Development and application of molecular markers linked to a major qtl for kernel dehydrating in maize
By developing KASP technology to detect the SNP locus genotype on maize chromosome 3, the problem of excessive moisture content in maize kernels has been solved, enabling efficient breeding selection and promoting the development of mechanized maize harvesting.
Patent Information
- Application Number
- CN202311121963.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-01
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2043-09-01
AI Technical Summary
In existing technologies, excessive moisture content in corn kernels leads to high breakage and impurity rates during mechanized harvesting, which limits the development of fully mechanized corn production. Furthermore, the reported genes related to kernel dehydration are insufficient to explain genetic variation, and there is a lack of effective molecular markers for breeding.
A method for SNP site detection based on KASP technology was developed. By detecting the genotype of the SNP site at 204, 549, 490 bp on maize chromosome 3, KASP amplification and fluorescence detection were performed using primer combinations to identify the moisture content and dehydration rate of maize kernels, and maize with the GG genotype was selected for breeding.
It enables efficient identification of corn kernel moisture content and dehydration rate, improves breeding selection efficiency, and can quickly screen out corn varieties with fast kernel dehydration, thus promoting the mechanized harvesting of corn.
Smart Images

Figure CN119552999B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of plant molecular genetics and breeding, and relates to the development of a molecular marker linked to a major-effect QTL for maize kernel dehydration and its application. BACKGROUND
[0002] Maize is one of the most important crops in the world, and full mechanized production has gradually become the most common production method. However, most maize varieties in China have not yet reached the standard for mechanical harvesting, which seriously hinders the development of full mechanization. The most important limiting factor is the excessively high kernel moisture content at harvest time. When the kernel moisture content is too high, mechanical harvesting will result in a high rate of breakage and impurities, increasing the cost of harvesting, reducing economic efficiency and affecting seed quality. According to previous studies, a kernel moisture content of 15%-25% is the optimal level for mechanical harvesting. However, the kernel moisture content of maize grown in the Huanghuaihai region of China is between 21.5%-33.1%, with an average kernel moisture content of 27.8% for summer maize. Therefore, it is of great significance to genetically improve maize kernel moisture content, tap and apply new maize germplasm with fast dehydration rate and low kernel moisture content, in order to achieve full mechanization of maize.
[0003] Currently, only two genes related to maize kernel dehydration have been reported, including GRMZM5G805627 (ZmGAR2) and GRMZM2G366532 (ZmHSP5). As a complex quantitative trait, the currently cloned two genes are far from sufficient to explain all genetic variations of the trait. Moreover, the two reported genes have not been applied in production practice. Therefore, more QTLs related to kernel dehydration need to be located in the future, and genes need to be further cloned through methods such as map-based cloning, and corresponding molecular markers need to be developed and applied in production practice.
[0004] KASP (Kompetitive Allele Specific PCR; competitive allele-specific PCR) can accurately determine SNPs or InDels widely present in genomic DNA, and is a high-throughput, economical and effective SNP typing technology. The development of KASP markers related to kernel dehydration will help to accelerate the field breeding of new maize varieties with fast dehydration rate.
[0005] Most maize varieties in China have not yet reached the standard for mechanical harvesting of kernels, and relatively little genetic research has been conducted on kernel dehydration. The genes that have been tapped are not sufficient to explain all genetic variations, and corresponding molecular markers have not been developed and successfully applied in production. Therefore, more genes and molecular markers related to kernel dehydration need to be introduced in production to breed new maize varieties suitable for mechanical harvesting, in order to accelerate the process of maize mechanization. SUMMARY
[0006] The problem to be solved by the present application is how to identify or assist in identifying the moisture content and / or dehydration rate of corn kernels in high throughput.
[0007] To solve the above technical problems, the present application first provides the use of a substance for detecting the polymorphism or genotype of KASP in the genome of corn in any one of the following,
[0008] (1) identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels;
[0009] (2) corn breeding;
[0010] (3) preparing a product for identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels;
[0011] (4) preparing a product for corn breeding;
[0012] The SNP site is a site on chromosome 3 of corn, and the nucleotide species is A or G, which is the 21st nucleotide of SEQ ID NO: 4 in the sequence table.
