Use of lithium-containing compounds in treatment of osteoporosis

Abstract

The invention relates to an application of a lithium-containing compound in the treatment of osteoporosis. Specifically, the invention relates to application of a lithium-containing compound in preparation of a medicine for treating osteoporosis, preferably, the lithium-containing compound is lithium carbonate, and the osteoporosis is selected from postmenopausal osteoporosis and senile osteoporosis.

Description

Technical Field

[0001] The present invention relates to the field of treatment of chronic diseases related to aging, and in particular to the use of lithium-containing compounds in the preparation of drugs for treating osteoporosis. Background Art

[0002] Osteoporosis is a systemic bone disease characterized by low bone mass, damaged bone microstructure, increased bone brittleness and easy fracture. With the rapid increase in the prevalence of osteoporosis in my country, it has become an important public health issue. The national epidemiological survey on osteoporosis showed that the prevalence of osteoporosis in people over 50 years old was 19.2%, including 32.1% in women and 6.9% in men; the prevalence of osteoporosis in people over 65 years old was 32.0%, including 51.6% in women and 10.7% in men. According to the above epidemiological data, it is estimated that the number of people with osteoporosis in my country is about 90 million, including about 70 million women. Osteoporotic fractures are extremely harmful and are one of the main causes of disability and death in elderly patients. Within one year after a hip fracture, 20% of patients may die from various complications; about 50% of patients are disabled and their quality of life is significantly reduced. In addition, the medical treatment and care of osteoporosis and fractures will also cause heavy burdens on families and society. It is estimated that by 2035, my country's medical expenses for major osteoporotic fractures (wrist, vertebral and hip) will reach 132 billion yuan; and by 2050, this part of medical expenditure will climb to 163 billion yuan.

[0003] How to provide the best treatment for osteoporosis patients has become an urgent need for social development. The treatment options for osteoporosis mainly include drug therapy, non-drug therapy and surgical treatment. At present, calcium, alendronate sodium and denosumab are the main drugs used in clinical practice. All of the above drugs have limitations such as limited effect when used alone, possible drug resistance and obvious side effects when used for a long time. Therefore, finding new therapeutic targets and developing safer and more effective therapeutic drugs can provide more options for the effective treatment of osteoporosis.

[0004] Bones need to have sufficient rigidity and toughness to maintain their strength, bear external forces, and avoid fractures. The integrity of bones is maintained by the repeated, spatiotemporally coupled bone resorption and bone formation processes, a process called bone remodeling. Bone remodeling is carried out by the basic multicellular unit (BMU) of bones composed of osteoblasts, osteoclasts, and osteocytes. Factors such as aging and estrogen deficiency in women after menopause lead to excessive activation of osteoclasts, an increase in the bone resorption / bone formation ratio, and osteoporosis.

[0005] Osteoclasts are multinuclear giant cells formed by the continuous fusion of mononuclear precursor cells, and play an important role in the formation of osteoporosis. Fusion vesicles in osteoclasts transport specialized transporters to the ruffled borders of osteoclasts, including the vacuolar H + -ATPase (v-ATPase) and chloride channel-7 (CIC-7), and release extracellular matrix-digesting acidic proteases, such as cathepsin K and matrix metalloproteinase 9 (MMP9), into the cavity formed with the bone matrix. v-ATPase plays a key role in the bone resorption process. Osteoclasts pump protons into the absorption cavity through v-ATPase to acidify the bone microenvironment, so that the acidic proteases that digest collagen fibers and other organic components of the bone matrix are at the optimal working pH. Therefore, targeting v-ATPase is crucial to lowering the pH of the osteoclast absorption space.

[0006] Lithium carbonate (Li 2 CO 3 , LC) is a first-line clinical treatment for bipolar disorder or other mental illnesses caused by emotional instability. Recent studies have reported that lithium ions can bind to the K-ring of Enterococcus v-ATPase and induce structural changes. Recent studies have found that lithium ions can inhibit CD8 + The V0C subunit of v-ATPase in the lysosomal membrane of T cells inhibits its hydrogen ion transport capacity. Therefore, we have found a clinical drug lithium carbonate with clear pharmacological and toxicological effects, which can inhibit the secretion of hydrogen ions by osteoclasts by targeting the v-ATPase subunit ATP6V0C, and then inhibit the excessive activation of osteoclasts by acidifying the cytoplasm and causing the glycolysis rate to decrease, thereby treating osteoporosis.

