An electrochemiluminescence sensor for detecting aflatoxin b1 and zearalenone and a preparation method and application thereof

An electrochemiluminescence sensor, which self-assembles DNA tetrahedra and signal probes on a gold electrode, was developed to achieve rapid and sensitive detection of AFB1 and ZEN in Coix seed using N-CDs and ZIF-8 composite materials. This solves the problem of difficulty in detecting large batches of samples in existing technologies and improves the accuracy and stability of the detection.

CN119555770BActive Publication Date: 2025-11-21CAPITAL UNIVERSITY OF MEDICAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411735815.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-29
Publication Date
2025-11-21
Estimated Expiration
2044-11-29

AI Technical Summary

Technical Problem

Existing technologies lack methods for rapid and sensitive detection of aflatoxin B1 (AFB1) and zearalenone (ZEN) in coix seed, especially in the detection of large batches of samples in the distribution center of Chinese medicinal materials, making it difficult to achieve low-cost and rapid detection.

Method used

An electrochemiluminescence sensor employing DNA tetrahedra self-assembled on a gold electrode, along with AFB1 and ZEN signal probes, utilizes nitrogen-doped carbon dots (N-CDs) as a signal source and ZIF-8 as a signal enhancement unit. Based on the aptamer-target binding reaction, the sensor's sensitivity is improved.

Benefits of technology

This method enables the simultaneous and rapid detection of AFB1 and ZEN in coix seed. It is simple to operate, highly sensitive, and has good detection accuracy and stability, making it suitable for rapid on-site detection of Chinese medicinal materials and food safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119555770B_ABST
    Figure CN119555770B_ABST
Patent Text Reader

Abstract

The application provides an electrochemiluminescence sensor for detecting AFB1 and ZEN and a preparation method and application thereof, relates to the technical field of analytical chemistry, and comprises a DNA tetrahedron and AFB1 signal probes and ZEN signal probes which are self-assembled on a gold electrode; the AFB1 signal probe comprises AFB1 aptamer and N-CDs1 / ZIF-8 composite materials; the ZEN signal probe comprises ZEN aptamer and N-CDs2 / ZIF-8 composite materials; the DNA tetrahedron is combined by four single-stranded DNAs, two kinds of nitrogen-doped carbon dots (N-CDs) are used as signal sources, the DNA tetrahedron (DTN) is used as a carrier, ZIF-8 is used as a signal enhancement unit, the high specificity of the binding reaction between aptamer and a target is used as the basis, the sensitivity of the sensor is improved, and the AFB1 and ZEN in coix seed are simultaneously and rapidly detected. The application has the advantages of simple operation, high sensitivity, improved detection accuracy and stability.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of analytical chemistry, in particular to an electrochemiluminescence sensor for detecting AFB1 and ZEN, a preparation method thereof and application thereof. BACKGROUND

[0002] With the accelerating development trend of population aging, sub-health and chronic diseases, "nourishing" and "prevention" have become the focus of people's daily health care. Among them, the "medicinal food health preservation concept" has attracted much attention and recognition, which has led to an increasing demand for "medicinal food" Chinese herbal medicines. Especially for the seed of Job's tears, which has important edible value and medicinal functions of promoting water excretion and dampness, and invigorating the spleen and stopping diarrhea, as a commonly used "medicinal food" Chinese herbal medicine, it is easily contaminated by mycotoxins during its growth, harvesting, processing and storage, among which the contamination rate and detection rate of aflatoxin B1 (AFB1) and zearalenone (ZEN) are the highest. AFB1 and ZEN are common mycotoxins in food, Chinese herbal medicines and "medicinal food" Chinese herbal medicines, which have great toxicity although their content is low, and may cause irreversible acute and chronic toxicity to the human body. Therefore, it is of great significance to develop a sensitive and accurate method for rapid detection of the contamination level of AFB1 and ZEN in a large number of seed of Job's tears, to ensure the quality and safety of the seed of Job's tears and the physical and mental health of consumers.

[0003] The current detection method (such as high performance liquid chromatography and liquid chromatography-mass spectrometry) of mycotoxins in Chinese herbal medicines usually relies on large and expensive instruments and professional operators, and is mostly limited to laboratory use, making it difficult to achieve low-cost rapid detection of AFB1 and ZEN in a large number of seed of Job's tears in the collection and distribution places of Chinese herbal medicines. Therefore, it is urgent to develop a practical and sensitive and accurate on-site rapid detection method.

[0004] In view of this, the present application is proposed. SUMMARY

[0005] One of the purposes of the present application is to provide an electrochemiluminescence sensor for detecting AFB1 and ZEN, so as to solve the technical problem that there is no method for rapidly and simultaneously detecting AFB1 and ZEN in the prior art.

[0006] The second purpose of the present application is to provide a preparation method of the electrochemiluminescence sensor.

[0007] The third purpose of the present application is to provide a method for detecting AFB1 and ZEN.

[0008] In order to achieve the above purposes of the present application, the following technical solutions are adopted:

[0009] In a first aspect, the present application provides an electrochemiluminescence sensor for detecting AFB1 and ZEN, comprising a DNA tetrahedron and AFB1 signal probes and ZEN signal probes self-assembled on a gold electrode.

[0010] The AFB1 signal probes comprise AFB1 aptamers and N-CDs1 / ZIF-8 composite materials.

[0011] The ZEN signal probes comprise ZEN aptamers and N-CDs2 / ZIF-8 composite materials.

[0012] The DNA tetrahedron is formed by combining four single-stranded DNAs.

[0013] Further, the nucleotide sequence of the AFB1 aptamer is shown in SEQ ID NO: 1, and the nucleotide sequence of the ZEN aptamer is shown in SEQ ID NO: 2.

[0014] Preferably, the four single-stranded DNAs comprise A chain, B chain, C chain and D chain, the nucleotide sequence of the A chain is shown in SEQ ID NO: 3, the nucleotide sequence of the B chain is shown in SEQ ID NO: 4, the nucleotide sequence of the C chain is shown in SEQ ID NO: 5, and the nucleotide sequence of the D chain is shown in SEQ ID NO: 6.

[0015] In a second aspect, the present application provides a preparation method of the electrochemiluminescence sensor, comprising modifying AFB1 signal probes and ZEN signal probes on a gold electrode with a DNA tetrahedron fixed thereon to obtain the electrochemiluminescence sensor.

[0016] Further, the preparation method comprises adding a DNA tetrahedron solution to the gold electrode treated with the alumina slurry for incubation, adding a 6-mercapto-1-hexanol solution after the incubation is completed, and then adding AFB1 signal probe solution and ZEN signal probe solution for incubation to obtain the electrochemiluminescence sensor.

[0017] Preferably, the preparation method of the alumina slurry comprises taking alumina powders with particle sizes of 0.3 μm and 0.05 μm respectively, placing them on the surface of a polishing cloth, adding a small amount of ultrapure water to make them into a slurry state, and obtaining the alumina slurry.

[0018] Preferably, the concentration of the DNA tetrahedron solution is 0.5-1.5 μM, and preferably 1.0 μM.

[0019] Preferably, the concentration of the 6-mercapto-1-hexanol solution is 8-12 mM, and preferably 10 mM.

