Protective oligonucleotides for CRISPR guide RNA

Abstract

The present disclosure provides protective oligonucleotides. Protective oligonucleotides having a 5'and / or 3 'conjugated moiety are provided. Protective oligonucleotides with chemical modifications are provided. Also provided are methods of genome editing with CRISPR nuclease using the protective oligonucleotides and kits for performing the methods. Wherein the protective oligonucleotide comprises: (a) a sequence complementary to the crRNA; and (b) at least one chemically modified nucleotide.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Patent Application Serial No. 63 / 336,340 filed on April 29, 2022 and U.S. Provisional Patent Application Serial No. 63 / 438,842 filed on January 13, 2023. The entire contents of the above patent applications are incorporated herein by reference in their entirety.

[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0004] This invention was made with government support under Grant No. TR002668 awarded by the National Institutes of Health. The government has certain rights in this invention. Technical Field

[0005] The present disclosure relates to compositions and methods of protective oligonucleotides for modified guide RNAs for CRISPR genome editing. Background Art

[0006] CRISPR RNA-guided genome engineering has revolutionized the study of many other aspects of human genetic diseases and biology. Many CRISPR-based in vivo or in vitro genome editing treatments are approaching clinical trials. The core of this revolution is the microbial effector proteins found in the Class II CRISPR-Cas system, such as Cas9 (Type II) and Cas12a / Cpf1 (Type V) (Jinek et al. Science 337, 816-821 (2012); Gasiunas et al. PNAS 109, E2579-E2586 (2012); Zetsche et al. Cell 163, 759-771 (2015)).

[0007] The most widely used genome editing tool is the II-A type Cas9 (SpCas9) from Streptococcus pyogenes strain SF370 (Jinek et al., supra). Cas9 forms a ribonucleoprotein (RNP) complex with CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) for effectively cutting DNA in bacteria and eukaryotes (Fig. 1). CrRNA contains a guide sequence that guides Cas9RNP to a specific locus to form an R loop via base pairing with the target DNA. This process requires pre-identification of the protospacer adjacent motif (PAM), which is NGG for SpCas9. R loop formation activates the His-Asn-His (HNH) domain and the RuvC-like endonuclease domain, which cuts the target and non-target chains of DNA, respectively, resulting in double-strand breaks (DSBs).

[0008] For mammalian applications, Cas9 and its guide RNA can be expressed from DNA (e.g., viral vectors), RNA (e.g., Cas9 mRNA plus guide RNA in lipid nanoparticles), or introduced as ribonucleoproteins (RNPs).

[0009] Unmodified single-stranded RNA is highly susceptible to nuclease degradation and rapidly degrades in cells and biological fluids (such as serum). Delivery of naked and unformulated crRNA is similar to delivery of other therapeutic oligonucleotides (such as antisense oligonucleotides (ASOs) and short interfering RNA (siRNA)), where chemical modification is the key to in vivo efficacy. However, although complete chemical modification significantly enhances crRNA stability ( Figure 1C ), but chemical modification also impairs editing efficiency ( Figure 1D ). We report here that short, completely chemically stable oligonucleotides complementary to undermodified regions of crRNA (hereinafter referred to as "protective oligonucleotides") significantly enhance crRNA stability without compromising activity. In addition, we demonstrate that protective oligonucleotides can enhance the effectiveness of crRNA and tolerate multiple conjugations, and therefore can improve delivery and biodistribution. We expect that protective oligonucleotides will enable in vivo delivery of naked crRNA with enhanced stability, activity, and cellular uptake. Summary of the invention

[0010] The present disclosure provides protective oligonucleotides for CRISPR genome editing. In certain embodiments, the protective oligonucleotides of the present disclosure are heavily or completely chemically modified. The protective oligonucleotides of the present disclosure can confer several advantages in vivo or in vitro, including crRNA stability, improved efficacy and / or reduced off-target effects. In addition, in certain embodiments, the protective oligonucleotides of the present disclosure have reduced immunogenicity, such as reduced ability to induce innate immune responses.

[0011] In certain aspects, the present disclosure provides a protective oligonucleotide comprising: (a) a sequence complementary to crRNA; and (b) at least one chemically modified nucleotide, wherein the protective oligonucleotide is capable of binding to crRNA, and wherein the protective oligonucleotide confers nuclease resistance to crRNA upon binding.

[0012] In one embodiment, the modified nucleotides each independently comprise a modification of the ribose group, the phosphate group, the nucleobase, or a combination thereof.

[0013] In one embodiment, each modification of the ribose group is independently selected from 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-NH2 (2'-amino), 4'-thio, bicyclic nucleotides, locked nucleic acids (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE, and 2'-O,4'-C-aminomethylene bridged nucleic acids (2',4'-BNA NC ) group.

[0014] In one embodiment, at least 80% of the ribose groups are chemically modified. In one embodiment, at least 90% of the ribose groups are chemically modified. In one embodiment, 100% of the ribose groups are chemically modified.

[0015] In one embodiment, the crRNA comprises a guide sequence portion capable of hybridizing to a target polynucleotide sequence and a repeat sequence portion.

[0016] In one embodiment, the protective oligonucleotide binds to the crRNA to form a duplex.

[0017] In one embodiment, the duplex has a melting temperature (Tm) greater than 37°C over the entire length of the duplex.

[0018] In one embodiment, the duplex has a melting temperature (Tm) of less than 37°C over the region of complementarity comprising the guide sequence portion.

[0019] In one embodiment, binding of the tracrRNA to the guide sequence portion of the crRNA causes dissociation of the protective oligonucleotide from the crRNA.

[0020] In one embodiment, the protective oligonucleotide further comprises at least one moiety conjugated to the protective oligonucleotide. In one embodiment, at least one moiety is conjugated to at least one of the 5' end of the protective oligonucleotide and / or the 3' end of the protective oligonucleotide.

[0021] In one embodiment, at least one moiety increases cellular uptake of the guide RNA. In one embodiment, at least one moiety promotes specific tissue distribution of the guide RNA.

[0022] In one embodiment, at least one moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, ganglioside analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, and alkyl chains.

[0023] In one embodiment, at least one moiety is selected from the group consisting of cholesterol, docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymers (ABC), hydrophilic block copolymers (HBC), poloxamer, Cy5 and Cy3.

[0024] In one embodiment, at least one moiety is conjugated to the guide RNA via a linker. In one embodiment, the linker is selected from the group consisting of ethylene glycol chains, alkyl chains, polypeptides, polysaccharides, and block copolymers.

[0025] In one embodiment, at least one moiety is a modified lipid. In one embodiment, the modified lipid is a branched lipid.

[0026] In one embodiment, the modified lipid is a branched lipid of Formula I, Formula I: X-MC(=Y)MZ-[L-MC(=Y)MR]n, wherein X is a portion that connects the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, O or S, Z is a branched group that allows two or three ("n") chains to be connected to the chemically modified guide RNA, L is an optional linker portion, and each R is independently a saturated, monounsaturated or polyunsaturated linear or branched portion, sterol or other hydrophobic group of 2 to 30 atoms in length. In one embodiment, the modified lipid is a head group modified lipid.

[0027] In one embodiment, the modified lipid is a headgroup-modified lipid of Formula II: X-MC(=Y)M-Z-[L-MC(=Y)M-R]n-L-K-J, wherein X is a moiety that connects the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, N-alkyl, O or S, Z is a branching group that allows two or three ("n") chains to be attached to the chemically modified guide RNA, each L is independently an optional linker moiety, and R is a saturated, monounsaturated or polyunsaturated linear or branched moiety, sterol or other hydrophobic group of 2 to 30 atoms in length, K is phosphate, sulfate or amide, and J is an aminoalkane or quaternary aminoalkane group.

[0028] In one aspect, the present disclosure provides a double-stranded oligonucleotide comprising: (a) a crRNA comprising (i) a guide sequence portion capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence portion; and (b) a protective oligonucleotide complementary to the crRNA, wherein the crRNA comprises at least 50% modified nucleotides and wherein the protective oligonucleotide comprises at least one modified nucleotide.

[0029] In one embodiment, the modified nucleotide comprises a modification of the ribose group, the phosphate group, the nucleobase, or a combination thereof.

[0030] In one embodiment, each modification of the ribose group is independently selected from the group consisting of 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-NH2 (2'-amino), 4'-thio, bicyclic nucleotides, locked nucleic acids (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE or 2'-O,4'-C-aminomethylene bridged nucleic acids (2',4'-BNA NC ).

[0031] In one embodiment, at least 80% of the ribose groups are chemically modified. In one embodiment, at least 90% of the ribose groups are chemically modified. In one embodiment, 100% of the ribose groups are chemically modified.

[0032] In one embodiment, the double stranded oligonucleotide comprises a melting temperature (Tm) greater than 37°C over the entire length of the double stranded oligonucleotide.

[0033] In one embodiment, the double-stranded oligonucleotide has a melting temperature (Tm) of less than 37°C over the region of the double-stranded oligonucleotide comprising the crRNA guide sequence portion.

[0034] In one embodiment, binding of the tracrRNA to the repeat sequence portion of the crRNA causes the protective oligonucleotide to dissociate from the crRNA.

[0035] In one embodiment, the protective oligonucleotide is bound to a region of the crRNA that is not fully chemically modified.

[0036] In one embodiment, the protective oligonucleotide binds to a region of the crRNA that contains less than 100% modified ribose groups.

[0037] In one embodiment, the double-stranded oligonucleotide further comprises at least one portion conjugated to a protective oligonucleotide and / or crRNA. In one embodiment, at least one portion is conjugated to at least one of the 5' end and / or 3' end of a protective oligonucleotide and / or crRNA.

[0038] In one embodiment, at least one moiety increases cellular uptake of the guide RNA. In one embodiment, at least one moiety promotes specific tissue distribution of the guide RNA.

[0039] In one embodiment, at least one moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, ganglioside analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, and alkyl chains.