[0007] In this study, we provide evidence that lithium carbonate, a clinically used mood stabilizer, can treat osteoporosis by inhibiting osteoclast differentiation and function.

[0008] The above description of the background technology is only for facilitating an in-depth understanding of the technical solution of the present invention (such as the technical means used, the technical problems solved and the technical effects produced), and should not be regarded as an admission or any form of implication that the information constitutes prior art already known to those skilled in the art. Summary of the invention

[0009] The present invention is proposed to solve the problems of low efficacy, large side effects and easy rebound after drug withdrawal in the current clinical treatment of osteoporosis.

[0010] The present application provides a mood stabilizer, lithium carbonate, which targets osteoclasts and is used to treat the chronic disease of osteoporosis. Specifically, the present invention provides a lithium-containing compound that targets vacuolar H+ -ATPase enzyme, inhibiting the secretion of hydrogen ions by osteoclasts during bone resorption, leading to cytoplasmic acidification, reducing the glycolysis rate of osteoclasts, thereby inhibiting osteoclast differentiation and over-activation, thereby treating osteoporosis.

[0011] Therefore, the present application relates to the use of lithium-containing compounds in the preparation of drugs for treating osteoporosis.

[0012] In a particular embodiment, the lithium-containing compound is selected from lithium carbonate and lithium chloride.

[0013] In a particular embodiment, the lithium-containing compound is lithium carbonate.

[0014] In a particular embodiment, the osteoporosis is primary osteoporosis.

[0015] In a particular embodiment, the primary osteoporosis is selected from postmenopausal osteoporosis and senile osteoporosis.

[0016] Postmenopausal osteoporosis mainly occurs in postmenopausal women. Due to estrogen deficiency, bone mass decreases and bone tissue structure changes occur, which increases bone brittleness and makes bones more susceptible to fractures, as well as pain, bone deformation, and complications caused by fractures.

[0017] Osteoporosis in the elderly refers to osteoporosis caused by aging.

[0018] The applicant has found through a large number of experimental studies that lithium carbonate can effectively treat osteoporosis in ovariectomized mice and aging mice. Lithium carbonate inhibits the acid secretion function of osteoclasts, reduces the cytoplasmic pH of osteoclasts, and increases the extracellular pH. At the same time, lithium carbonate can inhibit the differentiation and function of osteoclasts. Compared with existing osteoporosis treatment methods, the lithium carbonate provided by the present invention has better long-term therapeutic effects. On the other hand, the safety of the lithium carbonate provided by the present invention as a commonly used clinical drug has been widely verified. When used within a reasonable dosage range, the drug treatment method containing lithium compounds has higher safety.

[0019] In order to explain the present invention in more detail, the specification provides the following specific embodiments, and illustrates these specific embodiments in conjunction with the accompanying drawings, but the solutions disclosed in the present invention are not limited thereto. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Lithium carbonate treatment has been shown to improve ovariectomy-induced bone loss and reduction in bone matrix collagen.

[0021] Figure 2 Lithium carbonate treatment has been shown to improve aging-induced bone loss.

[0022] Figure 3 It shows that lithium carbonate treatment can prevent the occurrence of senile osteoporosis.

[0023] Figure 4 The results showed that lithium carbonate treatment in the ovariectomy osteoporosis model had a lower risk of osteoporosis after drug withdrawal compared with clinical bisphosphonates.

[0024] Figure 5 It shows that osteoporosis does not occur for a long time after discontinuation of lithium carbonate treatment for senile osteoporosis.

[0025] Figure 6 It shows that low-dose lithium carbonate treatment can still improve bone loss caused by oophorectomy and reduce drug side effects.

[0026] Figure 7 Lithium carbonate treatment was shown to improve ovariectomy-induced osteoclast hyperactivation and restore osteoblast activity.

[0027] Figure 8 It shows that lithium carbonate can improve the formation of bone resorption pits caused by excessive activation of osteoclasts induced by ovariectomy.

[0028] Fig. 9 It was shown that lithium carbonate can inhibit RANKL-induced osteoclast formation.

