCAG
[0043] 61TCGGTGCAGG AGTCCGGGGG TCGCCTGGTC ACGCCTGGGA CACCCCTGAC ACTCACCTGC
[0044] 121ACCGTCTCTG GATTCTCCCT CAATGACTAT GGAGTGACCT GGGTCCGCCA GGCTCCAGGG
[0045] 181AAGGGGCTGG AGTGGATCGG AATTATGAAT ACTTATGACA CCGCGGACTA CGCGAGCTGG
[0046] 241GCGAAAGGCC GATTCACCAT CTCCAAAACC TCGACCACGG TGGATCTGAA AATCACCAGT
[0047] 301CTGACACCCG AGGACACGGC CACCTATTTT TGTGGCAGAT CCTATATTCG TGGTAGTGAT
[0048] 361TATATAGGAT TGTGGGGCCT AGGCACCCTA GTCACCGTCT CCTCA
[0049] The amino acid sequence of the antibody heavy chain variable region protein, deduced from the gene sequence, is shown in SEQ ID NO:2.
[0050] SEQ ID NO:2: Amino acid sequence of monoclonal antibody 19A10 heavy chain signal peptide and variable region (1-20 are amino acid sequences of the signal peptide, 21-135 are amino acid sequences of the variable region)
[0051] 1 METGLRWLLL VAVLKGVQCQ SVQESGGRLV TPGTPLTLTC TVSGFSLNDY GVTWVRQAPG
[0052] 61KGLEWIGIMN TYDTADYASW AKGRFTISKT STTVDLKITS LTPEDTATYF CGRSYIRGSD
[0053] 121YIGLWGLGTL VTVSS
[0054] The deoxynucleotide sequence of the antibody light chain variable region gene is shown in SEQ ID NO:3.
[0055] SEQ ID NO:3: Deoxynucleotide sequence of the light chain signal peptide and variable region of monoclonal antibody 19A10 (1-69 are the signal peptide deoxynucleotide sequence, 70-396 are the variable region deoxynucleotide sequence)
[0056] 1ATGGACACGA GGGCCCCCAC TCAGCTGCTG GGGCTCCTGC TGCTCTGGCT CCCAGGTGCC
[0057] 61ACATTTGCTC AAGTGCTGAC CCAGACTGCA TCGTCCGTGT CTGCAGCTGT AGGAGGCACA
[0058] 121 GTCACCATCA GTTGCCAGTC CAGTGAGAGT GTGCATAGTA ACAACCAATT ATCCTGGTAT
[0059] 181 CAGCAGAAAC CAGGGCAGCC TCCCAGGCTC CTGATCTATT CTGCATCCAC TCTGATATCT
[0060] 241GGGGTCCCAT CGCGCTTCAA AGGCAGTGGA TCTGGGACAC AGTTCACTCT CACCATCAGC
[0061] 301GACCTGGAGTGTGACGATGCTGCCACTTAC TACTGTCAAGGCGGTTATACTGGTGAAGTT
[0062] 361GTGACTTTCGGCGGAGGGACCGAGGTGGTGGTCAGC
[0063] The amino acid sequence of the antibody light chain variable region protein, deduced from the gene sequence, is shown in SEQ ID NO:4.
[0064] SEQ ID NO:4: Amino acid sequence of the light chain signal peptide and variable region of monoclonal antibody 19A10 (1-23 are amino acid sequences of the signal peptide, 24-132 are amino acid sequences of the variable region)
[0065] 1 MDTRAPTQLL GLLLLWLPGA TFA QVLTQTA SSVSAAVGGT VTISCQSSES VHSNNQLSWY
[0066] 61QQKPGQPPRL LIYSASTLIS GVPSRFKGSG SGTQFTLTIS DLECDDAATY YCQGGYTGEV
[0067] 121VTFGGGTEVV VS
[0068] Further in vitro neutralization and in vivo mouse challenge protection tests were conducted on the monoclonal antibody to evaluate its antiviral efficacy.
[0069] 3. Micro-neutralization assay to detect the neutralizing activity of monoclonal antibody against yellow fever virus.
[0070] The cultured human liver cancer cell line Huh7 was passaged and seeded into 96-well plates. The culture medium was DMEM medium supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and 100 μg / ml streptomycin (hereinafter referred to as complete DMEM medium). Each well contained 10,000 cells and was placed in a cell culture incubator at 37°C with 5% CO2 and saturated humidity for 12 hours.