[0040] In one embodiment, at least one moiety is selected from the group consisting of cholesterol, docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymers (ABC), hydrophilic block copolymers (HBC), poloxamer, Cy5 and Cy3.

[0041] In one embodiment, at least one moiety is conjugated to the guide RNA via a linker. In one embodiment, the linker is selected from the group consisting of ethylene glycol chains, alkyl chains, polypeptides, polysaccharides, and block copolymers.

[0042] In one embodiment, at least one moiety is a modified lipid. In one embodiment, the modified lipid is a branched lipid.

[0043] In one embodiment, the modified lipid is a branched lipid of Formula I, Formula I: X-MC(=Y)MZ-[L-MC(=Y)MR]n, wherein X is a portion that connects the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, O or S, Z is a branched group that allows two or three ("n") chains to be connected to the chemically modified guide RNA, L is an optional linker portion, and each R is independently a saturated, monounsaturated or polyunsaturated linear or branched portion, sterol or other hydrophobic group of 2 to 30 atoms in length. In one embodiment, the modified lipid is a head group modified lipid.

[0044] In one embodiment, the modified lipid is a headgroup-modified lipid of Formula II: X-MC(=Y)M-Z-[L-MC(=Y)M-R]n-L-K-J, wherein X is a moiety that connects the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, N-alkyl, O or S, Z is a branching group that allows two or three ("n") chains to be attached to the chemically modified guide RNA, each L is independently an optional linker moiety, and R is a saturated, monounsaturated or polyunsaturated linear or branched moiety, sterol or other hydrophobic group of 2 to 30 atoms in length, K is phosphate, sulfate or amide, and J is an aminoalkane or quaternary aminoalkane group.

[0045] In one embodiment, the guide RNA binds to a Cas9 nuclease selected from the group consisting of Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus (S. aureus) Cas9 (SaCas9), Neisseria meningitidis (N. meningitidis) Cas9 (NmCas9), Campylobacter jejuni (C. jejuni) Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).

[0046] In one embodiment, the Cas9 is a variant Cas9 with altered activity.

[0047] In one embodiment, the variant Cas9 is selected from the group consisting of Cas9 nickase (nCas9), catalytically dead Cas9 (dCas9), ultra-precise Cas9 (HypaCas9), high-fidelity Cas9 (Cas9-HF), enhanced specificity Cas9 (eCas9) and extended PAMCas9 (xCas9).

[0048] In one embodiment, the Cas9 off-target activity is reduced relative to an unmodified guide RNA.

[0049] In one embodiment, the Cas9 targeting activity is increased relative to an unmodified guide RNA.

[0050] In one aspect, the present disclosure provides a method for editing a target region of a genome in a cell to thereby change the expression of a target gene in the cell, comprising administering to the cell a genome editing system, wherein the genome editing system comprises the protective oligonucleotide of any one of the above embodiments; one or more crRNAs of any one of the above embodiments; one or more tracrRNAs; and an RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease.

[0051] In one embodiment, the target gene is in a cell of an organism.

[0052] In one embodiment, expression of the target gene is knocked out or knocked down.

[0053] In one embodiment, an RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease and one or more tracrRNAs are administered to a cell prior to one or more crRNAs or protective oligonucleotides.

[0054] In one embodiment, the crRNA comprises a crRNA portion having a modification pattern according to any one of the preceding embodiments, the modification pattern consisting of:

[0055] mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG#mC#mU(crRNA 20), where rN=RNA, mN=2'-O-methyl RNA, fN=2'-fluoro RNA, N#N=phosphorothioate bond, and N=any nucleotide.

[0056] In one embodiment, the protective oligonucleotide of any of the preceding embodiments comprises a modification pattern consisting of:

[0057] mAmAmAmCmNmNmNmNmN(RC01);

[0058] mAmAmAmAmCmNmNmNmNmN(RC02);

[0059] mAmAmAmCmNmNmNmNmNmN(RC03);

[0060] mAmAmAmAmCmNmNmNmNmNmNmN(RC04);

[0061] mUmAmAmAmAmCmNmNmNmNmNmNmN(RC05);

[0062] mAmAmAmAmCmNmNmNmNmNmNmNmN(RC06);

[0063] mUmAmAmAmAmCmNmNmNmNmNmNmNmN(RC07);

[0064] mCmUmAmAmAmAmCmNmNmNmNmNmNmNmN(RC08);

[0065] mUmAmAmAmAmCmNmNmNmNmNmNmNmNmN(RC09);

[0066] mCmUmAmAmAmAmCmNmNmNmNmNmNmNmNmN(RC10);

[0067] mU#mA#mAmAmAmCmNmNmNmNmNmN#mN#mN(RC07-2PS); and

[0068] mU#mA#mA#mAmAmCmNmNmNmN#mN#mN#mN(RC07-3PS),

[0069] Where rN = RNA, mN = 2'-O-methyl RNA, N#N = phosphorothioate bond, and N = any nucleotide.

[0070] In certain embodiments, the protective oligonucleotide of any of the preceding embodiments is a protective oligonucleotide modification pattern selected from any one of RC01-10 of Table 1.

[0071] In certain embodiments, the crRNA of any of the preceding embodiments is a protective oligonucleotide modification pattern selected from any one of crRNAs 1-134 of Table 2.

[0072] In certain embodiments, the protective oligonucleotide and / or crRNA of any of the preceding embodiments further comprises one or more additional modified nucleotides, each independently selected from modifications of a ribose group, a phosphate group, a nucleobase, or a combination thereof.

[0073] In certain embodiments, each modification of the ribose group is independently selected from the group consisting of 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 4'-thio, bicyclic nucleotides, locked nucleic acids (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE, and 2'-O,4'-C-aminomethylene bridged nucleic acids (2',4'-BNA NC ).

[0074] In certain embodiments, each modification of the phosphate group is independently selected from the group consisting of phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, or phosphotriester modifications.

[0075] In certain embodiments, each modification of the nucleobase is independently selected from the group consisting of 2-thiouridine, 4-thiouridine, N 6 -methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidines, isoguanine, isocytosine, and halogenated aromatic groups. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] The above and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments in conjunction with the accompanying drawings. The patent or application file contains at least one drawing in color. Copies of this patent or patent application publication with one or more color drawings will be provided by the Office upon request and payment of the necessary fee.

[0077] Figure 1A – Figure 1E Schematic representation of stable cell lines and the activity and stability of chemically modified crRNA. Figure 1Ais a schematic diagram of a stable HEK293T cell line expressing the SpyCas9 nuclease, tracrRNA, and a fluorescent reporter consisting of a disrupted GFP and an out-of-frame mCherry. Electroporation of crRNA targeting the GFP sequence will generate a frameshift mutation and place the mCherry coding sequence in-frame. Figure 1B Schematic diagram of a stable HEK293T cell line expressing the SpyCas9 adenine base editor (SpyCas9-ABE8e), tracrRNA, and a fluorescent reporter consisting of a G to A nonsense mutation within the GFP coding sequence. Electroporation of crRNA will restore GFP fluorescence by reversing the mutant A to G editing. Figure 1C Depicted by placing every 5x 10 4 50 pmole crRNA was electroporated into Figure 1A The stable cell line shown in , the activity of crRNA of different chemical modifications is measured. Cells were harvested 48 hours after electroporation, and the percentage of mCherry positive cells was quantified by FACS. The crRNA sequence used is GAGACAAAUCACCUGCCUCGGUUUUAGAGCUAUGCU, and the chemical modification patterns of crRNA are listed in Table 2. Figure 1D Figure 3 shows the expression of SpyCas9-ABE8e and tracrRNA in a stable mouse Hepa1-6 cell line. 4 The activity of different chemically modified crRNAs was measured by electroporating 50 pmole crRNA per cell. The data were measured by Sanger sequencing and EditR analysis. Figure 1E Depicted Figure 1C The stability of partially modified and fully modified crRNAs shown in . The crRNAs were diluted to 1 μM concentration in 10% FBS and incubated at 37° C. for the indicated number of hours, then denatured by formamide loading dye and fractionated by 10% urea denaturing polyacrylamide gel electrophoresis (PAGE) and then stained.

[0078] Figure 2A-2C Depicted are protective oligonucleotides that enhance crRNA stability without compromising activity. Figure 2A Representative designs and chemical modifications of C20 (top) and protective oligonucleotides (bottom, RC01 to RC10) are depicted. The chemical modification patterns of C20 and protective oligonucleotides are color-coded: green, 2'-O-Me; red, 2'-F; black, 2'-OH; underline, PS. Figure 2BDepict the stability of C20-protective oligonucleotide complexes. C20 and indicated protective oligonucleotides were mixed in an equimolar ratio and annealed by heating to 95°C for 5 minutes and slowly cooled to 4°C (-0.1°C per second). The annealed C20-protective oligonucleotide complex was diluted to 1 μM in 10% FBS and incubated at 37°C for the indicated number of hours. RNA was then denatured by formamide and resolved by 10% denaturing urea PAGE. Figure 2C The activity of C20-protective oligonucleotide complexes is depicted. C20 and the indicated protective oligonucleotides are shown in Figure 2B Then use Figure 1A Each of the stable cell lines shown is 5x 10 4 Each cell was electroporated with 50 pmole crRNA. Cells were harvested 48 hours after electroporation and the percentage of mCherry was quantified by FACS.

[0079] Figure 3A-3B Depicted are protective oligonucleotides that enhance crRNA potency. Figure 3A Depicted Figure 1A Activity of C20-protective oligonucleotide complexes at non-saturating doses in stable cell lines is shown. Figure 3B Depicted Figure 1B The activity of C20-protected oligonucleotide complexes in stable cell lines at non-saturating doses is shown in FIG. 5 . The x-axis gives the number of 5x10 4 The molar amount of C20-protective oligonucleotide complex per cell was calculated. Cells were harvested 48 hours after electroporation and the percentage of mCherry or GFP positive cells was quantified by FACS.