[0013] Taking the sequence of corn variety B73 genome (RefGen_v3) as the reference genome, the SNP site is at 204,549,490 bp of chromosome 3 of corn (specifically the 21st nucleotide of SEQ ID NO: 4 in the sequence table).
[0014] The present application also provides a method for identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels, comprising detecting the genotype of the SNP site in the genome of the corn to be tested, and identifying or assisting in identifying the moisture content and / or dehydration rate of corn kernels according to the genotype, wherein the genotype of the SNP site is AA or AG or GG, the AA is the homozygous type of the SNP site being A, the GG is the homozygous type of the SNP site being G, and the AG is the heterozygous type of the SNP site being A and G, and the moisture content of the corn to be tested with the genotype of the SNP site being GG is lower and / or the dehydration rate is faster than the corn to be tested with the genotype of the SNP site being AA or / and AG.
[0015] As an embodiment, the method for identifying or assisting in identifying the moisture content and dehydration rate of corn kernels can comprise the following steps:
[0016] (1) using the genomic DNA of the corn to be tested as the template and using primer composition for KASP amplification; the primer composition is composed of primer A, primer B and primer C;
[0017] The primer A is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 1 or a single-stranded DNA with a nucleotide sequence of 22-42 of SEQ ID NO: 1 in the sequence table;
[0018] the primer B is a single-stranded DNA molecule with the nucleotide sequence of SEQ ID NO: 2 in the sequence listing or a single-stranded DNA with the nucleotide sequence of 22-42 of SEQ ID NO: 2 in the sequence listing;
[0019] the primer C is a single-stranded DNA molecule with the nucleotide sequence of SEQ ID NO: 3 in the sequence listing;
[0020] (2) after step (1) is completed, fluorescence detection is performed to determine the genotype of the SNP of the corn to be tested;
[0021] (3) according to the genotype result, the kernel moisture content and / or dehydration rate of the corn to be tested are identified: the kernel moisture content of the corn to be tested with the genotype GG of the SNP site is lower and / or the dehydration rate is faster than that of the corn to be tested with the genotype AA of the SNP site.
[0022] The application of the above method in corn breeding also belongs to the protection scope of the present application.
[0023] The present application also provides a method for corn breeding.
[0024] The method for corn breeding provided by the present application comprises detecting the genotype of the SNP site in the corn genome, selecting corn with the genotype GG of the SNP site as a parent for breeding, and the genotype GG is a homozygous type of G of the SNP site.
[0025] In the present application, the purpose of corn breeding is to select and cultivate corn with rapid kernel dehydration.
[0026] As an implementation method, the method for corn breeding can comprise the following steps:
[0027] (1) using the genomic DNA of the corn to be tested as a template, KASP amplification is performed using the primer set described above;
[0028] (2) after step (1) is completed, fluorescence detection is performed to determine the genotype of the SNP site of the corn to be tested;
[0029] (3) corn germplasm with the genotype GG is selected for kernel moisture content and / or dehydration rate advantage corn breeding.
[0030] In the above method, the primer dissolving and preparation method can be: first, dilute the three primers to 100 mM with ddH2O respectively, then prepare the primer working solution as follows: primer A 12 μL, primer B 12 μL, primer C 30 μL, ddH2O 46 μL, as the primer working solution for KASP marker, -20℃ storage for standby.
[0031] In the above method, the reaction system of PCR can be: 2xKASP Mastermix volume is 2 μL, primer mix volume is 0.056 μL, genomic DNA concentration is about 100 ng / μL, volume is 1 μL, and ultrapure water is supplemented to 4 μL.
[0032] In the above method, PCR amplification can be performed on a high-throughput PCR instrument.
[0033] In the above method, the reaction program of PCR can be:
[0034] Step 1: 94℃ pre-denaturation for 15 min;
[0035] Step 2: 94℃ denaturation for 20 s, annealing for 20 s (the annealing temperature of the first time is 61℃, and the temperature is reduced by 0.6℃ for each cycle) for a total of 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing for 1 min for a total of 32 cycles;
[0036] In the above method, the method for determining the genotype of the SNP of the to-be-tested corn can be: after the PCR reaction is completed, the fluorescence signal reading instrument and the fluorescence detection system are used to convert the fluorescence signal into an analyzable numerical value, and the fluorescence data of the reaction product is read (the data reading temperature is below 40℃). The fluorescence scanning result is genotyped by using KlusterCaller software, the A base type has FAM fluorescence, and is distributed near the Y axis; the G base type has HEX fluorescence, and is distributed near the X axis; and the sample without signal detection is distributed near the origin.
