Recombinant humanized III-type micromolecular collagen and application thereof

Abstract

The invention relates to the technical field of genetic engineering, and particularly discloses a recombinant humanized III-type micromolecular collagen and application thereof. The molecular weight of the recombinant humanized III-type micromolecular collagen is 1.7 KDa, the recombinant humanized III-type micromolecular collagen is the currently known minimum molecular collagen with biological functions, the technical problem that the collagen is difficult to transdermal due to large molecular weight can be effectively solved, and the recombinant humanized III-type micromolecular collagen can be expressed in a host cell in a high-soluble manner, so that the recombinant humanized III-type micromolecular collagen has a good application prospect. High-yield expression is achieved, the expression quantity reaches up to 40%-60%, and cell adhesion and scratch repair can be well achieved.

Description

Technical Field

[0001] The present application relates to the field of biological genetic engineering technology, and in particular to a recombinant humanized type III small molecule collagen and its application. Background Art

[0002] Collagen, the superstar of structural proteins, is widely found in human skin, bones, muscles and connective tissues. Since the early 20th century, collagen has been performing like an ever-evolving Hollywood blockbuster in the medical and beauty fields. Initially, it was a darling of the medical community, used for wound healing and burn treatment, and quickly won the favor of doctors with its good biocompatibility and low immunogenicity.

[0003] By the 1980s, collagen had successfully transformed into a rising star in the beauty industry, becoming a skin filler specifically for combating wrinkles and sagging skin. Collagen is the main component of the dermis. Since collagen molecules are proteins with a three-strand helical structure composed of three polypeptide chains, they can maintain skin tension and elasticity. The molecules contain a large number of amide groups and hydroxyl groups, and have strong hygroscopicity, thus keeping the skin plump and full. As people age, the collagen in the dermis degrades and ages, and the skin becomes dry and wrinkled. In order to prevent skin aging, collagen supplementation is used to delay the aging process of the skin.

[0004] At present, 28 types of collagen have been found, and different types of collagen have different functions. The most abundant type of collagen in the human body is type I collagen, accounting for more than 85%, followed by type III collagen, accounting for 10-15%. Type I collagen is found in high levels in bones, skin, tendons and corneas, while type III exists in blood vessels and new skin tissues. Type I and type III collagen are the main components of the extracellular matrix and are responsible for the integrity of tissue structure.

[0005] The type III collagen molecule consists of three α1 chains and is a protein that is encoded by the COL3A1 gene in humans and has a long triple helical domain. Type III collagen forms smaller fibrils with lower tensile strength and is found in movable organs and tissues that are cyclically stretched. Type III collagen is the main structural component of hollow organs, such as large blood vessels, the uterus, and the intestine. Type III collagen provides tensile strength and integrity to many organs, and studies have shown that type III collagen has several other important functions. Other functions of type III collagen include interaction with platelets in the blood coagulation cascade, and it is also an important signaling molecule for wound healing. In tissues, the diameter of type III collagen fibrils is smaller than that of type I collagen fibrils, and type I and type III collagen sometimes appear in the same fibrils, in which case type III collagen can regulate the diameter of the fibrils.

[0006] With the advancement of technology, the extraction and purification process of collagen is also constantly upgrading. From acid-base treatment and enzymatic hydrolysis to ultrafiltration, freeze drying and supercritical CO2 extraction, scientists have made continuous breakthroughs to make collagen purer and more stable, while reducing the content of impurities and allergens.

[0007] Entering the 21st century, the development of genetic recombination technology has made recombinant collagen a reality. The amino acid sequence of recombinant collagen produced by genetic engineering technology can be precisely designed to be highly consistent with the natural collagen in the human body. This not only solves the allergy and pathogen problems of animal-derived collagen, but also greatly improves production efficiency and product quality.

[0008] Proteins are the main executors of life activities and play a variety of important functions in organisms. By designing new protein sequences, it is expected that proteins with specific functions can be created to solve key problems in fields such as medicine, agriculture, and sustainable development. However, protein design faces huge challenges: 1. The design space is huge. The possible sequence combinations of proteins with only 100 amino acids exceed the number of atoms in the universe. 2. Functionality is sparse. In this huge sequence space, only a very small number of sequences can form proteins with the desired functions. 3. Complex structure-function relationship. There is a complex nonlinear relationship between the amino acid sequence, three-dimensional structure and function of the protein, which is difficult to describe with simple rules. Faced with these challenges, traditional protein design methods are often inefficient and costly.