[0080] Figure 4A-4D Conjugation of protective oligonucleotides is depicted to enhance cellular uptake without interfering with crRNA activity. Figure 4A Describes the process of 4 50 pmole of complex was electroporated into each cell and the measurement was Figure 1B The activity of C20-protective oligonucleotide complexes with conjugates in the stable cell lines shown in Table 2. The chemical modification patterns of C20 ("crRNA 20") are listed in Table 2, and the chemical modification patterns of protective oligonucleotide RC10 are listed in Table 1. Cells were harvested 48 hours after electroporation, and the percentage of mCherry or GFP positive cells was quantified by FACS. Figure 4B Schematic diagram of the design and modification is depicted, with editing efficiency of protective oligonucleotides with and without lipid conjugation (cholesterol is Chol, docosahexaenoic acid is DHA, N-acetylgalactosamine is GalNac) quantified by GFP. Figure 4CDepicted is the uptake of C20-protective oligonucleotide complexes in the mouse CNS following intrastriatal injection (n=3 mice per group).

[0081] Figure 4D Depicts the cellular uptake of Cy3-labeled crRNA (right), Cy3-labeled crRNA with protective oligonucleotides (middle) and Cy3-labeled crRNA with cholesterol-conjugated protective oligonucleotides (left). Oligonucleotides were diluted to 1.5 μM in DMEM+3% FBS and then mixed with HEK293T cells. Cells were plated on 8-well glass-bottom cell culture chamber slides (SKU230118) and incubated overnight. The cell culture medium was then replaced with PBS, and a drop of NucBlue (Hoechst33342) was added to the cell culture before imaging. Images were taken at 40x magnification under a Leica fluorescence microscope.

[0082] Figure 5 Editing efficiency of passive uptake of C20 with and without protective oligonucleotides is depicted. GFP-positive cells were quantified by FACS.

[0083] Figure 6 It is delineated that efficient editing may require optimal duplex stability between the protective oligonucleotide and crRNA. Figure 1B The activity of C20-protective oligonucleotide complexes in stable cell lines is shown in FIG. Figure 1A Anneal as described in. Then use Figure 1A Each of the stable cell lines shown is 5x 10 4 Each cell was electroporated with 50 pmole crRNA. Cells were harvested 48 hours after electroporation and the percentage of mCherry was quantified by FACS. The chemical modification patterns of C20 and protective oligonucleotides are color-coded: green, 2'-O-Me; red, 2'-F; black: 2'-OH; underline: PS; double underline: locked nucleic acid (LNA).

[0084] Figure 7A-7B In vivo genome editing in the adult mouse CNS by co-delivery of AAV and self-delivery of crRNA is depicted. Fig. 7A Depicted is a method for genome editing in adult mice using scAAV9 by injection until immunohistochemistry (IHC) detection. The editing efficiency of these conjugates was tested by IHC staining using an anti-EGFP antibody and quantified by the percentage of EGFP-positive cells within 1 mm2 around the injection site. Results are presented in Figure 7B The chemical modification patterns are listed in Table 1.

[0085] Figure 8A-8G Figure 3 shows in vivo genome editing in adult mouse liver by co-delivery of AAV expressing effectors and tracrRNA and self-delivery of GalNac-conjugated crRNA. For SpyCas9-ABE8e and tracrRNA expression, the expression results of injected AAV were Fig. 8A and for SpyCas9 nuclease and tracrRNA expression, the results are shown in Figure 8B Shown in. Figure 8C Describes Fah PM / PM Generates a point mutation resulting in exon 8 skipping and FAH deficiency. Fig.8D AAV delivery to Fah PM / PM Schematic diagram of mice. First, RO injection of AAV to express SpyCas9-ABE8e and tracrRNA. Five weeks later, RO injection of C20 was performed using a previously validated spacer sequence. Fig. 8E Base editing efficiency of mouse liver genomic DNA treated by co-delivery of AAV-SpyCas9-ABE-tracrRNA with the indicated C20 / protective oligonucleotide compounds is depicted. Editing efficiency was measured by targeted amplicon deep sequencing (n = 3 mice per group). Data are presented as mean ± SD, *, P < 0.05; **, P < 0.01; ***, P < 0.001 (two-way ANOVA). The weight of mice treated with AAV-expressed SpyCas9-ABE8e and tracrRNA and C20 with protective oligonucleotides was measured over time, and the results are shown in Figure 8F The mice were then sacrificed after three months of NTBC cycling, and liver sections were subjected to IHC staining using anti-FAH antibodies. Figure 8G Shown in.

[0086] Figure 9A-9B The effect of dosing regimen optimization on in vivo editing efficiency is depicted. Fig.9A Schematic diagram of the experimental procedure testing repeated crRNA dosing regimens is shown. RO, retro-orbital injection. Fig. 9B Figure 3. Editing efficiency of AAV-SpyCas9-ABE-tracrRNA co-delivered with a single 80 mg / kg dose compared to the editing efficiency of three consecutive daily injections of 26 mg / kg doses of C20+RC07-GalNac targeting the mouse Pcsk9 gene. Editing efficiency was measured by targeted amplicon deep sequencing of mouse liver genomic DNA (n = 3 mice per group). Single dose data vs. Fig. 8A The data are the same as those shown in . Data are presented as mean ± SD, ****, P < 0.0001 (two-way ANOVA).

[0087] Figure 10A-10B The effect of C20 targeting different sequences with and without protecting oligonucleotides is depicted. Fig. 10A Dose response curves of C20 targeting different sequences with and without protective oligonucleotides in HEK293T-SpyCas9-ABE-tracrRNA-dGFP reporter are shown. Editing efficiency was quantified by FACS. Data are presented as mean ± SD; ns, P>0.05, ****, P<0.0001 (two-way ANOVA, using C20 as control in multiple comparisons). Fig. 10B Editing efficiency of fully modified crRNA C40 with and without different doses of 14-mer protective oligonucleotides in SpyCas9-ABE-tracrRNA-dGFP reporter gene. The left figure shows the chemical modification pattern of crRNA and protective oligonucleotide. Data are presented as mean ± SD; ns, P>0.05 (two-way ANOVA). DETAILED DESCRIPTION

[0088] Protective oligonucleotides are provided herein, including heavy or complete chemical protective oligonucleotides. In certain embodiments, protective oligonucleotides and crRNAs having 5' and / or 3' conjugated moieties are provided. Also provided are methods for genome editing using the protective oligonucleotides and crRNAs disclosed herein with CRISPR nucleases and kits for performing the methods.

[0089] Unless otherwise defined herein, the nomenclature used in conjunction with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein is well-known in the art and commonly used. Unless otherwise indicated, the methods and techniques provided herein are generally carried out according to conventional methods well-known in the art and as described in various general and more specific references cited and discussed throughout this specification. Unless otherwise indicated, enzymatic reactions and purification techniques are carried out according to the manufacturer's instructions, as usually completed in the art or as described herein. Unless otherwise indicated, the nomenclature used in conjunction with analytical chemistry, synthetic organic chemistry and medicinal chemistry described herein and the laboratory procedures and techniques of these chemical fields are well-known in the art and commonly used. Standard techniques are used for chemical synthesis, chemical analysis, drug preparation, preparation and delivery and the treatment of patients.

[0090] Unless otherwise defined herein, the scientific and technical terms used herein have the meanings commonly understood by those of ordinary skill in the art. If there is any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. Unless the context otherwise requires, singular terms shall include plural terms and plural terms shall include singular terms. Unless otherwise indicated, the use of "or" means "and / or". The use of the term "including" and other forms such as "includes" and "included" is not restrictive.

[0091] In order that the present disclosure may be more readily understood, certain terms are first defined.

[0092] As used herein, the term "protective oligonucleotide" refers to an oligonucleotide that is complementary to crRNA and that, when bound to crRNA, confers increased nuclease resistance to crRNA compared to crRNA not bound by the protective oligonucleotide.

[0093] As used herein, the term "guide RNA" or "gRNA" refers to any nucleic acid that facilitates the specific association (or "targeting") of an RNA-guided nuclease (such as Cas9) with a target sequence (e.g., a genomic or episomal sequence) in a cell.

[0094] As used herein, a "modular" or "dual RNA" guide comprises more than one and typically two separate RNA molecules, such as a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA), which are typically associated with each other, for example by forming a duplex. gRNAs and their components are described throughout the literature (see, e.g., Briner et al. Mol. Cell, 56(2), 333-339 (2014), which is incorporated by reference).

[0095] As used herein, "single molecule gRNA", "chimeric gRNA" or "single guide RNA (sgRNA)" includes a single RNA molecule. The sgRNA can be a crRNA and a tracrRNA linked together. For example, the 3' end of the crRNA can be linked to the 5' end of the tracrRNA. The crRNA and tracrRNA can be connected into a single single molecule or chimeric gRNA, for example, by a tetranucleotide (e.g., GAAA) "tetraloop" or "linker" sequence that bridges the complementary region of the crRNA (at its 3' end) and the complementary region of the tracrRNA (at its 5' end).

[0096] As used herein, a "repeat" sequence or region is a nucleotide sequence at or near the 3' end of the crRNA that is complementary to the anti-repeat sequence of the tracrRNA.

[0097] As used herein, an "anti-repeat" sequence or region is a nucleotide sequence at or near the 5' end of the tracrRNA that is complementary to the repeat sequence of the crRNA.

[0098] Further details on guide RNA structure and function, including gRNA / Cas9 complexes for genome editing, can be found at least in Mali et al. Science, 339(6121), 823-826 (2013); Jiang et al. Nat. Biotechnol. 31(3). 233-239 (2013); and Jinek et al. Science, 337(6096), 816-821 (2012); the references are incorporated herein by reference.

[0099] As used herein, "guide sequence" or "targeting sequence" refers to the nucleotide sequence of gRNA, whether unimolecular or modular, which is completely or partially complementary to the target domain or target polynucleotide within the DNA sequence in the genome of the cell to be edited. The guide sequence is generally 10-30 nucleotides in length, preferably 16-24 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length), and is located at or near the 5' end of the Cas9 gRNA.