[0020] Preferably, the concentration of the AFB1 signal probe solution is 2.0-3.0 mg / mL, preferably 2.5 mg / mL;

[0021] Preferably, the concentration of the ZEN signal probe solution is 2.0-3.0 mg / mL, preferably 2.5 mg / mL;

[0022] Preferably, the volume ratio of the added DNA tetrahedron solution, 6-mercapto-1-hexanol solution, AFB1 signal probe solution and ZEN signal probe solution is 7-12:7-12:7-12:7-12, preferably 10:10:10:10;

[0023] Preferably, the incubation temperature of the added DNA tetrahedron solution and the added AFB1 signal probe solution and ZEN signal probe solution is independently 35-40°C, preferably 37°C;

[0024] Preferably, the incubation time of the added DNA tetrahedron solution and the added AFB1 signal probe solution and ZEN signal probe solution is independently at least 1 h;

[0025] Preferably, after the incubation, the electrode is further rinsed with a buffer and dried;

[0026] Preferably, the preparation method of the DNA tetrahedron comprises mixing four single-stranded DNAs to self-assemble into a DNA tetrahedron;

[0027] Preferably, the concentration of the four single-stranded DNAs in the self-assembly system is independently 3-8 μM, preferably 5 μM.

[0028] Further, the preparation method of the AFB1 signal probe comprises adding AFB1 aptamer to the prepared N-CDs1 / ZIF-8 composite material, and incubating to obtain the AFB1 signal probe;

[0029] The preparation method of the ZEN signal probe comprises adding ZEN aptamer to the prepared N-CDs2 / ZIF-8 composite material, and incubating to obtain the AFB1 signal probe;

[0030] Preferably, when the N-CDs1 / ZIF-8 composite material is incubated with the AFB1 aptamer, the concentration of the N-CDs1 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL; the concentration of the AFB1 aptamer is 3-8 μM, preferably 5 μM; and the volume ratio of the N-CDs1 / ZIF-8 composite material to the AFB1 aptamer is 1:1;

[0031] Preferably, the concentration of the N-CDs2 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL, and the concentration of the ZEN aptamer is 3-8 μM, preferably 5 μM, when the N-CDs2 / ZIF-8 composite material is incubated with the ZEN aptamer; and the volume ratio of the N-CDs1 / ZIF-8 composite material to the ZEN aptamer is 1:1.

[0032] Further, the preparation method of the N-CDs1 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs1 and incubating in the dark, and then standing, centrifuging, discarding the supernatant, and drying to obtain the N-CDs1 / ZIF-8 composite material.

[0033] The preparation method of the N-CDs2 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs2 and incubating in the dark, and then standing, centrifuging, discarding the supernatant, and drying to obtain the N-CDs2 / ZIF-8 composite material.

[0034] Preferably, the mass concentration ratio of ZIF-8 to N-CDs1 is 1:1.5-2.5, preferably 1:2.

[0035] Preferably, the mass concentration ratio of ZIF-8 to N-CDs2 is 1:1.5-2.5, preferably 1:2.

[0036] Preferably, the incubation temperature in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 23-30°C, preferably 25°C.

[0037] Preferably, the incubation time in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 10-14 h, preferably 12 h.

[0038] Preferably, the standing time is 8-12 min, preferably 10 min.

[0039] Preferably, after centrifugation, the precipitate is washed with water at least 3 times.

[0040] Further, the preparation method of the N-CDs1 comprises dissolving citric acid and urea in water, placing the mixed solution in a reaction kettle, reacting at 160°C, cooling to room temperature after the reaction is completed, dialysis, and drying to obtain N-CDs1.

[0041] Preferably, the mass concentration ratio of citric acid to urea is 1:1.5-2.5, preferably 1:2.

[0042] Preferably, the reaction time in the preparation method of the N-CDs1 is 3-5h, preferably 4h.

[0043] Preferably, the preparation method of the N-CDs2 comprises dissolving citric acid in dimethylformamide, adding hydrazine hydrate to form a milky white gel, placing the milky white gel in a reaction kettle, reacting at 180℃, cooling to room temperature after reaction, centrifuging, taking the supernatant, dialysis, and drying to obtain N-CDs2.

[0044] Preferably, the mass concentration of the citric acid in dimethylformamide is 0.1-0.3g / mL, preferably 0.21g / mL.

[0045] Preferably, the volume ratio of the hydrazine hydrate to dimethylformamide is 1:9-11; preferably 1:10.

[0046] Preferably, the reaction time in the preparation method of the N-CDs2 is 10-14h, preferably 12h.

[0047] Preferably, the drying temperature is 50℃-65℃, preferably 60℃.

[0048] Preferably, the drying is vacuum drying.

[0049] Preferably, the centrifugation speed is 8000-12000rpm, preferably 10000rpm.

[0050] Preferably, the centrifugation time is 8-12min, preferably 10min.

[0051] Further, the preparation method of the ZIF-8 comprises mixing a methyl imidazole aqueous solution and a zinc acetate dihydrate aqueous solution, reacting at room temperature, centrifuging and drying after the reaction is completed to obtain ZIF-8.

[0052] Preferably, the concentration of the methyl imidazole aqueous solution is 1.3-1.8mol / L, preferably 1.5mol / L.

[0053] Preferably, the concentration of the zinc acetate dihydrate aqueous solution is 22-28mmol / L, preferably 25mmol / L.

[0054] Preferably, the volume ratio of the methyl imidazole aqueous solution to the zinc acetate dihydrate aqueous solution is 10:1-8:1, preferably 9:1.

[0055] Preferably, the reaction time of the methyl imidazole aqueous solution and the zinc acetate dihydrate aqueous solution is 4-6h, preferably 5h.

[0056] In a third aspect, the present application provides a method for detecting AFB1 and ZEN, wherein a sample solution to be detected is added to the electrochemiluminescence sensor or the electrochemiluminescence sensor, and after incubation, the electrochemiluminescence signal is detected by taking the gold electrode as a working electrode.

[0057] Further, the incubation time of the sample solution to be detected is 15-25 min, preferably 20 min.

[0058] The incubation temperature of the sample solution to be detected is 25-40℃, preferably 37℃.

[0059] The detection of the electrochemiluminescence signal comprises placing the working electrode, auxiliary electrode and reference electrode in the electrochemiluminescence reaction solution, and detecting the electrochemiluminescence signal by cyclic voltammetry.

[0060] Preferably, the electrochemiluminescence reaction solution comprises K2S2O8 with a concentration of 0.05-0.15 M and H2O2 with a concentration of 0.005-0.015 M, and the solvent is 0.1 M PBS buffer, preferably K2S2O8 with a concentration of 0.1 M and H2O2 with a concentration of 0.01 M.

[0061] Preferably, the pH of the electrochemiluminescence reaction solution is 6.2-7.4, preferably 7.4.

[0062] Preferably, the scanning voltage of the cyclic voltammetry is 0.8-(-1.6) V.

[0063] Preferably, the scanning speed of the cyclic voltammetry is 80-120 mV / s, preferably 100 mV / s.

[0064] Preferably, the photomultiplier voltage is 800 V.