[0029] Fig.10 It shows that lithium carbonate can target v-ATPase and inhibit the hydrogen transport ability of osteoclasts. DETAILED DESCRIPTION

[0030] Various cell lines, drugs and experimental animals used in the examples:

[0031] Cells: Primary monocytes derived from the bone marrow of C57BL / 6 mice (Beijing Vital River Laboratory) were selected and induced into osteoclasts;

[0032] Drugs: lithium carbonate (Sigma-Aldrich), macrophage colony-stimulating factor MCSF (Amizona Scientific), receptor activator of nuclear factor-κB ligand RANKL (Amizona Scientific);

[0033] Animals (Beijing Vital River Laboratory): 8-week-old C57BL / 6 mice, 20-month-old C57BL / 6 mice.

[0034] Other reagents used in the examples are commercially available.

[0035] Example 1: Lithium carbonate treatment can improve bone loss caused by oophorectomy

[0036] 1. Experimental Procedure

[0037] C57BL / 6 mice were subjected to bilateral ovariectomy (OVX) at 8 weeks of age, and treatment began on day 60 after OVX. For lithium carbonate treatment, mice were randomly divided into sham, OVX, and OVX+LC (75 mg / kg) groups (n=6 per group). 75 mg / kg LC was administered orally by gavage daily for 50 days, and then the mice were killed. The bilateral femurs of each experimental mouse were collected and fixed in 4% paraformaldehyde (as Figure 1 A). The left femur was scanned in a small animal in vivo Micro-CT (SkyScan 1176) for bone morphology analysis. The scanning parameters were set at 100 kV and 98 mA, with a resolution of 9 um. Trabecular bone parameters including bone volume / tissue volume (BV / TV), bone surface area / tissue volume (BS / TV), trabecular number (Tb.N), trabecular spacing (Tb.Sp), trabecular thickness (Tb.Th) and bone mineral density (BMD) were used for trabecular bone parameter analysis and three-dimensional reconstruction. The bone tissue was embedded in paraffin and sectioned. The bone tissue was stained with HE to evaluate the bone volume / tissue volume (BV / TV).

[0038] 2. Experimental results

[0039] like Figure 1 As shown in B and C, Micro-CT results showed that compared with the OVX group, after lithium carbonate treatment, the levels of trabecular BV / TV, BS / TV, Tb.N, Tb.Th, and BMD increased, and the level of Tb.Sp decreased.

[0040] like Figure 1 As shown in D, HE results showed that the BV / TV level of trabecular bone increased after lithium carbonate treatment compared with the OVX group.

[0041] During this period, the blood lithium concentration of mice was dynamically monitored and maintained at 1 mM.

[0042] Example 2: Lithium carbonate treatment can improve bone loss caused by aging

[0043] 1. Experimental Procedure

[0044] At 20 months of age, C57BL / 6 mice were scanned by small animal in vivo Micro-CT (SkyScan1176) for bone morphology analysis of the left femur. 75 mg / kg LC was administered by oral gavage every day for 66 days. The mice were sacrificed and the bilateral femurs of each experimental mouse were collected and fixed in 4% paraformaldehyde (as Figure 2The left femur was scanned using a small animal in vivo Micro-CT (SkyScan 1176) for bone morphology analysis. The scanning parameters were set at 100 kV and 98 mA, with a resolution of 9 μm. Trabecular parameters included bone volume / tissue volume (BV / TV), bone surface area / tissue volume (BS / TV), trabecular number (Tb.N), trabecular spacing (Tb.Sp), trabecular thickness (Tb.Th), and bone mineral density (BMD).

[0045] 2. Experimental results

[0046] like Figure 2 As shown in B and C, Micro-CT results showed that the osteoporosis caused by aging in mice was improved after lithium carbonate treatment compared with the old mice without oral lithium carbonate.

[0047] During this period, the blood lithium concentration of mice was dynamically monitored and maintained at 1 mM.

[0048] Example 3: Lithium carbonate treatment can prevent the occurrence of senile osteoporosis

[0049] 1. Experimental Procedure

[0050] At 13 months of age, C57BL / 6 mice were scanned by small animal in vivo Micro-CT (SkyScan 1176) for bone morphometric analysis of the left femur. After daily oral gavage of 75 mg / kg LC for 60 and 120 days, the left femur was scanned by small animal in vivo Micro-CT (SkyScan 1176) for bone morphometric analysis. The scanning parameters were set at 100 kV and 98 mA with a resolution of 9 μm. Trabecular bone parameters included bone volume / tissue volume (BV / TV), bone surface area / tissue volume (BS / TV), trabecular number (Tb.N), trabecular spacing (Tb.Sp), trabecular thickness (Tb.Th), and bone mineral density (BMD).