[0100] As used herein, a "target domain" or "target polynucleotide sequence" is a DNA sequence in the genome of a cell that is complementary to the guide sequence of a gRNA.

[0101] In addition to the targeting domain, gRNA generally includes multiple domains that affect the formation or activity of gRNA / Cas9 complexes. For example, as described above, the duplex structure (also referred to as repeat: anti-repeat duplex) formed by the first and second complementary domains of gRNA interacts with the recognition (REC) leaf of Cas9 and may mediate the formation of Cas9 / gRNA complexes (Nishimasu et al. Cell 156:935-949 (2014); Nishimasu et al. Cell 162 (2), 1113-1126 (2015), both of which are incorporated herein by reference). It should be noted that the first and / or second complementary domains may contain one or more poly-A regions, which can be recognized as termination signals by RNA polymerase. Therefore, the sequence of the first and second complementary domains is optionally modified to eliminate these regions and promote the complete in vitro transcription of gRNA, such as by using the AG exchange or AU exchange described in Briner 2014. These and other similar modifications to the first and second complementary domains are within the scope of the present disclosure.

[0102] In addition to the first and second complementary domains, Cas9 gRNAs typically include two or more other duplex regions that are required for nuclease activity in vivo, but not necessarily in vitro (Nishimasu 2015, supra). The first stem loop close to the 3' portion of the second complementary domain is variously referred to as the "proximal domain", "stem loop 1" (Nishimasu 2014, supra; Nishimasu 2015, supra) and "nexus" (Briner 2014, supra). One or more other stem loop structures are typically present near the 3' end of the gRNA, and the number varies from species to species: Streptococcus pyogenes gRNAs typically contain two 3' stem loops (a total of four stem loop structures, including repeat: anti-repeat duplexes), while Staphylococcus aureus and other species have only one (a total of three). A description of conserved stem loop structures (and more general gRNA structures) organized by species is provided in Briner 2014, which is incorporated herein by reference. More details about guide RNA generally can be found in WO2018026976A1, which is incorporated herein by reference.

[0103] Protective oligonucleotides

[0104] The inventors unexpectedly discovered that the use of protective oligonucleotides can confer enhanced nuclease resistance to crRNA. The protective oligonucleotides described herein are complementary to crRNA. The protective oligonucleotides confer nuclease resistance to crRNA when combined. In a preferred embodiment, the protective oligonucleotides described herein are bound to a crRNA region containing at least one unmodified ribose group. In certain embodiments, the protective oligonucleotides are bound to a crRNA region containing 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 unmodified ribose groups.

[0105] In certain embodiments, the protective oligonucleotide is about 5 to about 20 nucleotides in length (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length). In certain embodiments, the protective oligonucleotide is 10, 11, 12, 13, 14, 15, or 16 nucleotides in length. The length of the protective oligonucleotide is shorter than the crRNA complementary to the protective oligonucleotide (i.e., the protective oligonucleotide is complementary to a region of the crRNA, wherein the region is not the full length of the crRNA).

[0106] In certain embodiments, the protective oligonucleotide binds to the crRNA to form a duplex, optionally wherein the protective oligonucleotide binds to a region of the crRNA that is not fully chemically modified.

[0107] In certain embodiments, a duplex has a melting temperature (Tm) greater than 37°C over the entire length of the duplex.

[0108] In certain embodiments, the duplex has a melting temperature (Tm) of less than 37°C over the region of complementarity comprising a portion of the guide sequence.

[0109] In certain embodiments, binding of the tracrRNA to the guide sequence portion of the crRNA causes dissociation of the protective oligonucleotide from the crRNA.

[0110] Exemplary protective oligonucleotide sequences are listed below, where "N" corresponds to any nucleotide:

[0111]

[0112] Chemically modified guide RNA and protective oligonucleotides

[0113] The protective oligonucleotides and guide RNAs (ie, crRNAs and tracrRNAs) of the present disclosure have improved in vivo stability, improved genome editing efficacy, and / or reduced immunotoxicity relative to unmodified or minimally modified protective oligonucleotides and guide RNAs.

[0114] The protective oligonucleotides and guide RNAs of the present disclosure contain one or more modified nucleotides comprising modifications in the ribose group, the phosphate group, the nucleobase, or a combination thereof.

[0115] Chemical modifications of the ribose group may include, but are not limited to, 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-NH2 (2'-amino), 4'-thio, 2'-O-allyl, 2'-O-ethylamine, 2'-O-cyanoethyl, 2'-O-acetal esters or bicyclic nucleotides such as locked nucleic acids (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE or 2'-O,4'-C-aminomethylene bridged nucleic acids (2',4'-BNA NC ).

[0116] As used herein, the term "4'-thio" corresponds to a modification of a ribose group wherein the sugar ring oxygen of the ribose is replaced by sulfur.

[0117] Chemical modifications of the phosphate group may include, but are not limited to, phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, or phosphotriester modifications.

[0118] In one embodiment, the crRNA portion of the chemically-modified guide RNA comprises 1 to 20 phosphorothioate modifications (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 phosphorothioate modifications). In one embodiment, the crRNA portion of the chemically-modified guide RNA comprises 1 to 20 phosphorothioate modifications (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 phosphorothioate modifications) and comprises at least about 50% activity relative to a guide RNA that does not comprise phosphorothioate modifications (e.g., 50% activity, 60% activity, 70% activity, 80% activity, 90% activity, 95% activity, or 100% activity relative to a guide RNA that does not comprise phosphorothioate modifications).

[0119] Chemical modifications of the nucleobases may include, but are not limited to, 2-thiouridine, 4-thiouridine, N 6 -methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine or a halogenated aromatic group.

[0120] The chemically modified guide RNA can have one or more chemical modifications in the crRNA portion and / or tracrRNA portion guided by a modular or dual RNA. The chemically modified guide RNA can also have one or more chemical modifications in a single guide RNA of a single molecule guide RNA.

[0121] The protective oligonucleotides and guide RNA may contain at least about 50% to at least about 100% chemically modified nucleotides, at least about 60% to at least about 100% chemically modified nucleotides, at least about 70% to at least about 100% chemically modified nucleotides, at least about 80% to at least about 100% chemically modified nucleotides, at least about 90% to at least about 100% chemically modified nucleotides, and at least about 95% to at least about 100% chemically modified nucleotides.

[0122] The protective oligonucleotide and the guide RNA may comprise at least about 50% chemically modified nucleotides, at least about 60% chemically modified nucleotides, at least about 70% chemically modified nucleotides, at least about 80% chemically modified nucleotides, at least about 90% chemically modified nucleotides, at least about 95% chemically modified nucleotides, at least about 99% chemically modified, or 100% (completely) chemically modified nucleotides.

[0123] The protect oligonucleotides and guide RNA may comprise at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% chemically modified nucleotides.

[0124] As used herein, protect oligonucleotides and guide RNAs comprising at least about 80% chemically modified nucleotides to at least about 99% chemically modified nucleotides are considered "heavily" modified.

[0125] As used herein, protected oligonucleotides and guide RNAs comprising 100% chemically modified nucleotides are considered "fully" modified.

[0126] In certain exemplary embodiments, the protective oligonucleotides and guide RNA may include chemically modified ribose groups at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.

[0127] In certain exemplary embodiments, the protective oligonucleotides and guide RNA may comprise chemically modified ribose groups at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.

[0128] In certain exemplary embodiments, the protective oligonucleotides and guide RNA may comprise chemically modified ribose groups at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.

[0129] As used herein, protect oligonucleotides and guide RNAs having at least about 80% chemically modified ribose groups to at least about 99% chemically modified ribose groups are considered "heavily" modified.

[0130] As used herein, protected oligonucleotides and guide RNAs having 100% of chemically modified ribose groups are considered "fully" modified.

[0131] In certain exemplary embodiments, the protective oligonucleotides and guide RNAs may include chemically modified phosphate groups at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.

[0132] In certain exemplary embodiments, the protective oligonucleotides and guide RNA may comprise chemically modified phosphate groups at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.

[0133] In certain exemplary embodiments, the protective oligonucleotides and guide RNA may comprise chemically modified phosphate groups at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.

[0134] As used herein, protective oligonucleotides and guide RNAs having at least about 80% chemically modified phosphate groups to at least about 99% chemically modified phosphate groups are considered "heavily" modified.

[0135] As used herein, protected oligonucleotides and guide RNAs having 100% of chemically modified phosphate groups are considered "fully" modified.

[0136] In certain exemplary embodiments, the protective oligonucleotides and guide RNA may comprise chemically modified nucleobases at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.

[0137] In certain exemplary embodiments, the protective oligonucleotides and guide RNA may comprise chemically modified nucleobases at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.

[0138] In certain exemplary embodiments, the protective oligonucleotides and guide RNA may comprise chemically modified nucleobases at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.

[0139] As used herein, protect oligonucleotides and guide RNAs having at least about 80% chemically modified nucleobases to at least about 99% chemically modified nucleobases are considered "heavily" modified.

[0140] As used herein, protective oligonucleotides and guide RNAs having 100% of chemically modified nucleobases are considered "fully" modified.

[0141] In certain exemplary embodiments, the protective oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.

[0142] In certain exemplary embodiments, the protective oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.

[0143] In certain exemplary embodiments, the protective oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.

[0144] As used herein, protect oligonucleotides and guide RNAs having any combination of at least about 80% chemically modified ribose groups, phosphate groups, and nucleobases to at least about 99% chemically modified nucleobases are considered "heavily" modified.

[0145] As used herein, protect oligonucleotides and guide RNAs having 100% of any combination of chemically modified ribose groups, phosphate groups, and nucleobases are considered "fully" modified.

[0146] The heavily and fully chemically modified protective oligonucleotides and guide RNAs disclosed herein have several advantages over minimally modified protective oligonucleotides and guide RNAs in the art. The heavily and fully chemically modified protective oligonucleotides and guide RNAs are expected to simplify chemical synthesis, further enhance in vivo stability, and provide a scaffold for terminally appended chemical functional groups that promote delivery and efficacy during clinical applications of genome editing.