[0065] The electrochemiluminescence sensor for detecting AFB1 and ZEN provided by the present application takes two nitrogen-doped carbon dots (N-CDs) with excellent electrochemiluminescence (ECL) performance and environmental friendliness as a signal source, DNA tetrahedron (DTN) as a carrier, and ZIF-8 as a signal enhancement unit, improves the sensitivity of the sensor based on the high specificity of the binding reaction between the aptamer and the target, and realizes the simultaneous rapid detection of AFB1 and ZEN in coix seed. On the other hand, the preparation method of the electrochemiluminescence sensor for detecting AFB1 and ZEN constructs a pyramid-shaped ECL aptamer sensor, which is simple to operate, high in sensitivity, and can realize the simultaneous rapid detection of AFB1 and ZEN in coix seed. The method for detecting AFB1 and ZEN provided by the other aspect can be used for the simultaneous detection of AFB1 and ZEN in the sample to be detected, and the method is simple, specific, improves the accuracy and stability of the detection. BRIEF DESCRIPTION OF DRAWINGS

[0066] In order to more clearly illustrate the technical solutions in the specific embodiments or prior art of the present application, the drawings required to be used in the specific embodiments or prior art description will be briefly introduced as follows. Obviously, the drawings described below are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0067] Figure 1 A preparation and detection principle diagram of an electrochemiluminescence sensor for detecting AFB1 and ZEN provided for Embodiment 1 of the present application;

[0068] Figure 2 An ECL signal reaction diagram and a standard curve diagram of AFB1 and ZEN with different concentrations provided for Embodiment 5 of the present application;

[0069] Figure 3 A specificity comparison diagram of the electrochemiluminescence sensor for detecting AFB1 and ZEN provided for Embodiment 5 of the present application;

[0070] Figure 4 A reproducibility evaluation diagram of the electrochemiluminescence sensor for detecting AFB1 and ZEN provided for Embodiment 5 of the present application;

[0071] Figure 5 A stability evaluation diagram of the electrochemiluminescence sensor for detecting AFB1 and ZEN provided for Embodiment 5 of the present application. DETAILED DESCRIPTION

[0072] Unless otherwise defined, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art. Clear indications to the contrary are needed to establish that any term in the specification does not retain its ordinary meaning. In this application, the use of "or" means "and / or" unless specifically stated otherwise. Moreover, the use of the term "including" as well as other forms, such as "include", is not limiting.

[0073] The methods and techniques of the present application are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Ausubel et al., 1999, Short Protocols in Molecular Biology, 4th Ed., John Wiley & Sons, Inc. New York, NY.

[0074] In one aspect, the present application provides an electrochemiluminescence sensor for detecting AFB1 and ZEN, which comprises a DNA tetrahedron and AFB1 signal probes and ZEN signal probes self-assembled on a gold electrode.

[0075] The AFB1 signal probe comprises an AFB1 aptamer and an N-CDs1 / ZIF-8 composite material.

[0076] The ZEN signal probe comprises a ZEN aptamer and an N-CDs / ZIF-8 composite material.

[0077] The DNA tetrahedron is combined by four single-stranded DNAs.

[0078] The electrochemiluminescence sensor uses two nitrogen-doped carbon dots (N-CDs) as a signal source, which have excellent electrochemiluminescence (ECL) performance and are environmentally friendly, uses a DNA tetrahedron (DTN) as a carrier, and uses ZIF-8 as a signal enhancement unit. Based on the high specificity of the binding reaction between the aptamer and the target, the sensitivity of the sensor is improved, and the simultaneous rapid detection of AFB1 and ZEN in coix seed is realized. This is conducive to the smooth progress of the detection of mycotoxins in traditional Chinese medicines, promotes the development of the traditional Chinese medicine quality inspection industry, and also provides a general tool for the analysis of various trace components in the field of food safety and environmental monitoring.

[0079] In some specific embodiments, the nucleotide sequence of the AFB1 aptamer is shown as SEQ ID NO: 1, and the nucleotide sequence of the ZEN aptamer is shown as SEQ ID NO: 2.

[0080] In some specific embodiments, the four single-stranded DNAs comprise A, B, C and D chains, the nucleotide sequence of the A chain is shown as SEQ ID NO: 3, the nucleotide sequence of the B chain is shown as SEQ ID NO: 4, the nucleotide sequence of the C chain is shown as SEQ ID NO: 5, and the nucleotide sequence of the D chain is shown as SEQ ID NO: 6.

[0081] According to another aspect of the present application, a preparation method of the electrochemiluminescence sensor is also provided, which comprises modifying AFB1 signal probes and ZEN signal probes on a gold electrode fixed with a DNA tetrahedron to obtain the electrochemiluminescence sensor.

[0082] The pyramid-shaped ECL aptamer sensor is constructed by using a DNA tetrahedron (DTN) as a carrier, ZIF-8 as a signal enhancement unit, and nitrogen-doped carbon dots (N-CDs) as a signal source. Based on the high specificity of the binding reaction between the aptamer and the target, the sensor is simple to operate, has high sensitivity, and can realize the simultaneous rapid detection of AFB1 and ZEN in coix seed.

[0083] In some specific embodiments, the preparation method comprises adding a DNA tetrahedron solution to the gold electrode treated with an alumina slurry solution for incubation, adding a 6-mercapto-1-hexanol solution after the incubation is completed, and then adding AFB1 signal probe solution and ZEN signal probe solution for incubation to obtain the electrochemiluminescence sensor.

[0084] In some specific embodiments, the method for preparing the alumina slurry includes taking alumina powder with particle sizes of 0.3 μm and 0.05 μm respectively, placing it on the surface of a polishing cloth, adding a small amount of ultrapure water to make it into a slurry state, and obtaining the alumina slurry.

[0085] In some specific embodiments, the concentration of the DNA tetrahedral solution is 0.5–1.5 μM. However, with further increases in DTN concentration, the ECL signal intensities of N-CDs1 and N-CDs2 did not change significantly. In some specific embodiments, the concentration of the DNA tetrahedral solution is preferably 1.0 μM.

[0086] In some specific embodiments, the concentration of the 6-mercapto-1-hexanol solution is 8-12 mM, preferably 10 mM.

[0087] In some specific embodiments, the concentration of the AFB1 signal probe solution is 2.0–3.0 mg / mL, preferably 2.5 mg / mL. The concentration of the ZEN signal probe solution is 2.0–3.0 mg / mL, preferably 2.5 mg / mL.

[0088] In some specific embodiments, the volume ratio of the added DNA tetrahedral solution, 6-mercapto-1-hexanol solution, AFB1 signal probe solution and ZEN signal probe solution is 7-12:7-12:7-12:7-12, preferably 10:10:10:10.

[0089] In some specific embodiments, the incubation temperatures for the DNA tetrahedral solution, the AFB1 signal probe solution, and the ZEN signal probe solution are each independently set at 35°C to 40°C, preferably 37°C. Incubation is a crucial factor in the binding of the signal probes Apt1 / N-CDs1 / ZIF-8 and Apt2 / N-CDs2 / ZIF-8 to DTN, and its influence can be assessed by detecting the ECL signal intensity. Experiments have shown that when the signal probes are incubated on AuE for 60 min, the ECL signal intensity values ​​of N-CDs1 and N-CDs2 are close to reaching the plateau phase. In some specific embodiments, the incubation times for the DNA tetrahedral solution, the AFB1 signal probe solution, and the ZEN signal probe solution are each independently set at least 1 h.

[0090] The incubation process also includes rinsing the electrode with a buffer solution and drying it.