[0009] In addition, due to the large molecular weight of collagen, there is a problem of not being able to achieve transdermal absorption, and the existing collagen expression level is low. Summary of the invention

[0010] The purpose of the present application is to overcome the deficiencies of the above-mentioned prior art and provide a recombinant humanized type III small molecule collagen and its application. The recombinant humanized type III small molecule collagen of the present application has a small molecular weight, which can solve the technical problem of difficult transdermal penetration, and the recombinant humanized type III small molecule collagen of the present application is efficiently expressed in a soluble form in host cells, which can better achieve cell adhesion and scratch repair.

[0011] The present application provides a recombinant humanized type III small molecule collagen, the amino acid sequence of which is as shown in (a) or (b):

[0012] (a) the amino acid sequence is shown in SEQ ID NO: 1;

[0013] (b) An amino acid sequence derived from (a) in which at least one amino acid is substituted, deleted or added and which has collagen activity.

[0014] In the technical solution of the present application, based on the molecular docking screening technology of the simulated structure, the function of the triple helical region of human type III collagen (collagen alpha-1(III) chain preproprotein [Homo sapiens], NCBI Reference Sequence: NP_000081.2) was screened, and a recombinant humanized type III small molecule collagen (GAPGPQGPRGDKGETGER, as shown in SEQ ID NO: 1) with strong biological function was screened out, with a molecular weight of 1.7KDa, which is the smallest molecule collagen with biological function known so far, and can effectively solve the technical problem that collagen has a large molecular weight and is difficult to penetrate the skin. This small molecule collagen can achieve cell adhesion and scratch repair. The recombinant humanized type III small molecule collagen has a very high match with integrin α2β1, can activate integrin α2β1, and realize the transmission of signals from outside to inside.

[0015] The present application provides a nucleic acid molecule, which encodes the recombinant humanized type III small molecule collagen.

[0016] The nucleic acid molecule of the present application can encode recombinant humanized type III small molecule collagen. The recombinant humanized type III small molecule collagen can be highly soluble and expressed in host cells, with an expression level of up to 40%-60%. It is the recombinant small molecule collagen with the highest yield reported so far, solving the technical problems of low yield and high cost.

[0017] As a preferred embodiment of the nucleic acid molecule described in the present application, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 2.

[0018] SEQ ID NO: 2 is ggtaccgacgacgacgacaagggtgctcctggtcctcagggtccgcgtggcgacaaaggcgagacgggtgaacgtta actcgag.

[0019] The present application provides an expression vector for efficiently expressing recombinant humanized type III small molecule collagen, wherein the expression vector carries the nucleic acid molecule.

[0020] The present application provides a host cell, which contains the recombinant humanized type III small molecule collagen or the nucleic acid molecule or the expression vector.

[0021] The expression vector includes mini-JY-2-pET-32a(+).

[0022] As a preferred embodiment of the host cell described in the present application, the host cell is an Escherichia coli LTHINK (DE3) competent cell.

[0023] The present application provides a method for preparing the recombinant humanized type III small molecule collagen, comprising the following steps:

[0024] The recombinant humanized type III small molecule collagen is expressed by using the above host cells and then separated and purified.

[0025] The present application achieves high-yield expression of recombinant humanized type III small molecule collagen by constructing and screening highly efficient expression host cells (genetically engineered bacteria), with an expression level of 40-60%, which is the recombinant humanized type III small molecule collagen with the highest yield reported so far, solving the technical problems of low yield and high cost.

[0026] In some specific embodiments, the host cell expression refers to culturing the host cell, and the culture medium and culture conditions are well known to those skilled in the art. For the expression mode, this application does not impose any restrictions, and it can be confirmed as needed, for example, the expression mode is induced expression. The separation and purification method includes salting out, ultrafiltration, affinity chromatography, gel filtration chromatography, chromatography, acid-base precipitation and membrane separation. Preferably, the separation and purification method is affinity chromatography.

[0027] The present application provides a cell repair reagent, which contains the recombinant humanized type III small molecule collagen.

[0028] Preferably, the concentration of the recombinant humanized type III small molecule collagen in the cell repair reagent is 0.125 mg / mL-1 mg / mL. The recombinant humanized type III small molecule collagen of the present application can achieve cell adhesion and scratch repair.