[0037] The application also provides a product for detecting the polymorphism or genotype of the SNP site in the corn genome.
[0038] The product for detecting the polymorphism or genotype of the SNP site in the corn genome provided by the application contains the above-mentioned substance for detecting the polymorphism or genotype of the SNP site in the corn genome, and the product is any one of the following:
[0039] C1) a product for detecting a single nucleotide polymorphism or genotype related to the moisture content and / or dehydration rate of a corn kernel;
[0040] C2) a product for identifying or assisting in identifying the moisture content and / or dehydration rate of a corn kernel;
[0041] C3) a product for corn breeding.
[0042] In the above-mentioned applications, methods and products, the substance can be a reagent and / or instrument required for determining the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction enzyme fragment length polymorphism, single strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes chip based on nucleic acid hybridization reaction, chip based on single base extension reaction, chip based on allele-specific primer extension reaction, chip based on "one-step" reaction, chip based on primer ligation reaction, chip based on restriction enzyme reaction, chip based on protein DNA binding reaction, and chip based on fluorescence molecule DNA binding reaction.
[0043] Optionally, the substance is D1), D2) or D3) as follows:
[0044] D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site;
[0045] D2) the substance is a PCR reagent containing the primer composition of D1);
[0046] D3) the substance is a kit containing the primer composition of D1) or the PCR reagent of D2).
[0047] Optionally, the amplification can be PCR amplification. The primer composition consists of the primer A, the primer B and the primer C.
[0048] D3) the kit can further include KASP Master Mix.
[0049] In the above applications, methods and products, the primer composition can or can not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as32P; binding moieties such as biotin; hapten such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with a nucleic acid or protein sequence, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., the sequence is directly read). As described above, the primer composition can be a primer composition consisting of a single-stranded DNA having a nucleotide sequence of positions 22-42 of SEQ ID NO: 1 in the sequence listing, a single-stranded DNA having a nucleotide sequence of positions 22-42 of SEQ ID NO: 2 in the sequence listing, and a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 3 in the sequence listing. The primer composition can also be a primer set consisting of a single-stranded DNA represented by SEQ ID NO: 1 in the sequence listing, a single-stranded DNA represented by SEQ ID NO: 2 in the sequence listing, and a single-stranded DNA represented by SEQ ID NO: 3 in the sequence listing. SEQ ID NO: 1 in the sequence listing consists of 42 nucleotides, the first to 21st nucleotides are FAM sequence (as a label), and the 22nd to 42nd nucleotides are specific sequence; SEQ ID NO: 2 in the sequence listing consists of 42 nucleotides, the first to 21st nucleotides are HEX sequence (as a label), and the 22nd to 42nd nucleotides are specific sequence.
[0050] The present application also provides a DNA molecule, the nucleotide sequence of which is represented by SEQ ID NO: 4 in the sequence listing.
[0051] The use of the above-mentioned DNA molecule also falls within the scope of the present application. The use is specifically the use in any one of the following:
[0052] (1) identifying or assisting in identifying the moisture content and / or the rate of dehydration of corn kernels;
[0053] (2) corn breeding;
[0054] (3) preparing a product for identifying or assisting in identifying the moisture content and / or the rate of dehydration of corn kernels;
[0055] (4) preparing a product for corn breeding.
[0056] Alternatively, in the above-mentioned uses, the DNA molecule serves as a detection target.
[0057] The substance for detecting the SNP site polymorphism and genotype can be combined with other substances (such as a substance for detecting a single nucleotide polymorphism or genotype of another molecular marker related to the moisture content and / or dehydration rate of a corn kernel) to prepare a product for identifying a corn variety with a moisture content and / or dehydration rate of a corn kernel.
[0058] In the present application, the breeding purpose can include breeding a corn with a low moisture content and / or a fast dehydration rate. The corn can be a pure line or an inbred line.