[0091] In some specific embodiments, the method for preparing the DNA tetrahedron includes mixing four single-stranded DNA molecules and self-assembling them into a DNA tetrahedron. Specifically, the concentration of each of the four single-stranded DNA molecules in the self-assembly system is independently 3–8 μM, preferably 5 μM.

[0092] In some specific embodiments, the preparation method of the AFB1 signal probe comprises adding AFB1 aptamer to the prepared N-CDs1 / ZIF-8 composite material, and incubating to obtain the AFB1 signal probe.

[0093] The preparation method of the ZEN signal probe comprises adding ZEN aptamer to the prepared N-CDs2 / ZIF-8 composite material, and incubating to obtain the AFB1 signal probe.

[0094] In some specific embodiments, when the N-CDs1 / ZIF-8 composite material is incubated with the AFB1 aptamer, the concentration of the N-CDs1 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL; the concentration of the AFB1 aptamer is 3-8 μM, preferably 5 μM; and the volume ratio of the N-CDs1 / ZIF-8 composite material to the AFB1 aptamer is 1:1.

[0095] In some specific embodiments, when the N-CDs2 / ZIF-8 composite material is incubated with the ZEN aptamer, the concentration of the N-CDs2 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL; the concentration of the ZEN aptamer is 3-8 μM, preferably 5 μM; and the volume ratio of the N-CDs1 / ZIF-8 composite material to the ZEN aptamer is 1:1.

[0096] In some specific embodiments, the preparation method of the N-CDs1 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs1 and incubating in the dark, and then standing, centrifuging, discarding the supernatant, and drying to obtain the N-CDs1 / ZIF-8 composite material; and the preparation method of the N-CDs2 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs2 and incubating in the dark, and then standing, centrifuging, discarding the supernatant, and drying to obtain the N-CDs2 / ZIF-8 composite material.

[0097] In some specific embodiments, the mass concentration ratio of the ZIF-8 to the N-CDs1 is 1:1.5-2.5, preferably 1:2; and the mass concentration ratio of the ZIF-8 to the N-CDs2 is 1:1.5-2.5, preferably 1:2.

[0098] In some specific embodiments, the incubation temperature in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 23-30°C, preferably 25°C.

[0099] In some specific embodiments, the incubation time in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 10-14h, preferably 12h.

[0100] In some specific embodiments, the standing time is 8-12min, preferably 10min.

[0101] In some specific embodiments, the centrifugation is further followed by washing the precipitate with water for at least 3 times.

[0102] In some specific embodiments, the preparation method of the N-CDs1 comprises dissolving citric acid and urea in water, placing the mixed solution in a reaction kettle, reacting at 160℃, cooling to room temperature after the reaction is completed, dialysis, and drying to obtain N-CDs1.

[0103] In some specific embodiments, the preparation method of the N-CDs1 comprises dissolving citric acid and urea in water, placing the mixed solution in a reaction kettle, reacting at 160℃, cooling to room temperature after the reaction is completed, dialysis, and drying to obtain N-CDs1.

[0104] In some specific embodiments, the preparation method of the N-CDs2 comprises dissolving citric acid in dimethylformamide, adding hydrazine hydrate to form a milky white gel, placing the milky white gel in a reaction kettle, reacting at 180℃, cooling to room temperature after the reaction, centrifuging, taking the supernatant, dialysis, and drying to obtain N-CDs2.

[0105] In some specific embodiments, the mass concentration of citric acid in dimethylformamide is 0.1-0.3g / mL, preferably 0.21g / mL.

[0106] In some specific embodiments, the volume ratio of hydrazine hydrate to dimethylformamide is 1:9-11; preferably 1:10.

[0107] In some specific embodiments, the reaction time in the preparation method of the N-CDs2 is 10-14h, preferably 12h.

[0108] In some specific embodiments, the drying temperature is 50℃-65℃, preferably 60℃.

[0109] In some specific embodiments, the drying is vacuum drying.

[0110] In some specific embodiments, the centrifugation speed is 8000-12000rpm, preferably 10000rpm.

[0111] In some specific embodiments, the centrifugation time is 8-12min, preferably 10min.

[0112] In some specific embodiments, the method for preparing ZIF-8 comprises mixing a methyl imidazole aqueous solution and a zinc acetate dihydrate aqueous solution, reacting at room temperature, centrifuging and drying after the reaction to obtain ZIF-8.

[0113] The concentration of the methyl imidazole aqueous solution is 1.3-1.8 mol / L, preferably 1.5 mol / L. The concentration of the zinc acetate dihydrate aqueous solution is 22-28 mol / L, preferably 25 mol / L. The volume ratio of the methyl imidazole aqueous solution to the zinc acetate dihydrate aqueous solution is 10:1-8:1, preferably 9:1. The reaction time of the methyl imidazole aqueous solution and the zinc acetate dihydrate aqueous solution is 4-6 h, preferably 5 h.

[0114] According to another aspect of the present application, a method for detecting AFB1 and ZEN is also provided, wherein a sample solution to be detected is added to the electrochemiluminescence sensor or the electrochemiluminescence sensor described above for incubation, and the electrochemiluminescence signal is detected after incubation with the gold electrode as the working electrode.

[0115] The method can be used for simultaneous detection of AFB1 and ZEN in a sample to be detected, and is simple, specific, and improves the accuracy and stability of detection.

[0116] In some specific embodiments, the incubation time of the sample solution to be detected is 15-25 min, preferably 20 min.

[0117] The incubation temperature of the sample solution to be detected is 25-40℃, preferably 37℃.

[0118] The detection of the electrochemiluminescence signal comprises placing the working electrode, the auxiliary electrode and the reference electrode in the electrochemiluminescence reaction solution, and detecting the electrochemiluminescence signal by cyclic voltammetry.

[0119] In some specific embodiments, the electrochemiluminescence reaction solution comprises K2S2O8 with a concentration of 0.05-0.15 M and H2O2 with a concentration of 0.005-0.015 M, and the solvent is 0.1 M PBS buffer, preferably K2S2O8 with a concentration of 0.1 M and H2O2 with a concentration of 0.01 M.

[0120] The ECL performance of the carbon dots is closely related to the pH value of the co-reaction system. Experiments have proved that the ECL signal increases as the pH increases from 6.2 to 7.4, and decreases as the pH exceeds 7.4. In some specific embodiments, the pH of the electrochemiluminescence reaction solution is 6.2-7.4, preferably 7.4.

[0121] In some specific embodiments, the scan voltage of the cyclic voltammetry is 0.8-1.6V.

[0122] In some specific embodiments, the scan speed of the cyclic voltammetry is 80-120mV / s, preferably 100mV / s.

[0123] In some specific embodiments, the photoelectric multiplication voltage is 800V.

[0124] The technical solutions of the present application will be described clearly and completely in combination with the embodiments. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0125] 1. Instrument

[0126] MPI-E II type ECL detector: Xi'an Remex Analytical Instrument Co., Ltd.

[0127] CHI660E EC detector: Shanghai Chenhua Instrument Co., Ltd.

[0128] MS105DU analytical balance: Mettler-Toledo Company, Switzerland

[0129] Eppendorf N13462C pipette: Eppendorf Company, Germany

[0130] TGL type centrifuge: Yancheng Kate Company

[0131] DHG-9053A electric heating constant temperature blast drying oven: Shanghai Jinghong Experimental Equipment Co., Ltd.

