Industrial cultivation method of golden ear

Abstract

The present application is about a method for the factory cultivation of Chinese golden ear, belonging to the field of biotechnology. The method comprises the following steps: (1) preparing a Chinese golden ear cultivation bag; (2) sending the Chinese golden ear cultivation bag into a culture room for cultivation; cultivating until the mycelium completely covers the culture medium in the cultivation bag; (3) continuing to cultivate until the primordium is formed; (4) after the primordium is formed, placing the Chinese golden ear cultivation bag into a mushroom house for cultivation, cultivating for 30 to 45 days until the petals of the Chinese golden ear fruiting body are all opened and golden yellow, and then the fruiting body can be harvested; wherein, during the cultivation period, a 0.1 to 0.5% Beauveria bassiana spore suspension is used to spray the surface of the Chinese golden ear cultivation bag 1 to 3 times. The dried fruiting body obtained by the cultivation method of the present application is golden in color, which solves the problem of black color of the dried fruiting body of golden ear obtained by the traditional cultivation method, and improves the quality of the product.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a method for factory cultivation of Tremella chinensis. Background Art

[0002] Golden ear is a fungus of the family Otomentaceae and genus Otomentaceae. This genus has at least four species in southwest China, including Golden ear ( Naematelia aurantialba )、Chinese golden ear( N. sinensis )、Vulgaris convexus( N. nodulosa ) and golden ear ( N. pedicellata ).

[0003] Golden ear is rich in fat, protein and trace elements such as phosphorus, sulfur, manganese, iron, magnesium, calcium and potassium. It is a nutritional supplement and can be used as medicine. In addition, golden ear can also be developed into a variety of skin care products and cosmetics, showing its high development and utilization value.

[0004] In the decades since the successful artificial domestication and cultivation of golden ear, the strains have basically been isolated from wild golden ear fruiting bodies and then continuously used through transgenerational reproduction, resulting in a small source of seed sources, and after multiple generations of vegetative reproduction, the production performance of the strains has deteriorated, and the strains have been carrying viruses or foreign bacteria.

[0005] Devoting oneself to the innovation of edible fungus germplasm, especially the domestication and cultivation of wild edible fungi, and the research of edible fungus germplasm resources with high active ingredients such as total flavonoids, has always been pursued by technical personnel in this field and has great application value. Summary of the invention

[0006] The Chinese golden ear strain Zhonghang 8 in this application was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 8, 2024, with the deposit number CGMCC No.41689, and the classification name is Chinese golden ear ( Naematelia sinensis ), the storage address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] Specifically, the new strain of Tricholoma auricularia sinensis in this application, Zhonghang No. 8, was obtained by the following breeding method:

[0008] First, the wild Chinese golden ear fruiting bodies collected from Tacheng Township, Yulong County, Yunnan Province in August 2022 were separated and purified by traditional methods to obtain pure cultures, and then the strains to be carried on space flight (numbered S16~106) were obtained through conventional golden ear strain resistance screening and mushroom production experiments. The depositor was requested to carry the numbered S16~106 Chinese golden ear strains on space flight through the Shenzhou 16 manned spacecraft at 9:31 on May 30, 2023, and at 8:11 on October 31, 2023, Beijing time, the numbered S16~106 Chinese golden ear strains returned to the ground with the return capsule of the Shenzhou 16 manned spacecraft; after fair treatment, the numbered S16~106 Chinese golden ear strains were brought back to the Kunming Institute of Botany, Chinese Academy of Sciences for activation and single spore separation and culture, and further screened and rescreened excellent strains according to the conventional breeding methods for edible fungi, numbered as AVIC 8.

[0009] The present application provides a method for factory-scale cultivation of Golden Fungus affine. The new strain of Golden Fungus affine, AVIC 8, obtained by aerospace screening is cultivated using the cultivation method of the present application. The obtained dried fruiting bodies are golden in color, which solves the problem of black color of dried Golden Fungus fruiting bodies obtained by traditional cultivation methods, thereby improving the quality of the product.

[0010] The present application also provides a Chinese golden fungus fruiting body, which is obtained by cultivating the above-mentioned Chinese golden fungus strain Zhonghang No. 8.

[0011] The beneficial effects of this application are:

[0012] 1. The cultivation method of the present application is used for cultivation, and the obtained dried fruit bodies are golden in color, which solves the problem of black color of the dried fruit bodies of golden ear obtained by the traditional cultivation method, and improves the quality of the product.

[0013] 2. The Chinese golden ear fruiting bodies obtained by cultivating the Chinese golden ear strain AVIC 8 in this application were tested against wild Chinese golden ear fruiting bodies that had not been carried on space flight and conventional commercially available golden ear fruiting bodies. The total flavonoids content of the Chinese golden ear fruiting bodies of the strain AVIC 8 was more significant. The total flavonoids content of the Chinese golden ear fruiting bodies in this application was as high as 0.2%, which was significantly higher than that of existing products, and it has great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The above and other objects, features and advantages of the present application will become more apparent through a more detailed description of exemplary embodiments of the present application in conjunction with the accompanying drawings, wherein the same reference numerals generally represent the same components in the exemplary embodiments of the present application.