[0029] The present application provides the use of the above-mentioned recombinant humanized type III small molecule collagen in the preparation of cell repair reagents.

[0030] The present application also provides recombinant humanized type III small molecule collagen, the use of the recombinant humanized type III small molecule collagen encoded by the nucleic acid molecule, or the recombinant humanized type III small molecule collagen produced by the host cell in the preparation of food, cosmetics or medical device products.

[0031] Compared with the prior art, this application has the following beneficial effects:

[0032] The present application provides a recombinant humanized type III small molecule collagen and its application. The recombinant humanized type III small molecule collagen of the present application has a molecular weight of 1.7 KDa and is the smallest molecule collagen with biological function known so far. It can effectively solve the technical problem that collagen has a large molecular weight and is difficult to penetrate the skin. In addition, the recombinant humanized type III small molecule collagen of the present application can be highly soluble and highly expressed in host cells, with an expression level of up to 40%-60%, which can better achieve cell adhesion and scratch repair. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the virtual docking diagram of recombinant humanized type III small molecule collagen and integrin α2β1;

[0034] Figure 2 is the map of mini-JY-2-pET-32a(+);

[0035] Figure 3 This is a screen result diagram of positive clones;

[0036] Figure 4 This is the result of SDS-PAGE electrophoresis detection;

[0037] Figure 5 This is the result of SDS-page detection of the purified samples;

[0038] Figure 6 The figure is the result of the 3T3-L1 cell proliferation experiment in Example 3 (*: P Value<0.05; **: P value<0.01; ****: P Value<0.0001; wherein, Control: PBS blank control; CPP 1: 1 mg / ml recombinant humanized type III small molecule collagen; Cpp0.5: 0.5 mg / ml recombinant humanized type III small molecule collagen; CPP 0.25: 0.25 mg / ml recombinant humanized type III small molecule collagen; CPP 0.125: 0.125 mg / ml recombinant humanized type III small molecule collagen; JBK 1: 1 mg / ml existing collagen; JBK 0.: 0.5 mg / ml existing collagen; JBK 0.25: 0.25 mg / ml existing collagen; JBK 0.125: 0.125 mg / ml existing collagen);

[0039] Figure 7The results of 3T3-L1 cell adhesion in Example 4 are shown in Figure 4 (Control: 1XPBS, blank control; B col: 1mg / mL bovine type I collagen, positive control; CPP-1: 0.125mg / ml recombinant humanized type III small molecule collagen; CPP-2: 0.25mg / ml recombinant humanized type III small molecule collagen; CPP-3: 0.5mg / ml recombinant humanized type III small molecule collagen; CPP-4: mg / ml recombinant humanized type III small molecule collagen; JBK-1: 0.125mg / ml existing collagen; JBK-2: 0.25mg / ml existing collagen; JBK-3: 0.5mg / ml existing collagen; JBK-4: 1mg / ml existing collagen; ****: P value <0.0001);

[0040] Figure 8 This is the migration image of 3T3-L1 cells in Example 5 (blank: serum-free culture medium; B col1: 0.2 mg / ml bovine type I collagen; JBK: 0.2 mg / ml existing collagen; CPP: 0.2 mg / ml recombinant humanized type III small molecule collagen);

[0041] Fig. 9 This is the result of fluorescent staining of mouse skin sections in Example 6 (DAPI: a blue nuclear dye, after binding to DNA, the maximum excitation wavelength is 360nm, the maximum emission wavelength is 460nm, and it is used for cell positioning; Sulfo-Cy3-collagen: a fluorescent collagen sample to be tested, the maximum excitation wavelength is 550nm, and the maximum emission wavelength is 570nm; Merge: a picture of the combination of two fluorescences). DETAILED DESCRIPTION

[0042] In order to better illustrate the purpose, technical solutions and advantages of the present application, the present application will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0043] In the following examples and comparative examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified.

[0044] The techniques and procedures described or referenced herein are conventional methods that are generally well known and commonly used by those skilled in the art.

[0045] The present application provides a recombinant humanized type III small molecule collagen protein, the amino acid sequence of the recombinant humanized type III small molecule collagen protein is shown in SEQ ID NO: 1 (GAPGPQGPRGDKGETGER).

[0046] The present application also provides a nucleic acid molecule encoding the above-mentioned recombinant humanized type III small molecule collagen.