[0132] VORTEX-vortex mixer: Shanghai Dam Company

[0133] KQ-300E ultrasonic cleaner: Kunshan Ultrasonic Instrument Co., Ltd.

[0134] pH meter: Sartorius Company, Germany

[0135] Transmission electron microscope: FEI Company, USA

[0136] Scanning electron microscope: FEI Company, USA

[0137] Fluorescence spectrophotometer: Shanghai Techcomp Company

[0138] X-ray diffractometer: Bruker Company, Germany

[0139] 2. Materials:

[0140] Ammonium acetate dihydrate: Shanghai Aladdin Bio-Chem Technology Co., Ltd.

[0141] 2-methylimidazole: Shanghai Aladdin Bio-Chem Technology Co., Ltd.

[0142] Hydrazine hydrate: Shanghai Aladdin Bio-Chem Technology Co., Ltd.

[0143] Citric acid: Shanghai Macklin Biochemical Technology Co., Ltd.

[0144] Urea: Shanghai Macklin Biochemical Technology Co., Ltd.

[0145] EDC-HCl: Afaesa

[0146] N-hydroxysuccinimide (NHS): Afaesa

[0147] Mercaptohexanol (MCH): Beijing Yuan Ye Biotechnology Co., Ltd.

[0148] 0.1M MES buffer: Beijing Coolab Technology Co., Ltd.

[0149] 10×PBS: Beijing Solabio Technology Co., Ltd.

[0150] Potassium persulfate: Shanghai Aladdin Bio-Chem Technology Co., Ltd.

[0151] Potassium ferricyanide: Shanghai Aladdin Bio-Chem Technology Co., Ltd.

[0152] 3. The DNA strands were purchased from Beijing Xindai Zhonghe Technology Co., Ltd., and the sequences are as follows (from 5' to 3'):

[0153] AFB1 aptamer (hereinafter referred to as Apt1) sequence (5'-3'):

[0154] NH2-(CH2)6-CACGTGTTGTCTCTCTGTGTCTCGTG (SEQ ID NO: 1);

[0155] ZEN aptamer (hereinafter referred to as Apt2) sequence (5'-3'):

[0156] NH2-(CH2)6-TCATCTATCTATGGTACATTACTATCTGTAATGTGATAT G (SEQ ID NO: 2);

[0157] The sequences of the four strands of the DNA tetrahedron are as follows:

[0158] A strand (5'-3'):

[0159] HS-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAG AGCCGCCATAGTATTTTTCACGAGACACAGAGTTTTTTTTTTCATATCA CATTACAGATAGT (SEQ ID NO: 3);

[0160] B strand (5'-3'):

[0161] HS-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGC GAGGGTCCAATAC (SEQ ID NO: 4);

[0162] C strand (5'-3'):

[0163] HS-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACT ATGGCGGCTCTTC (SEQ ID NO: 5);

[0164] D strand (5'-3'):

[0165] HS-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT (SEQ ID NO: 6).

[0166] wherein HS is a mercapto group.

[0167] The following example is an experiment for simultaneous detection of aflatoxin B1 and zearalenone in coix seed based on an ECL sensor.

[0168] Example 1

[0169] Binding Figure 1 The preparation and detection of the electrochemiluminescence sensor for detecting AFB1 and ZEN are described.

[0170] 1. Preparation of N-CDs1 and N-CDs2

[0171] Preparation of N-CDs1: 1.0 g of citric acid and 2.0 g of urea were dissolved in 10 mL of ultrapure water, and the mixed solution was transferred to a polytetrafluoroethylene hydrothermal reactor, heated in an oven at 160°C for 4 h, and after sufficient reaction, the mixture was cooled to room temperature and dialyzed with a dialysis bag (MWCO = 1000) for 48 h to remove small molecular impurities. The obtained N-CDs solution was vacuum dried at 60°C, and the obtained brown-black powder was stored in a sealed container, protected from light, for standby use.

[0172] Preparation of N-CDs2: First, 2.1 g of citric acid was dissolved in 10 mL of DMF and continuously stirred, and then 1.0 mL of hydrazine hydrate was added dropwise. It can be observed that the colorless solution turns into a milky white gel, and then the milky white gel is transferred to a stainless steel high-pressure reaction kettle for a solvothermal reaction. The brown solution in the reaction kettle is centrifuged (10000 rpm for 10 min) to remove large particle residues after heating at 180°C for 12 h and cooling to room temperature. The upper layer brown solution is dialyzed in deionized water and vacuum dried at 60°C. The obtained brown-black powder is stored in a sealed container and kept away from light for standby use.

[0173] 2. Preparation of ZIF-8

[0174] 0.2463 g of 2-methylimidazole was weighed and prepared into a 2 mL aqueous solution with a concentration of 1.5 mol / L; 0.01097 g of zinc acetate dihydrate was weighed and prepared into a 2 mL aqueous solution with a concentration of 25 mmol / L. After mixing 1.8 mL of 2-methylimidazole aqueous solution and 200 μL of zinc acetate dihydrate aqueous solution uniformly, a magnetic stirrer was used for reaction at room temperature for 5 h. White precipitate was obtained by centrifugation (10000 rpm for 10 min), washed with ultrapure water for 3 times and centrifuged (10000 rpm for 10 min), and then the precipitate was dried at 60°C to obtain white powder, which was ZIF-8.

[0175] 3. Preparation of N-CDs1 / ZIF-8 and N-CDs2 / ZIF-8

[0176] 5 mg of ZIF-8 powder was weighed and added into 2 mL of ultrapure water to dissolve and mix to prepare a suspension. Then, 10 mg of N-CDs1 and 10 mg of N-CDs2 powder were added respectively, and incubated at room temperature for 12 h in the dark. After standing for 10 min, brown-black powder was obtained by centrifugation (10000 rpm for 10 min), and the obtained precipitate was washed with ultrapure water for 3 times and vacuum dried at 60°C to obtain N-CDs1 / ZIF-8 and N-CDs2 / ZIF-8 luminescent complexes respectively, which were stored under dry and dark conditions.

[0177] 4. Preparation of DNA tetrahedron

[0178] The centrifuge tube containing DNA strands (A strand, B strand, C strand, D strand) was taken out from the -20 °C refrigerator, and after standing at room temperature for 15 min, centrifugation was performed (4000 rpm for 20 min), and the required volume of TE buffer was added according to the instructions on the centrifuge tube, mixed, and a solution with a concentration of 10 μM was prepared. In the PCR tube, 1 μL of 500 mM TCEP solution and 9 μL of TM buffer were added in turn, and then 10 μL of A strand, B strand, C strand and D strand solution were added in turn, and then blown evenly. The PCR tube was placed in the PCR instrument, and the synthesis of the DNA tetrahedron was performed according to the set program. The PCR program was: first heated to 95 °C, then cooled to 60 °C, kept for 10 min, and finally cooled to 4 °C. The synthesis result was verified by agarose gel electrophoresis.