[0015] Figure 1 This is a schematic diagram of the fresh fruiting body of the strain Zhonghang No. 8 obtained in Example 1 of the present invention;

[0016] Figure 2 This is a schematic diagram of the dried fruiting body of the strain Zhonghang No. 8 obtained in Example 1 of the present invention;

[0017] Figure 3 This is a schematic diagram of the dry product of Tremella fuciformis fruiting body obtained in Comparative Example 1 of the present invention;

[0018] Figure 4 It is a schematic diagram of the phylogenetic tree of strain Zhonghang No. 8 in this application. DETAILED DESCRIPTION

[0019] The embodiments of the present application will be described in more detail below with reference to examples. Although the embodiments of the present application are shown in the examples, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and the scope of the present application can be fully communicated to those skilled in the art.

[0020] Example 1

[0021] This example illustrates the breeding process of the Chinese golden ear strain Zhonghang 8, and the specific steps are as follows:

[0022] (1) The wild golden ear fruiting bodies collected from Tacheng Township, Yulong County, Yunnan Province in August 2022 were separated and purified by traditional methods to obtain pure culture, and then the strains to be carried by spaceflight (numbered S16~106) were obtained through conventional golden ear strain resistance screening and mushroom fruiting experiments. The applicant used universal fungal ITS primers (ITS4 / ITS5) to amplify and identify the strain, and the identification results showed that it was golden ear.

[0023] (2) At 9:31 a.m. on May 30, 2023, strains S16 to S106 were carried into space by the Shenzhou 16 manned spacecraft. At 8:11 a.m. Beijing time on October 31, 2023, strains S16 to S106 were returned to Earth in the return capsule of the Shenzhou 16 manned spacecraft. After notarization, they were brought back to the Culture Collection Center of the Kunming Institute of Botany, Chinese Academy of Sciences for relevant research.

[0024] (3) The space-borne strains S16~106 were activated, the activated mycelium was ground, and the single root fragments were separated and cultured to obtain ZH801~ZH8200.

[0025] (4) Referring to GB / T 21125-2007 Technical Specifications for the Selection and Breeding of Edible Fungi, the conventional selection and breeding methods for edible fungi were further used to obtain a strain that was easy to produce mushrooms, grew fast, and had a high content of total flavonoids. The strain was named Zhonghang No. 8. The strain was preserved in the Kunming Institute of Botany, Chinese Academy of Sciences (KUNCC) using the 10% glycerol + distilled water preservation method.

[0026] (6) The Chinese golden fungus strain Zhonghang 8 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on December 8, 2024, with the deposit number: CGMCC No.41689, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0027] The characteristics of the Chinese golden fungus strain Zhonghang 8 in this embodiment are as follows:

[0028] 1. Morphological characteristics

[0029] The fruiting body of the Chinese golden ear is medium to large, colloid, irregular brain tumor-shaped, narrow at the base, 3-15 cm in diameter, golden yellow on the surface and white inside when fresh, with basidia 18-24 × 17-20 μm and basidiospores 9.5-11 × 8-9.5 μm. Figure 1 shown.

[0030] 2. The genomic DNA of the Chinese golden ear strain Zhonghang 8 was first amplified and sequenced using the universal primers ITS4 / ITS5 for fungi for the internal transcribed spacer region (ITS) of the ribosome. The bases obtained by sequencing are shown in SEQ ID NO.1, specifically:

[0031] GTCAGCCCTCGGGCTCAAACATTGTGTAATGAACGTCTATAACATAACCTAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCAT GAACTCTCAATCCCCTCGGGTTTCCGACTGGATTGGACTTGGGTGCTGCCGTTTGGCTCCTCCTTAAATGACTTAGTGGATGTCTCCCCTAGTCGATGTAATAAGTTTCATCGGTGAAGGGTCTAGTCTGCTCACAATCGCCTTTGCTGGCAACATTTGTACTCTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAAA

[0032] The fragment was sequenced through GenBank and the result was that it belonged to the genus Xylella fastidiosa ( Naematelia) fungi, and 100% homologous to gene accession numbers (PQ084585, PP917727, PQ650952, OP881423 and OQ629799, etc.). At the same time, phylogenetic tree construction was performed to obtain the following phylogenetic tree, as shown in the following figure. Figure 4 The strain Zhonghang 8 (CGMCC No. 41689) was identified as Auricularia auriculariae.