[0147] The chemical modification pattern used in the guide RNA is such that the activity of the guide RNA is maintained when the guide RNA is paired with an RNA-guided DNA endonuclease (e.g., Cas9).

[0148] In one embodiment, a chemically-modified guide RNA of the present disclosure comprises at least about 50% activity relative to an unmodified guide RNA (e.g., 50% activity, 60% activity, 70% activity, 80% activity, 90% activity, 95% activity, or 100% activity relative to an unmodified guide RNA).

[0149] The activity of the guide RNA can be easily determined by any method known in the art. In one embodiment, the % activity is measured using the traffic light reporter gene (TLR) Multi-Cas variant 1 system (TLR-MCV1) as described below. The TLR-MCV1 system will provide % fluorescent cells, which is a measure of % activity.

[0150] Exemplary chemical modification patterns are described in Tables 1 and 2 below.

[0151] Table 1 - Exemplary chemical modification patterns of protective oligonucleotides.

[0152]

[0153] Table 2 - Exemplary chemical modification patterns of crRNA

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162] It will be appreciated by those skilled in the art that the base sequences of the first 20 nucleotides of the exemplary crRNA listed in Table 2 above are directed to specific targets. Such 20 nucleotide base sequences may be changed based on the target nucleic acid, but the chemical modification remains unchanged. An exemplary unmodified crRNA sequence from 5' to 3' is NNNNNNNNNNNNNNNNNNNNNGUUUUAGAGCU AUGCU (SEQ ID NO: 1), wherein "N" corresponds to any nucleotide (e.g., A, U, G, or C). An exemplary unmodified tracrRNA sequence from 5' to 3' is AGCAUAGC AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG GCACCGAGUCGGUGCUUU (SEQ ID NO: 2).

[0163] Those skilled in the art will also appreciate that the guide sequence can be 10-30 nucleotides in length, preferably 16-24 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and is located at or near the 5' end of the Cas9gRNA.

[0164] Chemically modified guide RNAs, including chemically modified crRNAs and tracrRNAs, are described in more detail in US20210363518 and US20210388348, each of which is incorporated herein by reference.

[0165] The protective oligonucleotides described herein can be designed to bind to any region of the crRNA modification pattern that contains at least one unmodified ribose group, thereby conferring nuclease resistance to the crRNA.

[0166] High-affinity repeat / anti-repeat guide RNA modification

[0167] crRNA and tracrRNA are hybridized together by forming a duplex between the repeat region of crRNA and the anti-repeat region of tracrRNA. In certain embodiments, modular or double RNA, guide RNA is provided with modification in the repeat region and the anti-repeat region to enhance the affinity between the two regions and form a stronger duplex.

[0168] High affinity interactions can be enhanced by increasing the GC nucleotide content in the duplex formed by the repeat region and the anti-repeat region. Nucleotide modifications such as 2'-fluoro and 2'-O-methyl modifications can also be introduced, which can increase the melting temperature (Tm) of the duplex. Further modifications include the use of orthogonal and non-naturally occurring nucleotides. Various repeat regions / anti-repeat regions described herein are modified to enhance the stability of the duplex, which helps prevent crRNA and tracrRNA from folding into suboptimal structures, thus promoting higher genome editing efficacy.

[0169] Conjugate

[0170] The protective oligonucleotides and guide RNAs disclosed herein can be modified with terminal conjugated moieties. As used herein, "terminal conjugated moieties" or "moieties" refer to compounds that can be connected or attached to the 5' and / or 3' ends of crRNA and / or protective oligonucleotides. The terminal conjugated moieties can provide increased stability, increased ability to penetrate cell membranes, increased cellular uptake, increased in vivo circulation time, act as cell-specific guiding agents, and / or provide methods for monitoring cell or tissue-specific uptake.

[0171] In certain embodiments, the terminal conjugated portion is conjugated to the 5' end of the crRNA. In certain embodiments, the terminal conjugated portion is conjugated to the 3' end of the crRNA. In certain embodiments, the terminal conjugated portion is conjugated to the 5' end of the protective oligonucleotide. In certain embodiments, the terminal conjugated portion is conjugated to the 3' end of the protective oligonucleotide.

[0172] In certain exemplary embodiments, the terminally conjugated moieties include, but are not limited to, fatty acids, steroids, secosteroid compounds, lipids, ganglioside analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, alkyl chains, fluorophores, antibodies, nuclear localization signals, and the like.

[0173] In certain exemplary embodiments, the terminally conjugated moieties include, but are not limited to, cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymers (ABC), hydrophilic block copolymers (HBC), poloxamer, Cy5, Cy3, and the like.

[0174] In certain exemplary embodiments, at least one terminally conjugated moiety is a modified lipid, including a branched lipid (such as the structure shown in Formula I) or a headgroup-modified lipid (such as the structure shown in Formula II).

[0175] Formula I: X–MC(=Y)M–Z–[L–MC(=Y)M–R]n

[0176] wherein X is a moiety that attaches the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, O, or S, Z is a branching group that allows two or three ("n") chains to be attached to the rest of the structure, L is an optional linker moiety, and each R is independently a saturated, monounsaturated, or polyunsaturated linear or branched moiety, sterol, or other hydrophobic group of 2 to 30 atoms in length.

[0177] Formula II: X–MC(=Y)M–Z–[L–MC(=Y)M–R]n–L–K–J

[0178] wherein X is a moiety that attaches the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, N-alkyl, O, or S, Z is a branching group that allows two or three ("n") chains to be attached to the rest of the structure, each L is independently an optional linker moiety, and R is a saturated, monounsaturated, or polyunsaturated linear or branched moiety, sterol, or other hydrophobic group of 2 to 30 atoms in length, K is phosphate, sulfate, or amide, and J is an aminoalkane or quaternary aminoalkane group.

[0179] These parts can be connected to the terminal nucleotide of the guide RNA via a linker.Exemplary linkers include, but are not limited to, ethylene glycol chains, alkyl chains, polypeptides, polysaccharides, block copolymers, etc.

[0180] In certain embodiments, the moiety is conjugated to the 5' end and / or the 3' end of any one of RC01 to RC10 (ie, RC01, RC02, RC03, RC04, RC05, RC06, RC07, RC08, RC09, or RC10).

[0181] Chemically modified single guide RNA

[0182] As described herein, the chemically modified guide RNA of the present disclosure can be constructed as a single guide RNA (sgRNA) by connecting the 3' end of crRNA to the 5' end of tracrRNA. The linker can be an oligonucleotide ring, including a chemically modified oligonucleotide ring. In certain embodiments, the oligonucleotide ring comprises a GAAA tetraloop. The linker can be a non-nucleotide chemical linker, including but not limited to ethylene glycol oligomers (see, e.g., Pils et al. Nucleic Acids Res. 28 (9): 1859-1863 (2000)).

[0183] RNA-guided nuclease

[0184] RNA-guided nucleases according to the present disclosure include, but are not limited to, naturally occurring type II CRISPR nucleases, such as Cas9, and other nucleases derived therefrom or obtained therefrom. Exemplary Cas9 nucleases that can be used in the present disclosure include, but are not limited to, Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Neisseria meningitidis Cas9 (NmCas9), Campylobacter jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9). In terms of function, RNA-guided nucleases are defined as those nucleases: (a) interact with gRNA (e.g., complex); and (b) together with gRNA, are associated with and optionally cut or modify a target region of DNA including: (i) a sequence complementary to the targeting domain of the gRNA and, optionally, (ii) other sequences referred to as "protospacer adjacent motifs" or "PAMs", which will be described in more detail below. As the following examples will illustrate, RNA-guided nucleases can be broadly defined by their PAM specificity and cleavage activity, even though there may be differences between individual RNA-guided nucleases that share the same PAM specificity or cleavage activity. The skilled artisan will appreciate that some aspects of the present disclosure relate to systems, methods, and compositions that can be implemented using any suitable RNA-guided nuclease with a particular PAM specificity and / or cleavage activity. For this reason, unless otherwise indicated, the term RNA-guided nuclease should be understood as a general term and is not limited to any particular type (e.g., Cas9 vs. Cpf1), strain (e.g., S. pyogenes vs. S. aureus), or variant (e.g., full-length vs. truncated or split; naturally occurring vs. engineered PAM specificity).

[0185] Various RNA-guided nucleases may require different sequential relationships between the PAM and the protospacer. In general, Cas9 recognizes a PAM sequence located 5' of the protospacer relative to the top or complementary strand as visual.

[0186] In addition to recognizing a specific sequential orientation of the PAM and protospacer, RNA-guided nucleases typically recognize a specific PAM sequence. For example, Staphylococcus aureus Cas9 recognizes a PAM sequence of NNGRRT, where the N sequence is immediately 3' to the region recognized by the gRNA targeting domain. Streptococcus pyogenes Cas9 recognizes the NGG PAM sequence. It should also be noted that engineered RNA-guided nucleases can have a PAM specificity that is different from the PAM specificity of similar nucleases (such as naturally occurring variants of derived RNA-guided nucleases, or naturally occurring variants with the greatest amino acid sequence homology to engineered RNA-guided nucleases). Modified Cas9s that recognize alternative PAM sequences are described below.

[0187] RNA-guided nucleases are also characterized by their DNA cleavage activity: naturally occurring RNA-guided nucleases typically form DSBs in target nucleic acids, but engineered variants have been generated that only generate SSBs (discussed above; see also Ran 2013, incorporated herein by reference), or that do not cleave at all.