[0047] In the above-mentioned specific embodiments, nucleic acid molecules are the general term for deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are biomacromolecules polymerized by many nucleotide monomers, and are one of the most basic substances of life. Nucleotide sequence refers to the order of arrangement of bases in DNA or RNA. Nucleic acid molecules contain cDNA, and in some cases, nucleic acid molecules can be modified for use in the present application vector, such as for codon optimization. In some cases, for the purpose of cloning into a vector, the sequence can be designed to contain a terminal restriction site sequence. Nucleic acid molecules can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) amplification of coding nucleic acids separated in one or more given cells or from the one or more given cells.

[0048] The present application also provides an expression vector carrying the above nucleic acid molecule.

[0049] In a specific embodiment, an expression vector refers to a self-replicating DNA molecule that transfers a DNA fragment (target gene) to a recipient cell in genetic engineering recombinant DNA technology. As the most commonly used and simplest vector in genetic engineering, it must include three parts: a genetic marker gene, a replication region, and a target gene. In addition to the commonly used E. coli plasmid vector, many other artificially constructed plasmid vectors suitable for microorganisms, yeast, plants, etc. have also been developed. Vectors include, but are not limited to: single-stranded, double-stranded or partially double-stranded nucleic acid molecules; nucleic acid molecules containing one or more free ends, no free ends (e.g., circular); nucleic acid molecules containing DNA, RNA or both; and other polynucleotide species known in the art. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA fragments can be inserted, for example, by standard molecular cloning techniques. Certain vectors are able to replicate autonomously in host cells into which they are introduced (e.g., bacterial vectors with bacterial replication origins and free mammalian vectors). Other vectors (e.g., non-free mammalian vectors) are integrated into the genome of the host cell after being introduced into the host cell, thereby replicating together with the host genome. In addition, certain vectors are able to direct the expression of the target gene. Such vectors are referred to herein as "expression vectors." A recombinant expression vector may comprise a form suitable for expressing a nucleic acid in a host cell, which means that the recombinant expression vector includes one or more regulatory elements, which may be selected based on the host cell for expression to which the nucleic acid sequence to be expressed may be operably linked.

[0050] The present application also provides a host cell expressing the above-mentioned recombinant humanized type III small molecule collagen.

[0051] In a specific embodiment, host cell refers to any cell type, which is susceptible to transformation, transfection, transduction, etc. of a nucleic acid construct or expression vector comprising a polynucleotide of the present application."Host cell" covers any offspring of a parent cell, which is not completely identical to the parent cell due to mutations during replication. The host cell can be any cell useful in the production of recombinant humanized type III small molecule collagen protein of the present application. In order to produce recombinant humanized type III small molecule collagen protein, the nucleic acid encoding recombinant humanized type III small molecule collagen protein can be separated and inserted into one or more vectors to further clone and / or express in the host cell. This nucleic acid can be easily separated and sequenced using conventional techniques (e.g., by using oligonucleotide probes that can specifically bind to genes encoding recombinant collagen). The host cell refers to a cell into which exogenous nucleic acid has been introduced, including the offspring of such cells. Host cells include transformants and transformed cells, which include primary transformed cells and offspring derived therefrom, regardless of the number of passages. Offspring may not be completely identical to parental cells in terms of nucleic acid content, but may contain mutations. The method for introducing the vector into the host cell is well known, for example, using electroporation to introduce the vector into the host cell, the method may also be transfection, microinjection technology, gene gun technology, liposome-mediated method, etc. The host cell is a prokaryotic cell or a eukaryotic cell. The host cell is selected from Escherichia coli.

[0052] In Examples 3-5, the existing collagen protein adopts the recombinant human small molecule collagen protein produced by Zhuhai Jibaikang Biotechnology Co., Ltd.

[0053] Example 1: Design of recombinant humanized type III small molecule collagen

[0054] In this embodiment, the structure-based molecular docking virtual screening method is used to divide the triple helical region of human type III collagen (collagen alpha-1 (III) chain preproprotein [Homo sapiens], NCBI Reference Sequence: NP_000081.2) into 10 fragments for virtual docking screening with integrin α2β1. The simulated docking Docking Score (based on the affinity evaluation between molecular pairs, the lower the calculated Docking Score, the stronger the affinity between molecules) is shown in Table 1 below:

[0055] Table 1

[0056]

[0057]

[0058] Among them, the recombinant humanized type III small molecule collagen (GAPGPQGPRGDKGETGER) has a very high match with integrin α2β1, and its Docking Score value is -171.14. The virtual docking diagram with integrin α2β1 is shown in the figure Figure 1 shown.