[0059] The present application provides a primer composition and a method for identifying or assisting in identifying the moisture content and / or dehydration rate of a corn kernel using the primer composition. The method established by the present application can be used to predict the moisture content and / or dehydration rate of a corn kernel, can be used for early screening of corn to be screened, can be used for molecular marker assisted breeding of corn, and has important application value in the research of mining corn kernel moisture content low, dehydration rate fast and breeding corn kernel moisture content low, dehydration rate fast. BRIEF DESCRIPTION OF DRAWINGS
[0060] Figure 1 Distribution of kernel moisture content phenotypes of fast dehydration parent KA105 and slow dehydration parent KB020.
[0061] Figure 2 Distribution of kernel moisture content of recombinant inbred line population.
[0062] Figure 3 Distribution of kernel dehydration rate of recombinant inbred line population.
[0063] Figure 4 QTL mapping of major QTL qKMC3.
[0064] Figure 5 KASP marker KASP_KMC3 genotyping in recombinant inbred line population (RIL population) and phenotype T test results.
[0065] Figure 6 KASP marker KASP_KMC3 genotyping in association population and phenotype T test results. DETAILED DESCRIPTION
[0066] The present application will be further described in detail below in conjunction with the specific embodiments. The examples provided below are only for the purpose of illustrating the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application.
[0067] The experimental methods in the following examples are all routine methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.
[0068] The quantitative experiments in the following examples are all set up in triplicate, unless otherwise specified.
[0069] The maize inbred lines KB020 and KA105 in the following examples were bred by the Key Laboratory of Maize Biology and Genetic Breeding, College of Agronomy, Northwest A&F University, and have been recorded in Zhao Z, He K, Feng Z, et al. Evaluation of Yield-Based Low Nitrogen Tolerance Indices for Screening Maize (Zea mays L.) Inbred Lines [J]. Agronomy, 2019, 9(5): 240. DOI: 10.3390 / agronomy9050240. The biological material can be obtained from the applicant, and can only be used for repeating the experiments of the present application, and cannot be used for other purposes.
[0070] The recombinant inbred line population of KA105 x KB020 in the following examples was obtained by single-seed descent.
[0071] The association population of 152 maize inbred lines in the following examples has been recorded in Qu J, Xu S, Gou X, Zhang H, Cheng Q, Wang X, Ma C, Xue J. 2022. Time-resolved multiomics analysis of the genetic regulation of maize kernel moisture. The Crop Journal. The biological material can be obtained from the applicant, and can only be used for repeating the experiments of the present application, and cannot be used for other purposes.
[0072] EXCEL software was used to process the data in the following examples, and the experimental results were expressed as mean ± standard deviation. T-test was used to distinguish the differences between independent samples, P < 0.05 (*) indicated significant difference, P < 0.01 (**) indicated extremely significant difference, and P < 0.001 (***) indicated extremely significant difference.
[0073] Example 1. Obtaining of SNP marker chip site Affx-159065432 and KASP marker primer set related to maize kernel moisture content and dehydration rate
[0074] 1. Corn kernel moisture content and dehydration rate determination
[0075] In May 2021, KA105 and KB020 and their recombinant inbred line population (a total of 208 families) were sown in the Guancun Corn Test Base of Northwest A&F University in Yangling, Shaanxi Province; each family was planted in 2 rows, with a row length of 5 m, a total of two replicates, a total of 840 rows, for genetic analysis and gene positioning of kernel dehydration.
[0076] Normal field management, all single plants were self-pollinated and the pollination date was recorded, and the needle prick method was used to determine the kernel moisture content at 35 days, 42 days, 49 days, and 56 days after pollination, and the AUDDC method was used to determine the kernel dehydration rate. The formula for calculating the kernel dehydration rate is as follows:
[0077]
[0078] Where: i represents the number of measurements, t i represents the corresponding pollination date
[0079] The results are shown in Figure 1 : The kernel moisture content of the fast dehydration inbred line KA105 was significantly lower than that of KB020, with an average kernel moisture content of 38.9%, 37.7%, 35.7%, and 31.0% (35 days, 42 days, 49 days, and 56 days), while the average kernel moisture content of KB020 was 42.2%, 41.2%, 36.9%, and 34.0% (35 days, 42 days, 49 days, and 56 days).
[0080] 2. QTL positioning related to corn kernel moisture content and dehydration rate and the discovery of chip site Affx-159065432
[0081] 1) 208 materials were planted in the culture room, and 200 seedling materials were obtained, and DNA extraction was performed on the leaves at the three-leaf-one-new stage, a total of 200 inbred lines were extracted.