[0051] 2. Experimental results

[0052] like Figure 3 As shown, Micro-CT results showed that middle-aged and elderly mice that did not take lithium carbonate orally developed osteoporosis at 17 months of age, while the bone mass of mice that took lithium carbonate did not decrease significantly.

[0053] Example 4: Comparison of lithium carbonate treatment with clinical bisphosphonates (BPs) and the risk of osteoporosis after drug withdrawal

[0054] 1. Experimental Procedure

[0055] The bisphosphonate (BP) used in this example is alendronate sodium.

[0056] C57BL / 6 mice were subjected to bilateral ovariectomy (OVX) at 8 weeks of age, and treatment began on day 60 after OVX. For lithium carbonate treatment, mice were randomly divided into sham operation, OVX, OVX+LC (25 mg / kg) group, OVX+LC (50 mg / kg) group, OVX+LC (75 mg / kg) group, OVX+BP group, (n=6 in each group). 75 mg / kg LC was administered by oral gavage every day for 50 days, and the mice were killed 30 days after withdrawal. The bilateral femurs of each experimental mouse were collected and fixed in 4% paraformaldehyde (such as Figure 4 Figure 4 (a). The left femur was scanned by small animal in vivo Micro-CT (SkyScan 1176) for bone morphology analysis. The scanning parameters were set at 100 kV and 98 mA with a resolution of 9 μm. Trabecular bone parameters included bone volume / tissue volume (BV / TV), bone surface area / tissue volume (BS / TV), trabecular number (Tb.N), trabecular spacing (Tb.Sp), trabecular thickness (Tb.Th) and bone mineral density (BMD).

[0057] 2. Experimental results

[0058] like Figure 4 As shown in B and C, the Micro-CT results showed that the bone mass of mice remained good 30 days after withdrawal of lithium carbonate treatment compared with the OVX group and the BP group.

[0059] Example 5: Lithium carbonate treatment of senile osteoporosis without osteoporosis for a long time after drug withdrawal

[0060] 1. Experimental Procedure

[0061] At 20 months of age, C57BL / 6 mice were randomly divided into a vehicle group and a lithium carbonate LC group after bone morphology analysis by scanning the left femur with small animal in vivo Micro-CT (SkyScan1176). The lithium carbonate group was given 75 mg / kg LC by oral gavage every day for 66 days. After withdrawal (withdrawal) for 30 days, the mice were killed and the bilateral femurs of each experimental mouse were collected and fixed in 4% paraformaldehyde (such as Figure 5 The left femur was scanned using a small animal in vivo Micro-CT (SkyScan 1176) for bone morphology analysis. The scanning parameters were set at 100 kV and 98 mA, with a resolution of 9 μm. Trabecular parameters included bone volume / tissue volume (BV / TV), bone surface area / tissue volume (BS / TV), trabecular number (Tb.N), trabecular spacing (Tb.Sp), trabecular thickness (Tb.Th), and bone mineral density (BMD).

[0062] 2. Experimental results

[0063] like Figure 5 As shown in B and C, the Micro-CT results showed that compared with the Vehicle group, the bone mass of the elderly mice remained good after the lithium carbonate treatment was withdrawn 30 days later and the normal bone mass was restored.

[0064] Example 6: Low-dose lithium carbonate treatment can still improve bone loss caused by oophorectomy and reduce drug side effects.

[0065] 1. Experimental Procedure

[0066] C57BL / 6 mice were subjected to bilateral ovariectomy (OVX) at 8 weeks of age, and treatment was started on day 60 after OVX. For lithium carbonate treatment, mice were randomly divided into sham, OVX, OVX+LC (25 mg / kg), OVX+LC (50 mg / kg), and OVX+LC (75 mg / kg) groups (n=6 in each group), with 75 mg / kg LC as the clinical dose. LC was administered orally by gavage every day for 50 days, and then the mice were killed. The bilateral femurs of each experimental mouse were collected and fixed in 4% paraformaldehyde (as Figure 1 A). The left femur was scanned in a small animal in vivo Micro-CT (SkyScan 1176) for bone morphology analysis. The scanning parameters were set at 100 kV and 98 mA, with a resolution of 9 um. Trabecular bone parameters including bone volume / tissue volume (BV / TV), bone surface area / tissue volume (BS / TV), trabecular number (Tb.N), trabecular spacing (Tb.Sp), trabecular thickness (Tb.Th) and bone mineral density (BMD) were used for trabecular bone parameter analysis and three-dimensional reconstruction. The bone tissue was embedded in paraffin and sectioned. The bone tissue was stained with HE to evaluate the bone volume / tissue volume (BV / TV).