[0059] The nucleotide sequence of the nucleic acid molecule encoding the recombinant humanized type III small molecule collagen of the present application is shown in SEQ ID NO:2.

[0060] SEQ ID NO: 2 is:

[0061] ggtaccgacgacgacgacaagggtgctcctggtcctcagggtccgcgtggcgacaaaggcgagacgggtgaa cgttaactcgag.

[0062] Example 2: Construction and purification of recombinant humanized type III small molecule collagen by high expression engineering bacteria

[0063] This embodiment provides a method for constructing a high-expression engineered bacterium, comprising the following steps:

[0064] 1) Construction of E. coli recombinant expression vector:

[0065] The codons were optimized according to the codon preference of E. coli, and the resulting gene sequence was named mini-JY-2. After adding the two segments of the optimized sequence to the restriction sites KpnⅠ and XhoⅠ, the whole gene was synthesized and cloned into the E. coli expression vector PET-32a(+), and the E. coli recombinant expression vector mini-JY-2-pET-32a(+) was obtained (see Figure 2). Figure 2 shown).

[0066] The enzyme digestion system is shown in Table 2 below:

[0067] Table 2

[0068]

[0069] The reaction conditions were: 37° C., reaction time 30 min. The E. coli recombinant expression vector mini-JY-1-pET-32a(+) after enzyme digestion was recovered by 1% agarose gel electrophoresis using a gel recovery kit.

[0070] Ligation: Transfer about 100 ng of DNA of the Escherichia coli recombinant expression vector mini-JY-2-pET-32a(+) to a sterile microcentrifuge tube, add 4 times the molar amount of the target fragment (the above-mentioned recombinant humanized type III small molecule collagen), then add 1 μL of 10×T4 DNA ligase buffer, 0.5 μL-1 μL of T4 DNA ligase, add sterile ultrapure water to a volume of 10 μL, mix thoroughly and use a microcentrifuge to collect all the liquid to the bottom of the tube, and keep warm at 16°C overnight.

[0071] 2) Plasmid transformation;

[0072] First, prepare competent E. coli LTHINK (DE3):

[0073] ①Pick a single colony of E. coli and inoculate it into 5 ml of LB liquid medium without antibiotics. Cultivate it at 37°C with shaking for 13 hours until the late logarithmic growth period. Inoculate the bacterial suspension into 100 ml of LB liquid medium at a ratio of 1:50 and culture it at 37°C with shaking for 2-3 hours until the OD reaches 0. 600 =0.5;

[0074] ② Transfer the culture medium into a centrifuge tube under sterile conditions, place it on ice for 10 minutes to cool the culture to 0°C, and then centrifuge it at 4°C, 4000 rpm for 10 minutes;

[0075] ③Discard the supernatant and invert for 1 minute to drain the culture medium;

[0076] ④ Gently suspend the cells with 10 ml of ice-cold 0.1 mol / L CaCl2 solution, mix thoroughly, place on ice for 30 min, and centrifuge at 4000 rpm for 10 min at 4°C;

[0077] ⑤Discard the supernatant and invert for 1 minute to allow the last trace of culture fluid to flow away;

[0078] ⑥ Add 4 ml of pre-cooled 0.1 mol / L CaCl2 solution containing 15% glycerol, gently suspend the cells, and place on ice for a few minutes to form a competent cell suspension;

[0079] ⑦ Aliquot 100 μL of E. coli BL21 (DE3) competent cells and store at -70°C for future use.

[0080] Conversion:

[0081] ①Take out a tube (100 μl) of LTHINK (DE3) competent bacteria from the -80℃ ultra-low temperature freezer, put it on ice after it melts, and keep it in an ice bath for 5 to 10 minutes.

[0082] ② Add 50 ng of the constructed E. coli recombinant expression vector mini-JY-2-pET-32a(+), shake gently and place on ice for 30 min.

[0083] ③ After gently shaking, place in a 42℃ water bath for 1-2 minutes for heat shock, then quickly return to ice and let stand for 3-5 minutes.