[0179] 5. Construction of ECL sensor based on "N-CDs / ZIF-8 and DNA tetrahedron"

[0180] Before assembling the gold electrode, it was pretreated with an alumina slurry. 10 μL of DNA tetrahedron solution was added to the surface of the pretreated Au electrode, and incubated at 37 °C for 1 h, and then 10 mM 6-mercapto-1-hexanol (MCH) solution was added to block the non-specific sites on the electrode surface. The N-CDs1 / ZIF-8 composite material with a concentration of 2.5 mg / mL was mixed with the AFB1 aptamer with a concentration of 5 μM at a volume ratio of 1:1, and then incubated to obtain the AFB1 capture probe Apt1 / N-CDs1 / ZIF-8. The N-CDs2 / ZIF-8 composite material with a concentration of 2.5 mg / mL was mixed with the ZEN aptamer with a concentration of 5 μM at a volume ratio of 1:1, and then incubated to obtain the ZEN capture probe Apt2 / N-CDs2 / ZIF-8. Then, 10 μL of Apt1 / N-CDs1 / ZIF-8 and Apt2 / N-CDs2 / ZIF-8 solution was added, and incubated at 37 °C for 1 h to obtain the ECL sensor. After each assembly step, the electrode was rinsed with PBS solution (0.01 M, pH 7.4) and dried at room temperature.

[0181] 6. Detection

[0182] 1) Add the sample solution to be tested, and incubate at 37 °C for 20 min to capture the target AFB1 and ZEN.

[0183] 2) ECL signal detection: A three-electrode detection system was used, in which the modified Au electrode was used as the working electrode, the platinum wire (Pt) electrode was used as the auxiliary electrode, and the saturated calomel electrode (SCE) was used as the reference electrode. When testing the ECL signal, the three electrodes were vertically placed in the detection cell containing the ECL reaction solution (0.1 M pH 7.4 PBS buffer containing 0.1 M K2S2O8 and 0.01 M H2O2). The ECL signal was detected by cyclic voltammetry (CV) at a scan voltage of 0.8 V to -1.6 V, a scan speed of 100 mV / s, and a photomultiplier voltage of 800 V.

[0184] Example 2 Optimization of the concentration of DNA tetrahedron solution

[0185] In this example, DNA tetrahedron (DTN) solutions with different concentrations were prepared and incubated on the surface of a gold electrode (AuE). The DTN concentrations were set to 0.5 μM, 0.75 μM, 1.0 μM, 1.25 μM, and 1.5 μM. The ECL signal intensities of cathodoluminescent nitrogen-doped carbon dots (N-CDs), i.e., N-CDs1, and anodoluminescent N-CDs, i.e., N-CDs2, were detected, respectively. Each influencing factor was determined in triplicate.

[0186] The results showed that the ECL signal intensity (a.u.) increased as the DTN concentration increased from 0.5 μM to 1.0 μM, but the ECL signal intensities of N-CDs1 and N-CDs2 did not change significantly as the DTN concentration further increased. Therefore, a DTN solution with a concentration of 1.0 μM was preferred for constructing an ECL aptamer sensor.

[0187] Example 3 Optimization of the incubation time of the signal probe

[0188] The incubation time is an important factor affecting the binding of the signal probe (Apt1 / N-CDs1 / ZIF-8 and Apt2 / N-CDs2 / ZIF-8) on the surface of the gold electrode to the DTN. The incubation time was set to 20 min, 40 min, 60 min, 80 min, and 100 min, respectively. The modified Au electrode was used as the working electrode, and the ECL signal was determined. Each influencing factor was determined in triplicate. The influence was evaluated by detecting the ECL signal intensity.

[0189] The results showed that when the signal probe was incubated on the gold electrode for 60 min, the ECL signal intensity values of N-CDs1 and N-CDs2 both approached the plateau. Therefore, 60 min was selected as the optimized incubation time of the signal probe.

[0190] Example 4 Optimization of the pH of the detection reaction system

[0191] The ECL performance of the carbon dots is closely related to the pH value of the ECL reaction solution of the co-reaction system, and the pH values of 6.2, 6.6, 7.0, 7.4, 7.8 and 8.2 are set. The modified Au electrode is used as the working electrode to measure the ECL signal, and each influencing factor is measured in triplicate.

[0192] The results show that the ECL signal increases as the pH increases from 6.2 to 7.4, but decreases as the pH exceeds 7.4. Therefore, the optimal pH value of the co-reaction solution is set to 7.4.

[0193] Example 5 Performance evaluation of the electrochemiluminescence sensor for detecting AFB1 and ZEN 1. Establishment of linear relationship: Under the optimal conditions, a series of standard solutions of AFB1 and ZEN with concentrations of 0.01 ng / mL, 0.1 ng / mL, 1 ng / mL, 10 ng / mL, 100 ng / mL and 1000 ng / mL are prepared as the detection solution to measure the corresponding ECL signal intensity value, so as to establish the standard curve matching the ECL signal intensity value and the concentration. The concentration (C) of AFB1 and ZEN is taken as the abscissa, and the ECL signal intensity value (IECL) is taken as the ordinate, and the linear equation is obtained by fitting through the Logistic model.

[0194] The results are shown in Figure 2 , where A is the ECL signal reaction diagram of the standard solutions with different concentrations of AFB1 and ZEN, B is the ECL standard curve corresponding to AFB1 of the standard solutions with different concentrations of AFB1 and ZEN, and C is the ECL standard curve corresponding to ZEN of the standard solutions with different concentrations of AFB1 and ZEN.

[0195] 2. Specificity evaluation: ochratoxin A (OTA), vomitoxin (DON) and aflatoxin B2 (AFB2) are used as interfering toxins, and the concentration is 1 ng / mL, which is measured in triplicate. The results are shown in Figure 3 .

[0196] 3. Reproducibility evaluation: Under the same conditions, 5 modified Au electrodes are prepared, and the ECL signal intensity is recorded by using a three-electrode system, and the RSD of the ECL signal intensity of the 5 groups is calculated. The results are shown in Figure 4 .

[0197] 4. Stability evaluation: Under the same conditions, 15 modified Au electrodes are prepared and stored at 4℃. On the 1st day, the 2nd day, the 4th day and the 7th day, 3 modified Au electrodes are taken out, and the ECL signal intensity is recorded by using a three-electrode system to observe the change of the ECL signal intensity with the storage time. The results are shown in Figure 5 .

[0198] From the above results, it can be seen that the ECL sensor has good linear relationship, specificity, reproducibility and stability, and can be used for the detection of AFB1 and ZEN. Figures 3 to 5It can be seen that the electrochemiluminescence sensor for detecting AFB1 and ZEN constructed under the optimal condition has high specificity for AFB1 and ZEN toxins; there is no significant difference in 5 repeated experiments; the detection signal intensity of the sensor with different storage durations has no significant change, and the sensor has good stability.

[0199] 5. Accuracy evaluation: the spiked concentration levels are low (0.01 ng / mL), medium (1 ng / mL) and high (100 ng / mL). The results are shown in Table 1, and it can be seen that the evaluation and analysis test is accurate, and the method is reliable.

[0200] Table 1: Spiked recovery rate results

[0201]

[0202] Example 6

[0203] In this example, the ECL sensor provided in Example 1 is applied to the simultaneous quantitative detection of the AFB1 and ZEN contents of 9 batches of coix seed samples from different origins. The detection results are detected by the UFLC-MS / MS method, and the reliability of the ECL sensor is verified. The specific results are shown in Table 2, and it can be seen that the detection results of the ECL sensor provided in Example 1 have no significant difference compared with the detection results of the UFLC-MS / MS method, the results are consistent, and it is proved that the electrochemiluminescence sensor for detecting AFB1 and ZEN provided in the application is reliable.