[0067] 2. Experimental results

[0068] like Figure 6 As shown in A and B, Micro-CT results showed that compared with the sham operation and normal dose 75 mg / kg LC groups, low-dose 25 mg / kg lithium carbonate treatment can still improve bone loss caused by ovariectomy, which can better reduce drug side effects.

[0069] Example 7: Lithium carbonate can improve the overactivation of osteoclasts caused by ovariectomy 1. Experimental procedures

[0070] C57BL / 6 mice underwent bilateral ovariectomy (OVX) at 8 weeks of age, and treatment began on day 60 after OVX. For lithium carbonate treatment, mice were randomly divided into sham, OVX, and OVX+LC (75 mg / kg) groups (n=6 in each group). 75 mg / kg LC was administered by oral gavage every day for 50 days, and then the mice were killed. Eyeball blood was collected from mice, placed at room temperature for 2 hours, and centrifuged at 4°C, 3000 rpm, for 15 min to obtain serum for the detection of serum calcium, serum phosphorus, bone resorption marker serum type I collagen C-terminal telopeptide (CTX), and bone formation marker type I collagen N-terminal propeptide (PINP); bilateral femurs of each experimental mouse were collected and fixed in 4% paraformaldehyde. Bone tissues were embedded in paraffin and sectioned. Bone tissues were stained with tartrate-resistant acid phosphatase (TRAP) and alkaline phosphatase (ALP) to evaluate the number of osteoclasts / trabecular circumference, osteoclast area / trabecular area and the number of osteoblasts / trabecular circumference, osteoblast area / trabecular area.

[0071] 2. Experimental results

[0072] like Figure 7 As shown in A, the results of serological indicators showed that after osteoporosis occurred in mice, serum calcium, serum phosphorus, and CTX-1 levels increased, and PINP level decreased. After lithium carbonate treatment, serum calcium, serum phosphorus, and CTX-1 levels returned to normal, and PINP showed an upward trend.

[0073] like Figure 7 As shown in B, TRAP staining results showed that lithium carbonate treatment effectively reduced the increase in number and area of ​​osteoclasts caused by OVX-induced excessive activation.

[0074] like Figure 7 As shown in C, the ALP staining results showed that lithium carbonate treatment effectively increased the number and area of ​​osteoblasts that were reduced in activity due to OVX.

[0075] Example 8: Lithium carbonate can improve the abnormal bone resorption function of osteoclasts caused by ovarian removal

[0076] 1. Experimental Procedure

[0077] C57BL / 6 mice were subjected to bilateral ovariectomy (OVX) at 8 weeks of age, and treatment was started on the 60th day after OVX. For lithium carbonate treatment, mice were randomly divided into sham, OVX, and OVX+LC (75 mg / kg) groups (n=6 in each group). 75 mg / kg LC was administered by oral gavage every day for 50 days, and the mice were killed. The bilateral femurs of each experimental mouse were collected and fixed in 2.5% glutaraldehyde at room temperature for 2 hours, and rinsed for 1 hour in 0.1 mol / L phosphate buffer (pH=7.2), washed three times, and then the samples were dehydrated in a graded ethanol series. After drying, a small amount of conductive glue was applied to the samples with a toothpick, vacuum coating and SEM microscopy were performed, and then the femoral epiphyseal bone resorption fossa was photographed using a scanning electron microscope.

[0078] 2. Experimental results

[0079] like Figure 8 As shown in A, scanning electron microscopy results show that after lithium carbonate treatment, the larger area and more number of bone resorption pits formed by excessive bone resorption by osteoclasts caused by OVX are reduced.

[0080] Example 9: Lithium carbonate can inhibit RANKL-induced osteoclast formation

[0081] 1. Experimental Procedure

[0082] (1) Primary osteoclast culture: BMDM were obtained from the femur and tibia bone marrow of 5-week-old C57BL / 6 mice to induce osteoclast differentiation. Bone marrow cells were diluted and cultured in a 10 cm dish containing α-MEM medium (Gibco) containing 30 ng / mL MCSF (Amizona Scientific) at 37°C and 5% CO. 2 Culture for 16 hours. Then transfer the supernatant to a new 10 cm culture dish. BMDM adhered to the bottom for subsequent experiments. To induce osteoclast differentiation, BMDM were seeded on a 96-well plate with bone slices at 2 × 10 cells per well. 4 Osteoclast differentiation was induced in α-MEM in the presence of 30 ng / mL MCSF and 100 ng / mL RANKL for 7 days.