[0084] ④ In a clean bench, add 800 μl of LB medium (without antibiotics) to each of the above tubes, mix gently, and then fix them on the spring frame of the shaker and shake at 37°C for 1 hour.

[0085] ⑤ Take 100-300 μl of the above transformation mixture in the clean bench, drop it into the solid LB plate culture dish containing appropriate antibiotics, and spread it evenly with a glass coating rod burned by an alcohol lamp.

[0086] ⑥ Mark the coated culture dish and place it in a 37℃ constant temperature incubator for 30 to 60 minutes until the liquid on the surface has penetrated into the culture medium. Then turn it upside down and place it in a 37℃ constant temperature incubator overnight.

[0087] 3) Screening of positive clones:

[0088] The enzyme digestion pattern was used to verify the recombinant quality of the recombinant positive clones. The endonucleases used were MluI and XhoI. The reaction system is shown in Table 3:

[0089] Table 3

[0090]

[0091] The reaction conditions were: 37°C, 30 min, and detection by 1% agarose gel electrophoresis.

[0092] refer to Figure 3 , the recombinant quality of the recombinant positive clones can be verified, among which, Figure 3 1 in the middle indicates: DNA of the recombinant expression vector mini-JY-2-pET-32a(+) without enzyme digestion; Figure 3 Middle 2 means: Plasmid digested by MluI and XhoI; Figure 3 The M in it stands for DNA Marker.

[0093] 4) PCR positive clone verification:

[0094] The single colony grown on the plate cultured overnight at 37°C after transformation was inoculated into 10 mL LB liquid medium, and antibiotics were added, and cultured overnight at 37°C. The positive clone was identified by bacterial liquid PCR. The bacterial liquid PCR system is shown in Table 4 below:

[0095] Table 4

[0096] Components 20μL system Forward primer (10 μmol / L) 0.5μL Reverse primer (10 μmol / L) 0.5μL <![CDATA[ddH2O]]> 8μL Bacterial liquid 1μL Taq DNA polymerase 10μL TOTAL 20.0μL

[0097] Forward primer: GATTAAAAAGGCGGCGAACAAA (SEQ ID NO: 3);

[0098] Reverse primer: TCAAAGCCTTCTTTCGGCT (SEQ ID NO: 4).

[0099] The PCR program was as follows: initial denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, 34 cycles; annealing at 50-54°C for 30 s; extension at 72°C for 30 s; final extension at 72°C for 10 min; storage at 4°C. After PCR amplification, sequencing was performed and the sequence was consistent with the synthetic sequence after comparison.

[0100] 5) Expression of recombinant humanized type III small molecule collagen:

[0101] Take a tube of bacteria stored at -80℃, freeze and thaw at room temperature, inoculate the above bacteria in 600ml LB culture medium containing 50μg / ml Kan at a ratio of 1:1000, and shake at 37℃ and 220rpm until the bacterial OD reaches 600 0.8-1.0; add inducer IPTG to 600ml fermentation medium (LB culture medium) to a final concentration of 0.1mM, culture at 37℃ for 4h and 22℃ for 8h at 220rpm; centrifuge at 5000rpm and 4℃ for 5min, remove the supernatant and collect the fermented bacteria, and store at -20℃; protein expression detection, break the bacteria, breaking conditions: 150W power, break 1s, interval 1s, a total of 15min. Breaking buffer: TBS, pH7.4.

[0102] SDS-PAGE electrophoresis was performed, and the results were as follows Figure 4 (recombinant small molecule collagen expression) as shown, Figure 4 M in the middle stands for Marker; 1 stands for before induction; 2 stands for the whole bacteria after induction; 3 stands for the supernatant after induction; 4 stands for the precipitate after induction.

[0103] 6) Purification of recombinant humanized type III small molecule collagen:

[0104] Bacteria fragmentation:

[0105] The cells were resuspended in lysis buffer (50 mM Tris-HCl) at a ratio of 1:10, and high-pressure homogenization was performed, once at 200 bar, twice at 800 bar, and centrifuged at 9000 rpm at 4°C for 30 min. The inclusion bodies were collected.