[0188] RNA guide nuclease Cas9 may be a variant of Cas9 with altered activity. Exemplary variant Cas9 nucleases include, but are not limited to, Cas9 nickase (nCas9), catalytic dead Cas9 (dCas9), ultra-precise Cas9 (HypaCas9) (Chen et al. Nature, 550 (7676), 407-410 (2017)), high-fidelity Cas9 (Cas9-HF) (Kleintiver et al. Nature 529 (7587), 490-495 (2016)), enhanced specificity Cas9 (eCas9) (Slaymaker et al. Science 351 (6268), 84-88 (2016)) and amplified PAM Cas9 (xCas9) (Hu et al. Nature doi: 10.1038 / nature26155 (2018)).

[0189] RNA guide nuclease can be combined with the chemically modified guide RNA of the present disclosure to form a genome editing system. RNA guide nuclease can be combined with the chemically modified guide RNA to form an RNP complex, which can be delivered to cells requiring genome editing. RNA guide nuclease can be expressed in cells requiring genome editing together with the chemically modified guide RNA delivered separately. For example, RNA guide nuclease can be expressed by polynucleotides (such as vectors or synthetic mRNA). The vector can be a viral vector, including but not limited to adeno-associated virus (AAV) vectors or lentivirus (LV) vectors.

[0190] It will be apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein may be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. Now that certain embodiments have been described in detail, the embodiments will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to limit the present invention.

[0191] Example

[0192] Example 1 - Genome Editing Efficiency of Chemically Modified crRNA and tracrRNA

[0193] To test the compatibility of certain chemical modifications of crRNA with SpyCas9 / base editor (BE) activity, we established a situation in which cell lines stably expressed SpyCas9 nuclease or base editor, tracrRNA, and a fluorescent reporter gene ( Figure 1A and Figure 1B ), but does not express crRNA. We first screened the activity of previously designed different chemically modified crRNAs (described in WO 2019 / 183000A1 and WO 2021 / 231606 A2, which are incorporated herein by reference) by electroporating into stable cell lines and using fluorescence-activated cell sorting (FACS) to quantify the percentage of fluorescent-positive cells (which reports editing activity). Compared with the terminally modified C0 crRNA, the heavily modified C20 showed significantly enhanced activity, while all fully modified crRNAs showed reduced activity ( Figure 1C This conclusion was further confirmed using crRNAs targeting various endogenous genomic sites ( Figure 1D ). Next, we compared the stability of heavily and fully modified crRNA by incubating them with fetal bovine serum (FBS). We found that only fully modified crRNA was stable in FBS ( Figure 1E ). We note that C20 has six ribose residues including 3'-phosphorothioate; phosphorothioate modification improves stability compared to unmodified phosphate bonds, but substantial degradation still occurs. Therefore, our most active CRISPR guide (C20) requires further stabilization.

[0194] The protective oligonucleotides used in the examples are listed in Table 3 below. The tracrRNAs used in the examples are listed in Table 4 below.

[0195] Table 3. Exemplary protective oligonucleotides

[0196]

[0197]

[0198]

[0199] Table 4. Exemplary crRNAs.

[0200]

[0201] Example 2—Protective oligonucleotides enhance crRNA stability without compromising activity and enhance crRNA potency

[0202] Inspired by the design of short DNA / RNA heteroduplex oligonucleotides (HDOs) (Nishina et al., Nature Communications, 2015) and the clear observation that double-stranded RNA is more resistant to nuclease degradation than single-stranded RNA (Lam et al., Molecular Therapy Nucleic Acids, 2015), we sought to enhance crRNA stability by designing short, fully chemically stable oligonucleotides that would protect the unmodified region of C20 ( Figure 2A ). We anticipate that during pairing of the crRNA repeat region with the tracrRNA anti-repeat region, the protective oligonucleotide will be displaced by the tracrRNA strand invasion, thereby still allowing crRNA / tracrRNA complex formation, as required for Cas9 editing. The formation of the crRNA / tracrRNA duplex will simultaneously induce the dissociation of the protective oligonucleotide. We found that when annealed to C20, oligonucleotides equal to or longer than 12 nt can protect C20 from nuclease degradation in FBS ( Figure 2B By electroporating C20-protective oligonucleotide complexes into stable cell lines, we confirmed that the protective oligonucleotide did not interfere with SpyCas9 activity ( Figure 2C ).

[0203] Protective oligonucleotides enhance crRNA potency

[0204] To test whether the protective oligonucleotides that enhance C20 stability can also increase CD20 potency, we electroporated C20-protective oligonucleotide complexes at non-saturating doses. We found that the protective oligonucleotides significantly enhanced the potency of C20 ( Figure 3A and Figure 3B ).

[0205] Example 3 - Conjugation with protective oligonucleotides enhances cellular uptake without interfering with crRNA activity

[0206] Adding conjugates such as N-acetylgalactosamine (GalNac) and cholesterol (TegChol) to therapeutic oligonucleotides is essential for achieving efficient and targeted in vivo delivery. To test whether conjugation interferes with crRNA activity, we synthesized crRNA and protective oligonucleotides conjugated with GalNac or cholesterol and tested the activity via electroporation in stable cell lines. We found that while direct conjugation of cholesterol to C20 significantly impaired activity, C20 with cholesterol-conjugated protective oligonucleotides did not show reduced activity ( Figure 4A Although C20 with cholesterol conjugation showed significantly reduced editing efficiency, conjugation of cholesterol to the protective oligonucleotide did not interfere with activity ( Figure 4B).

[0207] To directly observe in vivo that the conjugated protective oligonucleotides enhance the cellular uptake of C20, we delivered Cy3-labeled C20 (with and without cholesterol or DHA conjugated protective oligonucleotides) into the adult mouse brain by intrastriatal (IS) injection. We found that both cholesterol-conjugated and DHA-conjugated protective oligonucleotides significantly enhanced the in vivo distribution and cellular uptake of C20 compared with unconjugated protective oligonucleotides ( Figure 4C ). These data suggest that protective oligonucleotides allow various types of conjugation and can be used as delivery vehicles to enhance cellular uptake of crRNA without interfering with Cas9 activity. In addition, we demonstrated that our designed crRNA protective oligonucleotide complexes can be efficiently taken up by cultured mammalian cells without the need for transfection reagents ( Figure 4D ).

[0208] Example 4 - Chemically modified crRNA with different phosphorothioate contents

[0209] To test whether C20-protective oligonucleotide complexes can be passively taken up by cells (simply adding them to the culture medium without electroporation or transfection), escape from endosomes, and support editing, we Figure 1B The stable cell line shown in Figure 1 was incubated with 1.5 μM C20-protective oligonucleotide targeting an inactivated GFP reporter gene. Efficient editing may require optimal duplex stability between the protective oligonucleotide and crRNA ( Figure 6 We observed an editing efficiency of approximately 7% ( Figure 5 ). Because cholesterol may be essential for siRNA uptake in cultured cells [Ly et al., Molecular Therapy Nucleic Acids 2020], Figure 4A It was shown that editing efficiency was further improved by using cholesterol-conjugated protective oligonucleotides.

[0210] Example 5 - In vivo genome editing in the adult mouse CNS by co-delivery of AAV and self-delivery of crRNA

[0211] We tested whether the C20-protective oligonucleotide complex can support genome editing by AAV co-delivery in vivo. We chose to test it in the double transgenic reporter mouse model Cas9 / mTmG+ / +. The mouse model was generated by hybridizing homozygous Cas9+ / + mice 68 with homozygous mTmG+ / + reporter mice (Muzumdar et al. Genesis.45:593-605.2007). The Cas9+ / + mouse model constitutively expresses SpyCas9, and the only transgene delivered from the AAV vector is tracrRNA, which simplifies the experimental process. The mTmG+ / + reporter gene consists of: loxP sites on either side of the membrane-targeted tdTomato (mT) box, which constitutively expresses red fluorescence; and downstream membrane-targeted EGFP (mG), which can only be expressed when the mT box is deleted ( Fig. 7A ).

[0212] First, we injected scAAV9 expressing tracrRNA into the brain of adult Cas9 / mTmG+ / + mice by IS injection. Two weeks later, we performed another IS injection to deliver naked C20, which targets two loxP sites to generate a block deletion of the mT cassette and allow mG expression. We then detected GFP expression by immunohistochemistry (IHC) on formalin-fixed mouse brain sections using anti-EGFP antibodies.

[0213] We chose to test cholesterol and DHA conjugates, as well as cleavable and stable linkers for the protective oligonucleotide. We also included C20 with the protective oligonucleotide without any conjugation and C20 without the protective oligonucleotide as controls.

[0214] By using anti-EGFP antibody for IHC staining, we found that C20 without protective oligonucleotide did not generate any editing in the brain. At the same time, we observed only a small number of EGFP-positive cells around the site of injection of C20 without conjugation and protective oligonucleotide. In contrast, C20 with DHA conjugation or cholesterol conjugation and with a cleavable linker or a stable linker generated more efficient editing and wider distribution ( Figure 7B ), which is consistent with Figure 4B The results of in vivo distribution quantified in the medium were consistent. 2 When comparing the percentage of EGFP-positive cells, we found that DHA conjugation outperformed cholesterol conjugation and having a cleavable linker further improved the distribution and editing efficiency (Figure 7C).

[0215] Example 6 - Chemically modified crRNA with different phosphorothioate contents

[0216] Using adult wild-type B6 mice, we tested C20 targeting the mouse Pcsk9 gene with either 14 nucleotides or 16 nucleotides of trivalent GalNac-conjugated protective oligonucleotides. We also included non-targeting control C20 and PBS as controls. First, we injected adult mice with AAV expressing SpyCas9-ABE8e and tracrRNA ( Fig. 8A ) or SpyCas9 nuclease and tracrRNA ( Figure 8B ) and incubated for five weeks to allow effector protein expression and accumulation. We then injected C20 with and without GalNac-conjugated protective oligonucleotides at 80 mg / kg via a single RO injection. Editing efficiency was assessed by extracting genomic DNA from mouse liver tissue and performing targeted amplicon deep sequencing. We found that C20 with two lengths of protective oligonucleotides resulted in low but significant editing at the target genomic site, while no editing was observed for non-targeted control C20-injected mice ( Fig. 8A and Figure 8B ).