[0083] (2) RNA seq: grouped into MCSF, MCSF+RANK, and MCSF+RANK+LC groups (e.g. Fig. 9(A). After 5 days of osteoclast culture, the LC group was treated with 1 mM lithium carbonate for 48 h, and three groups of RNA were collected. Total RNA was extracted from cells using TRIzol (Takara, Japan) according to the manufacturer's protocol. RNA from quadruplicate treated samples was purified and RNA-seq analysis was performed using the DNBSEQ-G50 platform (BGI-Shenzhen, China). Differential gene expression analysis, KEGG analysis, and heat map analysis were performed by the Dr.Tom online system (BGI-Shenzhen, China).

[0084] (3) Osteoclast phenotype gene detection: Total RNA was extracted from osteoclast samples using TRIzol reagent (Takara, Japan) and dissolved in ddH 2 O, 1 μg RNA in each group was reverse transcribed into 20 μl cDNA, and after adding HiScript IIQ RTSuperMix (Vazyme Biotech, Nanjing, China), RT-qPCR was performed. The forward and reverse PCR primers are listed in Table 1. For data analysis, the expression of the target gene was normalized to the expression of β-actin.

[0085] Table 1

[0086] Gene name Upstream primer Downstream primer Nfatc1 GGTGCCTTTTGCGAGCAGTATC CGTATGGACCAGAATGTGACGG Acp5 GCGACCATTGTTAGCCACATACG CGTTGATGTCGCACAGAGGGAT Ctsk AGCAGAACGGAGGCATTGACTC CCCTCTGCATTTAGCTGCCTTTG MMP9 GCTGACTACGATAAGGACGGCA TAGTGGTGCAGGCAGAGTAGGA Atp6v0d2 ACGGTGATGTCACAGCAGACGT CTCTGGATAGAGCCTGCCGCA CA2 CTCTGCTGGAATGTGTGACCTG CCAGTTGTCCACCATCGCTTCT

[0087] (4) Trap staining: After obtaining primary osteoclasts according to step (1), the osteoclasts were washed with PBS, fixed in paraformaldehyde (4%) for 15 min, and then fixed with ddH 2 O washing. TRAP staining was performed using a TRAP staining kit (Sigma Aldrich). After staining, multinucleated cells were counted as osteoclasts and images were taken under a confocal microscope (Dmi8).

[0088] (5) F-actin staining: After obtaining primary osteoclasts according to step (1), the osteoclasts were washed with PBS, fixed in paraformaldehyde (4%) for 15 min, and then fixed with ddH 2 O washing. Use 5ug / ml FITC-phalloidin to stain at room temperature for 30 minutes, DAP to stain the cell nucleus for 10 minutes, wash the cells 3 times with PBS; remove excess water, add fluorescent mounting solution (Solarbio), cover with coverslip, and observe under confocal microscope (Dmi8).

[0089] (6) CKK-8 assay: After culturing primary osteoclasts in a 96-well plate according to step (1), 10 μl of CCK-8 solution (Beyotime) was added to each well and incubated for 4 h. The absorbance was measured at 450 nm using a microplate reader.

[0090] 2. Experimental results

[0091] like Fig. 9 As shown in B, RNA-seq results showed that compared with the MCSF group, the RANKL group significantly upregulated osteoclast-specific genes. Compared with the RANKL group, the RANKL+LC group significantly downregulated the expression of osteoclast phenotype genes, indicating that LC inhibited the differentiation and formation of osteoclasts.

[0092] like Fig. 9 As shown in C, the results of osteoclast phenotype gene detection showed that lithium carbonate treatment could reduce the expression of its phenotype and inhibit its differentiation.

[0093] like Fig. 9 As shown in D, the results of CKK-8 cell viability assay showed that treatment with 1 mM lithium carbonate did not affect cell proliferation and cell death.

[0094] like Fig. 9 As shown in E, the results of Trap staining and F-actin staining showed that lithium carbonate treatment could effectively inhibit the formation of osteoclasts and their actin rings.