[0106] 7) Purification:

[0107] Ni column purification:

[0108] After the Ni filler is fully soaked and cleaned with 1M NaOH solution, the Ni filler eluent 2 is rinsed with 2-5 column volumes, and the column balance solution is fully balanced and loaded. After the loading is completed, the column is rinsed with the column balance solution, and then the target protein is eluted with the eluent, and the elution peak is collected. The collection bottle is marked with the target protein name, purification date and sample volume. It can be stored at 4-6℃ if used within 1 week, and stored in a refrigerator at -20℃ for long-term storage.

[0109] Enzyme digestion:

[0110] Purified AF-16 was added with SUMO protease at a ratio of 100:1 and digested overnight at 4°C.

[0111] Continue Ni column purification:

[0112] After the enzyme digestion, the Ni column was used for purification. After the Ni filler was fully soaked and cleaned with 1M NaOH solution, the Ni filler was rinsed with 2-5 column volumes of eluent 2. The column was fully equilibrated with the equilibration solution and then the sample was loaded. After the loading was completed, the column was rinsed with the equilibration solution, and the flow-through peak was collected, which was the target protein. It can be stored at 4-6°C if used within 1 week, and stored in a refrigerator at -20°C for long-term storage).

[0113] The purified samples were tested by SDS-page, and the results were as follows Figure 5 As shown, Figure 5 1: purified sample; 2: sample before enzyme digestion; 3: sample after enzyme digestion, M: Marker.

[0114] Example 3: Recombinant humanized type III small molecule collagen promotes cell proliferation

[0115] 1) Dissolution of the sample to be tested: Filter the recombinant humanized type III small molecule collagen (or existing collagen) to be tested with a 0.22 μm microporous filter membrane, and dilute with 1×PBS in a gradient manner according to the concentrations of 1 mg / ml, 0.5 mg / ml, 0.25 mg / ml, 0.125 mg / ml, 0.0625 mg / ml, 0.03125 mg / ml, 0.015 mg / ml, 0.008 mg / ml, and 0.004 mg / ml, and place in a 4°C refrigerator for use.

[0116] 2) 3T3-L1 cell culture: 3T3-L1 cells were revived and inoculated into culture bottles. After the cells grew to 80-90%, they were subcultured and inoculated after the cells were in good growth condition.

[0117] 3) Collagen coating: Add 100 μL of standard solution, test sample, and PBS blank control to a 96-well plate. Prepare 4 wells for each sample coating, incubate in a 37°C, 5% CO2 incubator for 1 to 4 hours, and then remove excess coating solution from the wells.

[0118] 4) Cell proliferation assay: 3T3-L1 cells were cultured at 2×10 3 The cells were inoculated into a 96-well plate at a density of 100 / well, and blank DMEM high-glucose medium was added for culture at 5% CO2 and 37°C. After 48 hours, CCK8 detection reagent was added according to the instructions, and the cells were incubated for 2 hours and detected with an enzyme reader (450 nm wavelength).

[0119] 5) Experimental results show that Figure 6 Recombinant humanized type III small molecule collagen protein can promote the proliferation of 3T3-L1 cells in the concentration range of 0.125 mg / mL to 1 mg / mL.

[0120] Example 4: Recombinant humanized type III small molecule collagen promotes cell adhesion

[0121] 1) Dissolution of bovine type I collagen: dissolve 10 mg of bovine type I collagen in 10 ml of ultrapure water, filter through a 0.22 μm microporous filter membrane, and dilute with 1× PBS to a concentration of 1 mg / ml, 0.5 mg / ml, 0.25 mg / ml, 0.125 mg / ml, 0.0625 mg / ml, 0.03125 mg / ml, 0.015 mg / ml, 0.008 mg / ml, and 0.004 mg / ml, and place in a 4°C refrigerator for use.

[0122] 2) Dissolving the sample to be tested: Filter the recombinant humanized type III small molecule collagen (or existing collagen) to be tested with a 0.22 μm microporous filter membrane, and dilute with 1×PBS in a gradient manner according to the concentrations of 1 mg / ml, 0.5 mg / ml, 0.25 mg / ml, 0.125 mg / ml, 0.0625 mg / ml, 0.03125 mg / ml, 0.015 mg / ml, 0.008 mg / ml, and 0.004 mg / ml, and place in a 4°C refrigerator for use.