[0082] The results are shown in Figure 2 , Figure 3 : The recombinant inbred line population (referred to as RIL population) of KA105 x KB020 showed a normal distribution in the kernel moisture content and dehydration rate distribution chart, which was consistent with the segregation of quantitative traits, indicating that the trait was controlled by multiple genes.
[0083] 2) Based on the SNP data obtained from the Zea mays 6H60K chip and the phenotypic data measured in the field, the QTL IciMapping software was used to perform linkage analysis on the molecular marker genotype data of the RIL population to construct a molecular marker genetic linkage map. Based on the map and the phenotypic data of the 208 RIL population in three environments, QTL detection was performed, and a major QTL site was detected on chromosome 3 of corn, located between the SNP molecular markers Affx-159168009 and Affx-88984967, with a physical distance of about 3.3 Mb. The QTL contribution rate is 6.20-11.53%, and the additive effect is -0.28--0.74( Figure 4 ), and the rapid dehydration gene is derived from the parent KA105. The QTL is named qKMC3.
[0084] 3, Linkage analysis of KASP marker KASP_KMC3
[0085] The DNA of the recombinant inbred line population of KA105 x KB020 and the two parents was extracted by CTAB method for marker identification. First, the SNP markers in the QTL interval were mined in combination with the measured Zea mays 60K SNP marker information, and then the SNP markers were designed for KASP marker primers using the online platform primer3 website (https: / / bioinfo.ut.ee / primer3-0.4.0 / ). Subsequently, the primers were mixed with KASP Mix for PCR amplification, and the amplification results were analyzed by KlusterCaller software. It was found that the SNP site Affx-159065432 was linked to the QTL site qKMC3, which was named KASP_KMC3 and used for molecular marker assisted selection breeding. The SNP site Affx-159065432 is the 21st in sequence 4, and its nucleotide species is A or G. In the sequence table, r in sequence 4 represents a or g.
[0086] 4. Obtaining of primer set of KASP marker KASP_KMC
[0087] A primer set for detecting KASP marker KASP_KMC3 based on KASP technology was designed, which is referred to as KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C). The specific KASP primer set sequences are as follows:
[0088] Primer A: 5’- GAAGGTGACCAAGTTCATGCT AAACATGGTTATTGCGTCCGA-3’ (sequence 1)
[0089] Primer B: 5’- GAAGGTCGGAGTCAACGGATT AAACATGGTTATTGCGTCCGG-3’ (sequence 2)
[0090] Primer C: 5'-AAATAGTGTTTGGTTTATTGCATTGG-3' (Sequence 3)
[0091] PCR product: 5'-AAACATGGTTATTGCGTCCGrCCGCCAATGCAATAAACCAAACACTATTT-3' (Sequence 4), wherein r represents a or g.
[0092] Primer A is a primer with a FAM fluorescent label sequence (the bases in the underlined part) at the 5' end, and primer C amplifies the fragment of SNP site Affx-159065432 which is A, and the fluorescence signal of the FAM group can be read by a fluorescence signal reader;
[0093] Primer B is a primer with a HEX fluorescent label sequence (the bases in the underlined part) at the 5' end, and primer C amplifies the fragment of SNP site Affx-159065432 which is G, and the fluorescence signal of the HEX group can be read by a fluorescence signal reader.
[0094] The above primers are synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd.
[0095] The above KASP Master Mix is purchased from Beijing Ji Cheng Biological Technology Co., Ltd.
[0096] Example 2, establishment of a method for detecting the genotype of SNP marker Affx-159065432 using KASP marker
[0097] The KASP marker KASP_KMC3 is used to detect the grain moisture content and dehydration rate of different allelic types at the physical position 204549490 of chromosome 3 of corn (SNP site Affx-159065432).
[0098] 1. PCR amplification system and procedure
[0099] The genomic DNA of the common corn leaf is extracted by the CTAB method and dissolved with 100 μL of ddH2O. The quality of the DNA is detected by 1% agarose gel electrophoresis, and the extracted DNA is required to have no obvious impurities, clear bands and no degradation. After the concentration of the DNA is measured, the corn genomic DNA after dilution is used as a template for PCR amplification.