[0095] Example 10: Lithium carbonate can target v-ATPase to inhibit the hydrogen transport ability of osteoclasts

[0096] 1. Experimental Procedure

[0097] (1) After culturing primary osteoclasts according to step (1) of Example 9, the osteoclasts cultured on the bone slices were washed with sodium hypochlorite, fixed in glutaraldehyde at room temperature for 2 hours, rinsed with 0.1 mol / L phosphate buffer (pH=7.2) for 1 hour, and washed three times. The samples were then dehydrated in a graded ethanol series. After drying, a small amount of conductive glue was applied to the samples with a toothpick, vacuum coated and examined by SEM, and then the bone resorption pits on the bone slices were photographed using a scanning electron microscope.

[0098] (2) Determination of osteoclast cytoplasmic and lysosomal pH: Osteoclasts were labeled with the dyes pHrodo Red AM (Thermo Fisher) for determination of intracellular acidity and LysoSensor Yellow / Blue DND-160 for determination of lysosomal pH in prewarmed RPMI 1640 medium at 37°C for 30 min, then washed with PBS and treated with 10 μM valinomycin and 10 μM nigericin in 25 mM MES calibration buffer (pH 4.5-7.5) for 10 min in a black 96-well plate. The fluorescence was immediately measured using a microplate reader (Synergy H1, BioTek) at Ex-360 / EM-460 and Ex-360 / EM-528. The pH of osteoclasts was calculated based on the pH standard curve obtained with the calibration buffer.

[0099] (3) v-ATPase activity detection: Osteoclast membrane proteins were extracted according to the instructions of the membrane protein extraction kit (Beyotime). In the v-ATPase activity assay, ATPase hydrolyzes ATP to release ADP and free phosphate ions, and generates a strong and stable chromophore through the bonding reaction of phosphate and malachite green, which is detected by a microplate reader at OD 650nm. The osteoclast v-ATPase activity is then calculated based on the standard sample fitting curve.

[0100] (4) Immunofluorescence localization of V0C and V1A subunits of v-ATPase: Osteoclasts were washed with PBS, fixed in paraformaldehyde (4%) for 15 min, and then fixed with ddH 2 O wash. Permeabilize in 0.1% Triton X-100 (Solarbio) and block with 5% BSA (Biosharp) for 30 minutes at room temperature. Discard the blocking solution, add primary antibodies ATP6V0C Abbit mAb (ABclonal) and ATPV1A Mouse mAb (Thermo Fisher) diluted 1:100 in PBS, incubate overnight at 4°C, wash cells with PBS, and incubate with fluorophore-conjugated secondary antibodies for 1 hour at room temperature. Cell nuclei are stained in DAPI solution. Then wash cells with PBS and perform fluorescence imaging analysis by super-resolution microscopy (DeltaVision OMX Flex, GE).

[0101] (5) Detection of V0C and V1A subunit proteins of v-ATPase: Osteoclast membrane proteins and cytoplasmic proteins were extracted according to the instructions of the membrane protein extraction kit (Beyotime), and the protein concentration was measured using the (BCA) kit (Boster Biotechnology, Wuhan, China) and then western blot was performed. The proteins were separated by electrophoresis (80V) in SDS-PAGE and transferred to a PVDF membrane (#IPVH00010, Millipore, Boston, USA). The membrane was then blocked in 5% BSA dissolved in TBS (containing 0.1% Tween 20) at room temperature for 1 hour and incubated overnight at 4°C with the primary antibody ATP6V0C Rabbit mAb (ABclonal). The membrane was washed 3 times the next day and then incubated with the secondary antibody HRP, Goat Anti-Rabbit IgG (Abbkine) for 1 hour. The analysis was performed using an ECL solution and a ChemiDoc XRS system (BioRad, California, USA).

[0102] (6) Detection of genes of each subunit of v-ATPase: Total RNA was extracted from osteoclast samples using TRIzol reagent (Takara, Japan). The final RNA sample was dissolved in ddH 2 O, 1 μg RNA in each group was reverse transcribed into 20 μl cDNA, and after adding HiScript IIQ RT SuperMix (Vazyme Biotech, Nanjing, China), RT-qPCR detection was performed. The forward and reverse PCR primers are listed in Table 2 below. For data analysis, the expression of the target gene was normalized to the expression of β-actin.