[0217] We next tested whether our co-delivery approach could generate therapeutically relevant edits by testing it in the HT1 mouse model. The HT1 mouse model used in this study is a Fah PM / PM Mice that have a G to A point mutation in the last nucleotide of exon 8 of the Fah gene encoding fumarylacetoacetate hydrolase. This point mutation generates exon 8 skipping and leads to FAH deficiency ( Figure 8C Because FAH catalyzes a step in the tyrosine catabolic pathway, FAH deficiency results in the accumulation of toxic fumarylacetoacetate and acetoacetate succinyl, which can cause damage to multiple organs. PM / PM The mice were treated with 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), an inhibitor of an enzyme upstream of the tyrosine degradation pathway that prevents toxin accumulation. Without this treatment, the mice rapidly lost weight and died. PM / PM Point mutations in mice can be corrected by SpyCas9-ABE delivered by lipid nanoparticles or plasmid hydrodynamic tail vein injection carrying mRNA and sgRNA.

[0218] We first injected AAV to express SpyCas9-ABE8e and tracrRNA via RO injection. Five weeks later, we performed RO injection of C20 with a previously validated targeting Fah at a single 80 mg / kg dose. PM / PMThe spacer sequence in the mouse body has a trivalent GalNac-conjugated protective oligonucleotide of 14 nucleotides or 16 nucleotides. The mouse keeps NTBC throughout the whole process to maintain its weight and allow time for the occurrence of genome editing. Then, we killed three mice from each group and extracted liver genomic DNA to measure the editing efficiency by targeted amplicon deep sequencing, and used anti-FAH antibodies to detect FAH-positive hepatocytes via IHC staining. For the remaining mice in each group, we cycled on and off NTBC (off for 7-10 days, then on for 2 days) for three months to allow FAH-positive hepatocytes to expand and monitor mouse weight to test whether the genome editing performed by our co-delivery method can correct the phenotype of the mouse model ( Fig.8D ).

[0219] Before NTBC cessation, we observed low but significant on-target editing in the co-delivery treatment group ( Fig. 8E ). After stopping NTBC, mice injected with PBS lost weight rapidly and were humanely killed after their body weight dropped below 80% and they were dying. The weight of mice treated with AAV-expressed SpyCas9-ABE8e and tracrRNA and C20 with protective oligonucleotides gradually increased over time ( Figure 8F ). The mice were then sacrificed after three months of NTBC cycling, and liver sections were subjected to IHC staining using anti-FAH antibodies. We observed an expansion of FAH-positive hepatocytes in liver tissue treated with AAV co-delivery ( Figure 8G These data suggest that in vivo genome editing in the liver can be achieved and provide therapeutic benefit by systemic delivery of C20 and GalNac-conjugated protective oligonucleotides along with AAV-expressed effector proteins and tracrRNA.

[0220] Example 6 - Improving editing efficiency by optimizing dosing regimen

[0221] The editing efficiencies we achieved in the liver, while significant, were low. We then sought to improve efficiency by optimizing the dosing regimen. The asialoglycoprotein receptor (ASGPR), which is expressed on the surface of hepatocytes and is responsible for the uptake of GalNac-conjugated oligonucleotides, has a recirculation time of approximately 10–15 minutes. Data from previous studies also showed that hepatocytes can take up only a limited amount of GalNac-conjugated molecules after an intravenous bolus injection due to saturation of the ASGPR. 77 Our initial studies injected a single dose of C20 with GalNac-conjugated protective oligonucleotides at 80 mg / kg, far exceeding the capacity of the available ASGPR. We reasoned that, rather than a single bolus, splitting the oligonucleotide into three consecutive daily RO injections, each injection at one-third of the previous dose (26 mg / kg), might be able to deliver more oligonucleotides into hepatocytes, thereby improving editing efficiency ( Fig.9A ).

[0222] To test this idea, we first RO injected AAV in B6 mice to express SpyCas9-ABE8e and tracrRNA. Then, five weeks later, we RO injected C20 complexed with 14ntGalNac-conjugated protective oligonucleotides targeting the Pcsk9 gene at 26 mg / kg for three consecutive days. We then harvested mouse liver genomic DNA and performed targeted amplicon deep sequencing to measure editing efficiency. We found that three consecutive daily doses of 26 mg / kg significantly improved editing efficiency compared to a single dose of 80 mg / kg oligonucleotide ( Fig. 9B ). In addition, we did not observe any signs of liver toxicity with repeated dosing, and the health of oligonucleotide-treated mice was good, similar to that of mice receiving PBS injections. These data suggest that repeated crRNA dosing is possible and well tolerated, and optimization of dosing regimens may further increase editing efficiency.

[0223] Example 7 - Improving in vivo editing efficiency by optimizing dosing regimen

[0224] We then further explored the mechanism of the activity of the protective oligonucleotides. We compared the activity of C20 with protective oligonucleotides of different lengths or with protective oligonucleotides annealing to different C20 regions (Figure 10). We found that protective oligonucleotides as short as 10 nucleotides (PO1) enhanced C20 potency, although to a lesser extent than protective oligonucleotides of 14 nucleotides (PO7), probably because the lower melting temperature limits the extent of C20 protection. In contrast, we found that longer POs (PO16 is up to 22 nucleotides with a nucleotide sequence of 5'-GCACAAAAAACNNNNNNNNNNNN-3') reduced C20 potency, probably due to strong binding affinity inhibiting initial tracrRNA annealing, protective oligonucleotide displacement, or both. In addition, the location where the protective oligonucleotide binds is also important ( Fig. 10A A 16-nt protective oligonucleotide (B10, sequence 5′-ACCAUAGCUCUAAAAC-3′) that does not leave a foothold for initial tracrRNA annealing also resulted in reduced activity, consistent with our hypothesis that the protective oligonucleotide needs to be displaced by tracrRNA before C20 can become active ( Fig. 10A Finally, we demonstrated that the protective oligonucleotides neither inhibited nor enhanced the potency of the fully modified and stabilized crRNA (C40), implying that the increased potency conferred by the protective oligonucleotides was due to C20 stabilization ( Fig. 10B ).

Claims

1. A protective oligonucleotide comprising: (a) a sequence complementary to crRNA; and (b) at least one chemically modified nucleotide, wherein the protective oligonucleotide is capable of binding to the crRNA, and wherein the protective oligonucleotide confers nuclease resistance to the crRNA upon binding.

2. The protective oligonucleotide of claim 1, wherein the at least one chemically modified nucleotide comprises a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.

3. The protective oligonucleotide of claim 2, wherein the modification of the ribose group is independently selected from the group consisting of 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-NH2 (2'-amino), 4'-thio, bicyclic nucleotides, locked nucleic acids (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE, and 2'-O,4'-C-aminomethylene bridged nucleic acids (2',4'-BNA NC ).

4. A protective oligonucleotide as claimed in claim 2 or 3, wherein at least 80% of the ribose groups are chemically modified.

5. The protective oligonucleotide of claim 2 or 3, wherein at least 90% of the ribose groups are chemically modified.

6. The protective oligonucleotide of claim 2 or 3, wherein 100% of the ribose groups are chemically modified.

7. The protective oligonucleotide of any one of claims 1 to 6, wherein the crRNA comprises a guide sequence portion and a repeat sequence portion capable of hybridizing to a target polynucleotide sequence.

8. The protective oligonucleotide of any one of claims 1 to 7, wherein the protective oligonucleotide binds to the crRNA to form a duplex, optionally wherein the protective oligonucleotide binds to a region of the crRNA that is not fully chemically modified.

9. The protective oligonucleotide of claim 8, wherein the duplex has a melting temperature (Tm) greater than 37°C over the entire length of the duplex.

10. The protector oligonucleotide of claim 8, wherein the duplex has a melting temperature (Tm) of less than 37°C over the complementary region comprising the guide sequence portion.

11. The protective oligonucleotide of any one of claims 7 to 10, wherein binding of tracrRNA to the guide sequence portion of the crRNA causes the protective oligonucleotide to dissociate from the crRNA.

12. The protective oligonucleotide of any one of the preceding claims, further comprising at least one moiety conjugated to the protective oligonucleotide.

13. The protective oligonucleotide of claim 12, wherein the at least one moiety is conjugated to at least one of the 5' end of the protective oligonucleotide and / or the 3' end of the protective oligonucleotide.

14. The protective oligonucleotide of claim 12, wherein the at least one moiety increases cellular uptake of the protective oligonucleotide.

15. The protective oligonucleotide of claim 12, wherein the at least one moiety promotes specific tissue distribution of the protective oligonucleotide.

16. The protective oligonucleotide of claim 12, wherein the at least one moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, ganglioside analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, and alkyl chains.

17. The protective oligonucleotide of claim 12, wherein the at least one moiety is selected from the group consisting of cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymers (ABC), hydrophilic block copolymers (HBC), poloxamer, Cy5 and Cy3.

18. The protective oligonucleotide of claim 12, wherein the at least one moiety is conjugated to the protective oligonucleotide via a linker.

19. The protective oligonucleotide of claim 18, wherein the linker is selected from the group consisting of ethylene glycol chains, alkyl chains, polypeptides, polysaccharides, and block copolymers.

20. The protective oligonucleotide of claim 18, wherein the at least one moiety is a modified lipid.

21. The protective oligonucleotide of claim 20, wherein the modified lipid is a branched lipid.

22. The protective oligonucleotide of claim 20, wherein the modified lipid is a branched lipid of formula I, Formula I: X–MC(=Y)M–Z–[L–MC(=Y)M–R]n, wherein X is a moiety that links the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, O, or S, Z is a branching group that allows two or three ("n") chains to be linked to the chemically modified guide RNA, L is an optional linker moiety, and each R is independently a saturated, monounsaturated, or polyunsaturated linear or branched moiety, sterol, or other hydrophobic group of 2 to 30 atoms in length.