[0100] Prepare the primer mix: 12 mM of primer A and primer B (see Example 1 for specific sequences), and 30 mM of primer C (see Example 1 for specific sequences).
[0101] PCR amplification reaction system (4 μL): PCR reagent composition: 2x KASP Mastermix volume 2 μL, primer mix volume 0.056 μL, genomic DNA concentration about 100 ng / μL, volume 1 μL, and ultrapure water to 4 μL.
[0102] The PCR reaction program is a Touchdown reaction program: 94°C pre-denaturation for 15 min, 94°C denaturation for 20 s, 61°C annealing for 60 s, 10 cycles of decreasing 0.6°C each cycle, 94°C denaturation for 20 s, 55°C annealing for 60 s, 32 cycles.
[0103] 2. Genotyping
[0104] After the completion of the PCR reaction, the end fluorescence reading was read in the enzyme marker FLUOstar Omega, and then the data was imported into the KlusterCaller software for genotyping. If the genotyping is not obvious, generally 3 cycles of additional genotyping are needed.
[0105] The FAM excitation wavelength is 485 nm, and the emission wavelength is 520 nm. The HEX excitation wavelength is 535 nm, and the emission wavelength is 556 nm. The system reference fluorescence ROX excitation wavelength is 575 nm, and the emission wavelength is 610 nm.
[0106] The results are shown in Figure 5 If only the fluorescence signal of the FAM group (blue fluorescence) is shown, the genotype of Affx-159065432 of the corn to be tested is AA (i.e., the SNP site Affx-159065432 in the corn genome is A homozygous type); if only the fluorescence signal of the HEX group (red fluorescence) is shown, the genotype of Affx-159065432 of the corn to be tested is GG (i.e., the SNP site Affx-159065432 in the corn genome is G homozygous type); if the green fluorescence signal is shown, the genotype of Affx-159065432 of the corn to be tested is AG (i.e., the SNP site Affx-159065432 in the corn genome is A and G heterozygous type); if yellow is shown, it is a failed material.
[0107] Example 3, Application of KASP_KMC3 in assisting the identification of corn kernel moisture content and dehydration rate and in corn breeding
[0108] In 2018 and 2019, 152 related population inbred lines were phenotyped in Guancun corn test base of Northwest A&F University in Yangling District of Xianyang City, Shaanxi Province. The completely randomized block design was used, with row length of 4.5 m, row spacing of 0.6 cm, and plant spacing of 20 cm. Normal field management was carried out, all single plants were self-pollinated, and the pollination date was recorded. The grain moisture content was determined by oven method at 35 days, 42 days, 49 days, and 56 days after pollination, and the grain dehydration rate was determined by AUDDC method. Grain moisture content (%) = [(W1-W2) / W1] x 100%.
[0109] Determination method: uniform fruiting ears were selected at 35 days, 42 days, 49 days, and 56 days after pollination, and immediately threshed after sampling. 100 intact kernels were weighed by electronic balance (unit 0.0001 g) to obtain fresh weight (W1), and then killed green in 105℃ oven for 30 min, and dried in 85℃ oven to constant weight (measured three times continuously, and the value was unchanged), and then measured dry weight (W2) and recorded. The weight was brought into the above formula to calculate the grain moisture content.
[0110] At the same time, the seedling stage was labeled for sampling, and the total DNA of corn leaves was extracted, and the KASP_KMC3 marker genotype detection method was referred to Example 2. The results are shown in Table 1. AA represents that the genotype of the SNP site Affx-159065432 of the corn material is AA, GG represents that the genotype of the SNP site Affx-159065432 of the corn material is GG, and AG represents that the genotype of the SNP site Affx-159065432 of the corn material is AG.