[0204] Table 2: Detection results of AFB1 and ZEN contents in coix seed

[0205]

[0206]

[0207] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. An electrochemiluminescence sensor for detecting AFB1 and ZEN, characterized in that, The electrochemiluminescence sensor comprises a DNA tetrahedron self-assembled on a gold electrode, and the DNA tetrahedron is simultaneously modified with an AFB1 signal probe and a ZEN signal probe. The AFB1 signal probe comprises an AFB1 aptamer and an N-CDs1 / ZIF-8 composite material. The ZEN signal probe comprises a ZEN aptamer and an N-CDs2 / ZIF-8 composite material. The DNA tetrahedron is formed by combining four single-stranded DNAs.

2. The electrochemiluminescent sensor according to claim 1, characterized in that The nucleotide sequence of the AFB1 aptamer is shown as SEQ ID NO: 1, and the nucleotide sequence of the ZEN aptamer is shown as SEQ ID NO:

2.

3. The electrochemiluminescent sensor according to claim 1, characterized in that, The four single-stranded DNAs comprise an A chain, a B chain, a C chain and a D chain, the nucleotide sequence of the A chain is shown as SEQ ID NO: 3, the nucleotide sequence of the B chain is shown as SEQ ID NO: 4, the nucleotide sequence of the C chain is shown as SEQ ID NO: 5, and the nucleotide sequence of the D chain is shown as SEQ ID NO:

6.

4. The method for preparing an electrochemiluminescent sensor according to any one of claims 1 to 3, characterized in that, The method comprises modifying the AFB1 signal probe and the ZEN signal probe on the gold electrode on which the DNA tetrahedron is fixed, to obtain the electrochemiluminescence sensor. The preparation method of the AFB1 signal probe comprises adding the AFB1 aptamer in the prepared N-CDs1 / ZIF-8 composite material, and incubating to obtain the AFB1 signal probe. The preparation method of the ZEN signal probe comprises adding the ZEN aptamer in the prepared N-CDs2 / ZIF-8 composite material, and incubating to obtain the ZEN signal probe.

5. The production method according to claim 4, characterized by, The method comprises adding the DNA tetrahedron solution to the gold electrode treated by the alumina slurry, incubating, adding the 6-mercapto-1-hexanol solution, and then adding the AFB1 signal probe solution and the ZEN signal probe solution to incubate, to obtain the electrochemiluminescence sensor.

6. The production method according to claim 5, wherein The preparation method of the alumina slurry comprises taking alumina powders with particle sizes of 0.3 μm and 0.05 μm respectively, placing them on the surface of a polishing cloth, adding a small amount of ultrapure water to make them into a slurry state, to obtain the alumina slurry.

7. The preparation method according to claim 5, characterized in that, The concentration of the DNA tetrahedron solution is 0.5-1.5 μM.

8. The preparation method according to claim 5, characterized in that, The concentration of the 6-mercapto-1-hexanol solution is 8-12 mM.

9. The preparation method according to claim 5, characterized in that, The concentration of the AFB1 signal probe solution is 2.0-3.0 mg / mL.

10. The method of claim 5, wherein, The concentration of the ZEN signal probe solution is 2.0-3.0 mg / mL.

11. The method of claim 5, wherein, The volume ratio of the adding amounts of the DNA tetrahedron solution, the 6-mercapto-1-hexanol solution, the AFB1 signal probe solution and the ZEN signal probe solution is (7-12):(7-12):(7-12):(7-12).

12. The method of claim 11, wherein, The volume ratio of the adding amounts of the DNA tetrahedron solution, the 6-mercapto-1-hexanol solution, the AFB1 signal probe solution and the ZEN signal probe solution is 10:10:10:

10.

13. The preparation method according to claim 5, characterized in that, The incubation temperatures of the adding of the DNA tetrahedron solution and the adding of the AFB1 signal probe solution and the ZEN signal probe solution are independently 35-40 °C.

14. The method of claim 13, wherein, The incubation temperature of the added DNA tetrahedron solution, the added AFB1 signal probe solution and the added ZEN signal probe solution is 37℃ respectively.

15. The preparation method according to claim 13, characterized in that, The incubation time of the added DNA tetrahedron solution, the added AFB1 signal probe solution and the added ZEN signal probe solution is at least 1h respectively.

16. The method of claim 5, wherein, After the incubation, the electrode is further rinsed with a buffer and dried.

17. The preparation method according to claim 4, characterized in that, The preparation method of the DNA tetrahedron comprises mixing four single-stranded DNAs to self-assemble into a DNA tetrahedron.

18. The method of claim 17, wherein, The concentration of the four single-stranded DNAs in the self-assembled system is 3-8 μM respectively.

19. The method of claim 18, wherein, The concentration of the four single-stranded DNAs in the self-assembled system is 5 μM respectively.

20. The method of claim 4, wherein, When the N-CDs1 / ZIF-8 composite material is incubated with the AFB1 aptamer, the concentration of the N-CDs1 / ZIF-8 composite material is 2-3 mg / mL; the concentration of the AFB1 aptamer is 3-8 μM; and the volume ratio of the N-CDs1 / ZIF-8 composite material to the AFB1 aptamer is 1:

1.

21. The method of claim 20, wherein, When the N-CDs1 / ZIF-8 composite material is incubated with the AFB1 aptamer, the concentration of the N-CDs1 / ZIF-8 composite material is 2.5 mg / mL; and the concentration of the AFB1 aptamer is 5 μM.

22. The method of claim 4, wherein, When the N-CDs2 / ZIF-8 composite material is incubated with the ZEN aptamer, the concentration of the N-CDs2 / ZIF-8 composite material is 2-3 mg / mL; the concentration of the ZEN aptamer is 3-8 μM; and the volume ratio of the N-CDs2 / ZIF-8 composite material to the ZEN aptamer is 1:

1.

23. The preparation method according to claim 22, characterized in that, When the N-CDs2 / ZIF-8 composite material is incubated with the ZEN aptamer, the concentration of the N-CDs2 / ZIF-8 composite material is 2.5 mg / mL; and the concentration of the ZEN aptamer is 5 μM.

24. The method of claim 4, wherein, The preparation method of the N-CDs1 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs1 and incubating in the dark, and then standing, centrifuging, discarding the supernatant and drying to obtain the N-CDs1 / ZIF-8 composite material. The preparation method of the N-CDs2 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs2 and incubating in the dark, and then standing, centrifuging, discarding the supernatant and drying to obtain the N-CDs2 / ZIF-8 composite material.

25. The method of claim 24, wherein, When the N-CDs1 / ZIF-8 composite material is prepared, the mass concentration ratio of the ZIF-8 to the N-CDs1 is 1:1.5-2.

5.

26. The method of claim 25, wherein, When the N-CDs1 / ZIF-8 composite material is prepared, the mass concentration ratio of the ZIF-8 to the N-CDs1 is 1:

2.

27. The method of claim 24, wherein, When the N-CDs2 / ZIF-8 composite material is prepared, the mass concentration ratio of the ZIF-8 to the N-CDs2 is 1:1.5-2.

5.