23. The protective oligonucleotide of claim 20, wherein the modified lipid is a head group modified lipid.

24. The protective oligonucleotide of claim 20, wherein the modified lipid is a head group modified lipid of formula II, Formula II: X–MC(=Y)M–Z–[L–MC(=Y)M–R]n–L–K–J, wherein X is a moiety that links the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, N-alkyl, O, or S, Z is a branching group that allows two or three ("n") chains to be linked to the chemically modified guide RNA, each L is independently an optional linker moiety, and R is a saturated, monounsaturated, or polyunsaturated linear or branched moiety, sterol, or other hydrophobic group of 2 to 30 atoms in length, K is phosphate, sulfate, or amide, and J is an aminoalkane or quaternary aminoalkane group.

25. A double-stranded oligonucleotide comprising: (a) a crRNA comprising (i) a guide sequence portion capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence portion; and (b) a protective oligonucleotide complementary to the crRNA, wherein the crRNA comprises at least 50% modified nucleotides, and Wherein the protective oligonucleotide comprises at least one modified nucleotide.

26. A double-stranded oligonucleotide as described in claim 25, wherein the at least one modified nucleotide in the protective oligonucleotide or the modified nucleotide in the crRNA comprises a modification of a ribose group, a phosphate group, a nucleobase or a combination thereof.

27. A double-stranded oligonucleotide as described in claim 26, wherein the modification of the ribose group is independently selected from the group consisting of: 2'-O-methyl, 2'-fluoro, 2'-deoxy, 2'-O-(2-methoxyethyl) (MOE), 2'-NH2 (2'-amino), 4'-thio, bicyclic nucleotides, locked nucleic acids (LNA), 2'-(S)-constrained ethyl (S-cEt), constrained MOE and 2'-O,4'-C-aminomethylene bridged nucleic acids (2',4'-BNA NC ).

28. The double-stranded oligonucleotide of claim 25 or 26, wherein at least 80% of the ribose groups are chemically modified.

29. The double-stranded oligonucleotide of claim 25 or 26, wherein at least 90% of the ribose groups are chemically modified.

30. The double-stranded oligonucleotide of claim 25 or 26, wherein 100% of the ribose groups are chemically modified.

31. The double-stranded oligonucleotide of any one of claims 25 to 30, comprising a melting temperature (Tm) greater than 37°C over the entire length of the double-stranded oligonucleotide.

32. The double-stranded oligonucleotide of any one of claims 25 to 30, comprising a melting temperature (Tm) of less than 37°C over the region of the double-stranded oligonucleotide comprising the crRNA guide sequence portion.

33. The double-stranded oligonucleotide of any one of claims 25 to 30, wherein the binding of tracrRNA to the repeat sequence portion of the crRNA causes the protective oligonucleotide to dissociate from the crRNA.

34. A double-stranded oligonucleotide as described in any one of claims 25 to 33, wherein the protective oligonucleotide is bound to an incompletely chemically modified region of the crRNA.

35. The double-stranded oligonucleotide of any one of claims 25 to 33, wherein the protective oligonucleotide binds to a region of the crRNA comprising less than 100% modified ribose groups.

36. The double-stranded oligonucleotide of any one of claims 25 to 35, further comprising at least one portion conjugated to the protective oligonucleotide and / or crRNA.

37. A double-stranded oligonucleotide as described in claim 36, wherein the at least one portion is conjugated to at least one of the 5' end and / or 3' end of the protective oligonucleotide and / or crRNA.

38. The double-stranded oligonucleotide of claim 36, wherein the at least one moiety increases cellular uptake of the double-stranded oligonucleotide.

39. The double-stranded oligonucleotide of claim 36, wherein the at least one portion promotes specific tissue distribution of the double-stranded oligonucleotide.

40. The double-stranded oligonucleotide of claim 36, wherein the at least one moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, ganglioside analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, and alkyl chains.

41. The double-stranded oligonucleotide of claim 36, wherein the at least one portion is selected from the group consisting of cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymers (ABC), hydrophilic block copolymers (HBC), poloxamer, Cy5, and Cy3.

42. A double-stranded oligonucleotide as described in claim 36, wherein the at least one portion is conjugated to the protective oligonucleotide and / or crRNA via a linker.

43. The double-stranded oligonucleotide of claim 42, wherein the linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.

44. The double-stranded oligonucleotide of claim 42, wherein the at least one moiety is a modified lipid.

45. The double-stranded oligonucleotide of claim 44, wherein the modified lipid is a branched lipid.

46. ​​A double-stranded oligonucleotide as described in claim 44, wherein the modified lipid is a branched lipid of formula I, Formula I: X–MC(=Y)M–Z–[L–MC(=Y)M–R]n, wherein X is a moiety that links the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, O, or S, Z is a branching group that allows two or three ("n") chains to be linked to the chemically modified guide RNA, L is an optional linker moiety, and each R is independently a saturated, monounsaturated, or polyunsaturated linear or branched moiety, sterol, or other hydrophobic group of 2 to 30 atoms in length.

47. The double-stranded oligonucleotide of claim 44, wherein the modified lipid is a head-group modified lipid.

48. A double-stranded oligonucleotide as described in claim 44, wherein the modified lipid is a head group modified lipid of formula II, Formula II: X–MC(=Y)M–Z–[L–MC(=Y)M–R]n–L–K–J, wherein X is a moiety that links the lipid to the guide RNA, each Y is independently oxygen or sulfur, each M is independently CH2, NH, N-alkyl, O, or S, Z is a branching group that allows two or three ("n") chains to be linked to the chemically modified guide RNA, each L is independently an optional linker moiety, and R is a saturated, monounsaturated, or polyunsaturated linear or branched moiety, sterol, or other hydrophobic group of 2 to 30 atoms in length, K is phosphate, sulfate, or amide, and J is an aminoalkane or quaternary aminoalkane group.

49. The double-stranded oligonucleotide of any one of claims 25 to 48, further comprising a tracrRNA comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence portion of the crRNA.

50. The double-stranded oligonucleotide of claim 49, further comprising a nucleotide or non-nucleotide loop or linker connecting the 3' end of the crRNA portion to the 5' end of the tracrRNA portion, optionally wherein: The non-nucleotide linker comprises an ethylene glycol oligomer linker; The nucleotide loop is chemically modified; and / or The nucleotide loop comprises a nucleotide sequence of GAAA.

51. A protective oligonucleotide or double-stranded oligonucleotide as claimed in any one of the preceding claims, comprising a crRNA partial modification pattern consisting of: mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNfNrN#rN#fNfNrN#mNmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG#mC#mU(crRNA 20); Where rN = RNA, mN = 2'-O-methyl RNA, fN = 2'-fluoro RNA, N#N = phosphorothioate bond, and N = any nucleotide.

52. The protective oligonucleotide or double-stranded oligonucleotide of any of the preceding claims, wherein the protective oligonucleotide comprises a modification pattern selected from the group consisting of: mAmAmAmCmNmNmNmNmN(RC01); mAmAmAmAmCmNmNmNmNmN(RC02); mAmAmAmCmNmNmNmNmNmN(RC03); mAmAmAmAmCmNmNmNmNmNmNmN(RC04); mUmAmAmAmAmCmNmNmNmNmNmNmN(RC05); mAmAmAmAmCmNmNmNmNmNmNmNmN(RC06); mUmAmAmAmAmCmNmNmNmNmNmNmNmN(RC07); mCmUmAmAmAmAmCmNmNmNmNmNmNmNmN(RC08); mUmAmAmAmAmCmNmNmNmNmNmNmNmNmN(RC09); mCmUmAmAmAmAmCmNmNmNmNmNmNmNmNmN(RC10); mU#mA#mAmAmAmCmNmNmNmNmNmN#mN#mN(RC07-2PS); and mU#mA#mA#mAmAmCmNmNmNmN#mN#mN#mN(RC07-3PS), Where mN = 2'-O-methyl RNA, N#N = phosphorothioate bond, and N = any nucleotide.

53. A protective oligonucleotide or double-stranded oligonucleotide as described in any of the preceding claims, comprising a crRNA modification pattern selected from any one of crRNA 1 to 134 of Table 2.

54. The protective oligonucleotide or double-stranded oligonucleotide of any one of the preceding claims, wherein the crRNA binds to the tracrRNA to form a guide RNA.

55. The protective oligonucleotide or double-stranded oligonucleotide of claim 52, wherein the guide RNA binds to a Cas9 nuclease selected from the group consisting of: Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Neisseria meningitidis Cas9 (NmCas9), Campylobacter jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).

56. The protective oligonucleotide or double-stranded oligonucleotide of claim 53, wherein the Cas9 is a variant Cas9 with altered activity.

57. The protective oligonucleotide or double-stranded oligonucleotide of claim 54, wherein the variant Cas9 is selected from the group consisting of: Cas9 nickase (nCas9), catalytically dead Cas9 (dCas9), ultra-precise Cas9 (HypaCas9), high-fidelity Cas9 (Cas9-HF), enhanced specificity Cas9 (eCas9) and extended PAM Cas9 (xCas9).

58. A method of editing a genomic target region in a cell, comprising administering to the cell a genome editing system, the genome editing system comprising: A protective oligonucleotide as claimed in any one of the preceding claims; One or more crRNAs as claimed in any one of the preceding claims; one or more tracrRNAs; and RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease.

59. The method of claim 58, wherein the target gene is in a cell of an organism.

60. The method of claim 58, wherein expression of the target gene is knocked out or knocked down.

61. The method of claim 58, wherein the RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease and the one or more tracrRNAs are administered to the cell prior to the one or more crRNAs or the protective oligonucleotide.

62. The oligonucleotide or double-stranded oligonucleotide of any one of the preceding claims, further comprising a linker connecting the 3' end of the crRNA portion to the 5' end of the tracrRNA portion, optionally wherein: The linker is cleavable.

63. The oligonucleotide or double-stranded oligonucleotide of claim 62, wherein: The linker is a cleavable d(TT)-PO-C7 linker.

Images