[0111] Table 1, KASP_KMC3 marker genotype and corn kernel moisture content and dehydration rate phenotype information of 152 related population inbred lines
[0112]
[0113]
[0114]
[0115]
[0116]
[0117] Note: Bad represents failed typing, and NA represents that no phenotype data was collected
[0118] The molecular marker KASP_KMC3 was used to determine the qKMC3 genotype, and the genotype of each single plant was obtained. The results showed (Table 1 and Figure 6):KASP marker detection, 152 association population inbred lines, 62 inbred lines for QTL qKMC3 allele type AA (i.e. SNP site Affx-159065432 genotype AA), the grain moisture content is 40.36 ± 3.82 (42 days after pollination), 35.48 ± 4.51 (49 days after pollination), and the grain dehydration rate is 265.10 ± 27.52 (42-49 days after pollination); 68 inbred lines for QTL qKMC3 allele type GG (SNP site Affx-159065432 genotype GG), the grain moisture content is 38.58 ± 3.42 (42 days after pollination), 33.43 ± 4.05 (49 days after pollination), and the grain dehydration rate is 252.30 ± 23.94 (42-49 days after pollination); 8 inbred lines for QTL qKMC3 allele type AG (SNP site Affx-159065432 genotype AG), the grain moisture content is 39.56 ± 4.07 (42 days after pollination), 36.10 ± 3.83 (49 days after pollination), and the grain dehydration rate is 264.83 ± 26.37 (42-49 days after pollination).
[0119] In addition, T test was conducted in combination with the grain moisture content and dehydration rate phenotypes of each inbred line, and the results showed that Figure 6 ) the grain moisture content of the inbred line carrying the GG genotype was significantly lower than that of the inbred line carrying the AA genotype (p value less than 0.01), and the grain dehydration rate was significantly faster than that of the inbred line carrying the AA genotype (p value less than 0.01) Figure 6 ) the grain moisture content of the inbred line carrying the AG genotype had no obvious difference with the grain moisture content and the grain dehydration rate of the inbred line carrying the AA genotype (p value greater than 0.05) Figure 6 ) the grain moisture content of the inbred line carrying the AG genotype had no obvious difference with the grain moisture content and the grain dehydration rate of the inbred line carrying the GG genotype (p value greater than 0.05). The above results show that the molecular marker can be used to eliminate inbred lines with slow dehydration in the field, which not only saves production costs, but also greatly improves selection efficiency, and thus inbred lines with fast grain dehydration can be quickly screened for subsequent breeding.
[0120] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application.
Claims
1. Application of substances for detecting SNP polymorphisms or genotypes in the maize genome in any of the following: (1) To identify or assist in the identification of corn kernel moisture content and / or dehydration rate; (2) Breeding for maize kernel moisture content and / or dehydration rate; (3) Prepare products for identification or auxiliary identification of corn kernel moisture content and / or dehydration rate; (4) To prepare products for breeding maize kernel moisture content and / or dehydration rate; The SNP site is a site on maize chromosome 3, and its nucleotide type is A or G, which is the 21st nucleotide of sequence 4 in the sequence listing. The genotype of the SNP locus is AA, AG, or GG, where AA is homozygous for SNP locus A, and GG is homozygous for SNP locus G; AG is heterozygous for SNP locus A and G. The kernel moisture content of the test corn with genotype GG at the SNP locus is lower than that of the test corn with genotypes AA and / or AG at the SNP locus, and / or the dehydration rate is faster than that of the test corn with genotypes AA and / or AG at the SNP locus.
2. The application according to claim 1, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying maize genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).
3. The application according to claim 2, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-42 of sequence 1 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-42 of sequence 2 in the sequence listing; The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.
4. A method for identifying or assisting in the identification of moisture content and / or dehydration rate of corn kernels, characterized in that: This includes detecting the genotype of SNP sites in the genome of the maize to be tested, and identifying or assisting in the identification of maize kernel moisture content and / or dehydration rate based on the genotype. The SNP site is a site on maize chromosome 3, and its nucleotide type is A or G, which is the 21st nucleotide of sequence 4 in the sequence listing. The genotype of the SNP site is AA, AG, or GG, where AA is homozygous for SNP site A, GG is homozygous for SNP site G, and AG is heterozygous for SNP sites A and G. The kernel moisture content of the maize to be tested with the genotype GG at the SNP site is lower than that of the maize to be tested with the genotypes AA and / or AG at the SNP site, and / or the dehydration rate is faster than that of the maize to be tested with the genotypes AA and / or AG at the SNP site.
5. The application of the method of claim 4 in breeding maize kernel moisture content and / or dehydration rate.
6. A method for breeding maize, characterized by: The method includes detecting the genotype of the SNP locus in claim 1 in the maize genome, selecting maize with the genotype GG at the SNP locus as a parent for breeding, wherein GG is a homozygous type of the SNP locus G; the purpose of the breeding is to select maize inbred lines with fast kernel dehydration.