[0103] Table 2

[0104] Gene name Upstream primer Downstream primer Atp6v0a1 CTGTTATCCTCGGCATCATCCAC CAGGTAGCCAAACAACGAGGAC Atp6v0a2 GCCTCATCTACAACGACTGCTTC TGCCTGATGGTGCTGTCATTCC Atp6v0a3 CTCATCAGGACCAACCGCTTCA CGCCAAACATCACAGCGAAGAG Atp6v0c GACTGATGGCATCACCCTCTAC CAGGATCATGCCCACGAACAGT Atp6v0d2 ACGGTGATGTCACAGCAGACGT CTCTGGATAGAGCCTGCCGCA Atp6v0e CTCCTCGTGCCCTGGTTTATCC GTGGTCCAAACAGAGGATTGAGC Atp6v1a GCTGGCTTCTTTCTATGAGCGAG GCGTTGCAGAAGTGACTGGATC Atp6v1b2 TGGCTCCAAAGCAGTGGTTCAG CTCAGACACTGGTGTTCGGAGA Atp6v1c1 GGTTGGCTTGTCGGATGAACTG TGTCCTCCAGCACATCAGCCAT Atp6v1e1 AAAGGTCGCCTTGTGCAAACGC CTCTGAGGACTTTGAGCCTTGC Atp6v1g1 CAGAGGGAAGGAGTTCAAGG GTTCTGGAGGACGGTCATCTTC Atp6vap1 CTGTGGCATACAAAGACGAGTGG GCACCAAAGAGTGGCTCATAGG Atp6vap2 TCACATTGCGGCAGCTCCGTAA GTAGCACTTGCAGTTCGGAGAG

[0105] 2. Experimental results

[0106] like Fig.10 As shown in A, scanning electron microscopy results show that lithium carbonate treatment of osteoclasts cultured in vitro can reduce and decrease the area and number of osteoclast bone resorption pits.

[0107] like Fig.10 As shown in B and C, the results of osteoclast extracellular and extracellular pH detection showed that lithium carbonate treatment of osteoclasts cultured in vitro could acidify the osteoclast cytoplasm and alkalize the osteoclast extracellular pH.

[0108] like Fig.10 As shown in D, the results of v-ATPase enzyme activity detection showed that lithium carbonate treatment could reduce the v-ATPase enzyme activity of osteoclasts.

[0109] like Fig.10 As shown in E, the results of immunofluorescence detection showed that the V0C subunit and V1A subunit of v-ATPase on the membrane surface of osteoclasts in the Vehicle group were completely co-localized. Lithium carbonate treatment could reduce the distribution of the V1A subunit on the membrane and affect the assembly of the V0 and V1 subunits.

[0110] like Fig.10 As shown in F, WB results show that lithium carbonate treatment has no effect on the levels of V0C and V1A in osteoclast total protein, but lithium carbonate reduces the expression of V1A on the membrane and increases the expression of cytoplasmic V1A, and slightly reduces the expression of V0C on the osteoclast membrane. Lithium carbonate treatment can affect the assembly of V0 and V1 subunits of v-ATPase.

[0111] like Fig.10 As shown in G, the PCR results of each subunit of v-ATPase showed that the V0C subunit was the most highly expressed in osteoclasts, and lithium carbonate could reduce the expression of V0C.

[0112] In summary, the solution of this application has the following effects:

[0113] 1. This application proposes a therapeutic strategy of using lithium carbonate to treat osteoporosis, which can effectively treat osteoporosis caused by ovariectomized mice and aging mice. Compared with current clinical medications, the risk of osteoporosis recurrence during the drug-free period is low, and it has good clinical application prospects.

[0114] 2. Lithium carbonate treatment targets osteoclast v-ATPase to inhibit the secretion of hydrogen ions by osteoclasts, reduce their bone absorption capacity, and acidify the cytoplasm, thereby inhibiting osteoclast differentiation.

[0115] 3. Lithium carbonate has long been approved for marketing in my country. Its safety and reliability have been verified and it can be directly used on the human body.

Claims

1. Use of lithium-containing compounds in the preparation of drugs for treating osteoporosis.

2. The method according to claim 1, wherein the lithium-containing compound is selected from lithium carbonate and lithium chloride.

3. The use according to claim 1, wherein the lithium-containing compound is lithium carbonate. The use according to claim 1 , wherein the osteoporosis is primary osteoporosis.

5. The use according to claim 4, wherein the primary osteoporosis is selected from postmenopausal osteoporosis and senile osteoporosis.

Images