[0033] The specific cultivation method of the Chinese golden fungus strain Zhonghang No. 8 in this embodiment is as follows:

[0034] (1) Preparing a Goldenrod cultivation bag; the specific operation is as follows: mixing the cultivation substrate evenly and putting it into the culture bag, sterilizing it, and inoculating the Goldenrod strain and the hairy leather fungus to obtain the Goldenrod cultivation bag; specifically, the Goldenrod strain is obtained by expanding the Goldenrod strain Zhonghang 8 into a cultivation strain by tissue separation method;

[0035] (2) Place the Golden Ear cultivation bag in a culture room for cultivation at a temperature of 23°C to 25°C, relative humidity of 65% to 70%, and CO2 concentration ≤ 3000 PPM; cultivate until the mycelium completely covers the culture medium in the cultivation bag;

[0036] (3) Control the temperature in the culture room to 17℃~20℃, the relative humidity to 70%~85%, the light intensity to 50lx~100lx, the CO2 concentration to ≤2500PPM, and cultivate for 7d~10d until the primordium is formed;

[0037] (4) After the primordium is formed, place the cultivation bag of Chinese golden fungus in the fruiting room, control the temperature at 17-21℃, humidity at 80-95%, CO2 concentration at 450-600 PPM, and light intensity at 300-500Lx. Cultivate for 30-45 days until the petals of the Chinese golden fungus fruiting body are fully opened and golden yellow, then it can be harvested.

[0038] During the culture period, the surface of the Chinese golden ear cultivation bag was sprayed three times with a Beauveria bassiana spore suspension of 0.1-0.5%, specifically, it was sprayed once with a Beauveria bassiana spore suspension of 0.5% and sprayed twice with a Beauveria bassiana spore suspension of 0.1%.

[0039] The harvested fruiting bodies of the Chinese golden fungus strain Zhonghang 8 were dried by conventional methods to obtain a dry product with a golden color. Figure 2 shown.

[0040] In addition, the total flavonoid content of the fruiting bodies of the Chinese golden ear strain Zhonghang No. 8 cultivated in Example 1 was compared with that of wild Chinese golden ear fruiting bodies and existing conventional commercially available golden ear fruiting bodies.

[0041] Specifically, the determination method refers to the existing literature: Yang Wenhui, Meng Min, et al. Study on the antioxidant activity and total flavonoids content of different edible fungi [J]. Journal of Traditional Chinese Medicine, 2020, 31 (2): 301-303.

[0042] The test results are shown in the following table:

[0043] Table 1 Total flavonoids content determination results

[0044]

[0045] It can be seen from the above table that compared with the test of wild Chinese golden ear fruiting bodies that have not been carried into space and conventional commercially available golden ear fruiting bodies, the total flavonoids content of the Chinese golden ear strain Zhonghang No. 8 fruiting bodies is more significant.

[0046] Comparative Example 1

[0047] Comparative Example 1 involves a cultivation method of another Tricholoma australis strain, AVIC 8, which is different from that in Example 1 in that a 0.1-0.5% Beauveria bassiana spore suspension is not used to spray the surface of the Tricholoma australis cultivation bag during the culture period, and the rest are the same.

[0048] The dried fruit obtained by drying the fruiting bodies obtained in this comparative example by conventional methods has a black color and low quality. Figure 3 shown.

[0049] The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A method for industrial cultivation of Tremella chinensis, characterized in that: The following steps are involved: (1) Preparing a golden ear cultivation bag; the golden ear strain is obtained by expanding the golden ear strain Zhonghang 8 into a cultivar through tissue separation method; the golden ear strain Zhonghang 8 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on December 8, 2024, with a deposit number of CGMCC No.41689, and is classified and named as Golden Ear ( Naematelia sinensis ); (2) Place the Golden Ear cultivation bag in a culture room for cultivation at a temperature of 23°C to 25°C, relative humidity of 65% to 70%, and CO2 concentration ≤ 3000 PPM; cultivate until the mycelium completely covers the culture medium in the cultivation bag; (3) Control the temperature in the culture room to 17℃~20℃, the relative humidity to 70%~85%, the light intensity to 50 lx~100lx, the CO2 concentration to ≤2500PPM, and cultivate for 7d~10d until the primordium is formed; (4) After the primordium is formed, place the Chinese golden ear cultivation bag in the fruiting room, control the temperature at 17-21°C, humidity at 80-95%, CO2 concentration at 450-600 PPM, and light intensity at 300-500Lx, and cultivate for 30-45 days until the petals of the Chinese golden ear fruiting body are fully opened and golden yellow, then it can be harvested; During the culture period, the surface of the Chinese golden ear cultivation bag was sprayed three times with a Beauveria bassiana spore suspension with a concentration of 0.1-0.5%, specifically, it was sprayed once with a Beauveria bassiana spore suspension with a concentration of 0.5%, and it was sprayed twice with a Beauveria bassiana spore suspension with a concentration of 0.1%.

2. The method for industrial cultivation of Tremella chinensis according to claim 1, characterized in that: The step (1) specifically comprises: mixing the cultivation substrate evenly and putting it into a culture bag, sterilizing it, and inoculating it with Auricularia auricularia sinensis and Auricularia tricholoma to obtain a Auricularia auricularia sinensis cultivation bag.

Images