[0071] Monoclonal antibody 19A10 was serially diluted in 96-well plates (using complete DMEM medium as the diluent). Normal rabbit IgG (Cell Signaling) was used as a negative control. 50 μl of each concentration gradient was aspirated into each well of the 96-well plate. Then, 50 μl of diluted yellow fever virus attenuated vaccine strain 17D or West African wild-type strain FJ2016 virus solution (containing approximately 300 focus-forming units (PFUs) of yellow fever virus, diluted in complete DMEM medium) was added to each well. The mixture was then placed in a 37°C cell culture incubator. After 30 minutes, the liquid in the wells was transferred to Huh7 cell culture wells (after removing the original cells and preparing the culture medium). The cells were cultured for another 18 hours, and the expression of yellow fever virus protein in the cells was detected by immunofluorescence. The specific procedure is as follows: Remove the culture medium from the culture plate, add 0.1 ml of methanol to each well, place the culture plate at -20°C for 20 minutes, remove the plate, remove the methanol, wash each well once with phosphate-buffered saline (PBS), then add 0.1 ml of PBS containing 3% bovine serum albumin (BSA) (hereinafter referred to as 3% BSA-PBS), place on a horizontal shaker, and shake slowly at room temperature for 1 hour. Remove the 3% BSA-PBS from the culture plate, add 0.1 ml of 1% BSA-PBS (antibody 500-fold dilution) containing rabbit anti-yellow fever virus non-structural protein NS1 monoclonal antibody (primary antibody) to each well, and shake slowly at room temperature for 1 hour. Remove the primary antibody working solution from the culture plate, wash each well 3 times with PBS, then add 0.1 ml of 1% BSA-PBS (fluorescein antibody 1000-fold dilution) containing Alexa Fluor 488-labeled anti-human IgG, and shake slowly at room temperature in the dark for 1 hour. Remove the fluorescein antibody working solution from the culture plate, and add 0.1 ml of DAPI nuclear staining solution to each well. ml, shake slowly at room temperature in the dark for 10 minutes, remove DAPI cell nuclear staining solution from the culture plate, wash each well 3 times with PBS, count the green fluorescent positive cells in each well using a cell imaging and analysis system (BioTek Cytation 5 Imaging Reader), and then calculate the neutralization percentage (%) = number of positive cells in wells treated with monoclonal antibody 19A10 or control rabbit IgG / number of positive cells in wells without antibody.
[0072] The results are as follows Figure 2 , 3 As shown, monoclonal antibody 19A10 can effectively neutralize the infection of target cells Huh7 by yellow fever virus attenuated vaccine strain 17D and West African wild-type strain FJ2016.
[0073] 4. Evaluate the in vivo antiviral activity of the monoclonal antibody using a mouse virus challenge model.
[0074] Thirty 3-4 week old female C57BL / 6 mice were randomly divided into three groups of 10 each. Each group received an intraperitoneal injection of 200 μl of DMEM medium containing 1,000,000 PFUs of yellow fever virus (West African wild-type strain FJYF03 / 2016). Two hours later, each group received a tail vein injection of either 100 μg of monoclonal antibody 19A10 or 100 μl of control rabbit IgG. Mice were weighed every 24 hours after virus injection. Mice whose weight decreased by more than 25% were considered dead, anesthetized with isoflurane, and euthanized by cervical dislocation.
[0075] The results are as follows Figure 4 , 5 As shown, monoclonal antibody 19A10 can protect mice 100% against infection with the West African wild-type yellow fever virus strain FJ2016. The mice in the control antibody treatment group continued to lose weight after challenge and had a mortality rate of 100%, while the mice in the monoclonal antibody 19A10 treatment group did not lose weight and survived 100%.
[0076] The above in vitro and in vivo test results all indicate that monoclonal antibody 19A10 can effectively neutralize the infectivity of yellow fever virus and treat the morbidity and mortality of mice caused by yellow fever virus infection.
[0077] The foregoing has shown and described the main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.
Claims
1. A monoclonal antibody against yellow fever virus, characterized in that, The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:2, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO:
4.
2. The use of the monoclonal antibody of claim 1 in the preparation of medicaments for the treatment and / or prevention of yellow fever virus.
3. A pharmaceutical composition, characterized in that, Contains the antibody as described in claim 1.
4. The encoding gene of the monoclonal antibody of claim 1.