28. The method of claim 27, wherein, When the N-CDs2 / ZIF-8 composite material is prepared, the mass concentration ratio of the ZIF-8 to the N-CDs2 is 1:

2.

29. The method of claim 24, wherein, The incubation temperature in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is 23-30℃ respectively.

30. The method of claim 29, wherein, The incubation temperature in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 25℃.

31. The method of claim 24, wherein, The incubation time in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 10-14h.

32. The method of claim 31, wherein, The incubation time in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 12h.

33. The method of claim 24, wherein the method further comprises: The standing time is 8-12min.

34. The method of claim 33, wherein, The standing time is 10min.

35. The method of claim 24, wherein, The centrifugation is further followed by washing the precipitate with water for at least 3 times.

36. The method of claim 24, wherein, The preparation method of the N-CDs1 comprises dissolving citric acid and urea in water, placing the mixed solution in a reaction kettle, reacting at 160℃, cooling to room temperature after the reaction is completed, dialysis, and drying to obtain the N-CDs1.

37. The method of claim 36, wherein the method is performed in a single step. The mass concentration ratio of the citric acid and the urea is 1:1.5-2.

5.

38. The method of claim 37, wherein the method is performed in a single step. The mass concentration ratio of the citric acid and the urea is 1:

2.

39. The method of claim 36, wherein the method is performed in a single step. The reaction time in the preparation method of the N-CDs1 is 3-5h.

40. The preparation method according to claim 39, characterized in that, The reaction time in the preparation method of the N-CDs1 is 4h.

41. The method of claim 24, wherein, The preparation method of the N-CDs2 comprises dissolving citric acid in dimethylformamide, adding hydrazine hydrate to form a milky white gel, placing the milky white gel in a reaction kettle, reacting at 180℃, cooling to room temperature after the reaction, centrifuging, taking the supernatant, dialysis, and drying to obtain the N-CDs2.

42. The method of claim 41, wherein, The mass concentration of the citric acid in the dimethylformamide is 0.1-0.3g / mL.

43. The method of claim 42, wherein the method further comprises, The mass concentration of the citric acid in the dimethylformamide is 0.21g / mL.

44. The preparation method according to claim 41, characterized in that, The volume ratio of the hydrazine hydrate to the dimethylformamide is 1:9-11.

45. The method of claim 44, wherein the method is carried out at a temperature of about 20°C to about 30°C. The volume ratio of the hydrazine hydrate to the dimethylformamide is 1:

10.

46. The method of claim 41, wherein the method is performed in a single step. The reaction time in the preparation method of the N-CDs2 is 10-14h.

47. The method of claim 46, wherein the method is carried out at a temperature of about 20 °C to about 30 °C. The reaction time in the preparation method of the N-CDs2 is 12h.

48. The method of claim 41, wherein, In the preparation method of the N-CDs2, the drying temperature is 50-65℃.

49. The method of claim 48, wherein, In the preparation method of the N-CDs2, the drying temperature is 60℃.

50. The method of claim 41, wherein, In the preparation method of the N-CDs2, the drying is vacuum drying.

51. The method of claim 41, wherein, In the preparation method of the N-CDs2, the centrifugation speed is 8000-12000rpm.

52. The method of claim 51, wherein, In the preparation method of the N-CDs2, the centrifugation speed is 10000rpm.

53. The method of claim 41, wherein, In the preparation method of the N-CDs2, the centrifugation time is 8-12min.

54. The method of claim 53, wherein, In the preparation method of the N-CDs2, the centrifugation time is 10min.

55. The method of claim 24, wherein the method is carried out at a temperature of about 20°C to about 30°C. The preparation method of the ZIF-8 comprises mixing a methyl imidazole aqueous solution and a zinc acetate dihydrate aqueous solution, reacting at room temperature, centrifuging and drying after the reaction is completed to obtain the ZIF-8.

56. The method of claim 55, wherein the method is performed in a single step. The concentration of the methyl imidazole aqueous solution is 1.3-1.8mol / L.

57. The method of claim 56, wherein the method is performed in a single step. The concentration of the methyl imidazole aqueous solution is 1.5mol / L.

58. The method of claim 55, wherein the method is carried out at a temperature of about 20°C to about 30°C. The concentration of the zinc acetate dihydrate aqueous solution is 22-28mmol / L.

59. The method of claim 58, wherein, The concentration of the zinc acetate dihydrate aqueous solution is 25mmol / L.

60. The method of claim 55, wherein the method is carried out at a temperature of about 20°C to about 30°C. The volume ratio of the aqueous methyl imidazole solution and the aqueous zinc acetate dihydrate solution is 10:1 to 8:

1.

61. The method of claim 60, wherein, The volume ratio of the aqueous methyl imidazole solution and the aqueous zinc acetate dihydrate solution is 9:

1.

62. The method of claim 55, wherein the method is carried out at a temperature of about 20°C to about 30°C. The reaction time of the aqueous methyl imidazole solution and the aqueous zinc acetate dihydrate solution is 4 to 6 hours.

63. The method of claim 62, wherein, The reaction time of the aqueous methyl imidazole solution and the aqueous zinc acetate dihydrate solution is 5 hours.

64. A method for detecting AFB1 and ZEN, characterized in that, The sample solution to be detected is added to the electrochemiluminescence sensor of any one of claims 1 to 3 or the electrochemiluminescence sensor prepared by the preparation method of any one of claims 4 to 63, and incubated, and then the electrochemiluminescence signal is detected with a gold electrode as a working electrode.

65. The method of claim 64, wherein, The incubation time of the sample solution to be detected is 15 to 25 minutes.

66. The method of claim 65, wherein, The incubation time of the sample solution to be detected is 20 minutes.

67. The method of claim 64, wherein, The incubation temperature of the sample solution to be detected is 25 to 40 degrees Celsius.

68. The method of claim 67, wherein, The incubation temperature of the sample solution to be detected is 37 degrees Celsius.

69. The method of claim 64, wherein, The detection of the electrochemiluminescence signal comprises placing a working electrode, an auxiliary electrode and a reference electrode in an electrochemiluminescence reaction solution, and detecting the electrochemiluminescence signal by cyclic voltammetry.

70. The method of claim 69, wherein, The electrochemiluminescence reaction solution comprises 0.05 to 0.15 M K2S2O8 and 0.005 to 0.015 M H2O2, and the solvent is 0.1 M PBS buffer.

71. The method of claim 70, wherein, The electrochemiluminescence reaction solution comprises 0.1 M K2S2O8 and 0.01 M H2O2.

72. The method of claim 69, wherein, The pH of the electrochemiluminescence reaction solution is 6.2 to 7.

4.

73. The method of claim 72, wherein, The pH of the electrochemiluminescence reaction solution is 7.

4.

74. The method of claim 69, wherein, The scanning voltage of the cyclic voltammetry is 0.8 to -1.6 V.

75. The method of claim 69, wherein, The scanning speed of the cyclic voltammetry is 80 to 120 mV / s.

76. The method of claim 75, wherein, The scanning speed of the cyclic voltammetry is 100 mV / s.

77. The method of claim 69, wherein, The photomultiplier voltage is 800 V.

Citation Information

Patent Citations

  • Double-target aptamer sensor for simultaneously detecting AFB1 and ZEN and preparation method thereof

    CN114609209A