[0123] 3) Coating preparation: Add 100 μL of standard solution (bovine type I collagen), test sample, and PBS blank control to a 96-well plate. Prepare 4 wells for each sample coating and incubate in a 37°C, 5% CO2 incubator for 1h to 4h. Remove excess coating solution from the wells, add 100 μL of 1% BSA-PBS solution, and incubate in a 37°C, 5% CO2 incubator for 1h. After removing the liquid in the wells, wash three times with PBS, discard the washing solution, seal with sealing film, and place at 4°C for use.

[0124] 4) Cell adhesion detection: 3T3-L1 cells were cultured in a 37°C, 5% CO2 cell culture incubator, and the cell density and status were observed under an inverted microscope every day. When the cells grew to 80% to 90% of the culture flask, cell passage or cell inoculation was performed. 5×10 3 Add 100 μL of cells to each well and incubate at 37°C, 5% CO2 for 1 hour. Seal the 96-well plate with sealing film to prevent liquid leakage, and centrifuge (inverted) at 350g for 5 minutes. After centrifugation, discard the sealing film and remove the supernatant from the well. After washing once with PBS, add 100 μL of diluted CCK8 detection reagent. After incubating in a cell culture incubator at 37°C, 5% CO2 for 2 hours, use an enzyme marker to detect the absorbance at a wavelength of 450nm.

[0125] 5) Experimental results, such as Figure 7 As shown, according to the results of the 3T3-L1 cell adhesion experiment, recombinant humanized type III small molecule collagen can promote 3T3-L1 cell adhesion within the concentration range of 0.125 mg / mL-1 mg / mL.

[0126] Example 5: Recombinant humanized type III small molecule collagen promotes cell scratch damage repair

[0127] 1) Dissolution of bovine type I collagen: dissolve 10 mg of bovine type I collagen in 10 ml of ultrapure water, filter through a 0.22 μm microporous filter membrane, and dilute with 1× PBS to a concentration of 1 mg / ml, 0.5 mg / ml, 0.25 mg / ml, 0.125 mg / ml, 0.0625 mg / ml, 0.03125 mg / ml, 0.015 mg / ml, 0.008 mg / ml, and 0.004 mg / ml, and place in a 4°C refrigerator for use.

[0128] 2) Dissolving the sample to be tested: Filter the recombinant humanized type III small molecule collagen (or existing collagen) to be tested with a 0.22 μm microporous filter membrane, and dilute with 1×PBS in a gradient manner according to the concentrations of 1 mg / ml, 0.5 mg / ml, 0.25 mg / ml, 0.125 mg / ml, 0.0625 mg / ml, 0.03125 mg / ml, 0.015 mg / ml, 0.008 mg / ml, and 0.004 mg / ml, and place in a 4°C refrigerator for use.

[0129] 3) 3T3-L1 cells were cultured in a 37°C, 5% CO2 cell culture incubator, and the cell density and status were observed under an inverted microscope every day. When the cells grew to 80% to 90% of the culture flask, cell passage or cell inoculation was performed. Approximately (5 to 15) × 10 5 The specific seeding number can be adjusted according to the different cells (this experiment uses 10×105 The goal is to achieve 95% to 100% confluence after 24 hours of culture. After 24 hours of cell culture, use a 10μL pipette tip to gently push down the longitudinal line in three equal parts in each well on the back of the 6-well plate to form scratches. Rinse the cells three times with PBS to remove the scratched cells, and add 2mL of serum-free culture medium to the sample group and reference material group, respectively. The final concentration is recommended to be 0.5mg / mL. Only serum-free culture medium is added to the blank control group. Culture in a 37℃, 5% CO2 incubator. After 0h and 24h, take pictures under a 40x microscope with the intersection of the horizontal and longitudinal lines as the core, and obtain photos of 9 parts in each well. Measure the area of ​​the scratch area, and calculate the migration rate of each group of cells by dividing the total area of ​​migrating cells in the fixed scratch area by the initial area of ​​the fixed scratch area.

[0130] 4) From Figure 8 As shown in Table 5, based on the results of 3T3-L1 cell migration rate, recombinant humanized type III small molecule collagen can significantly promote 3T3-L1 cell migration at 24 hours and 48 hours.

[0131] Table 5

[0132]

[0133] Example 6, Transdermal Absorption Test

[0134] 1) The sample to be tested (recombinant humanized type III small molecule collagen) and the control sample were mixed according to the molecular weight and Sulfo-CY3-NHS at a molar ratio of 10:1, shaken overnight at 4°C, and the unbound dye and the sample to be tested were removed by gel chromatography, and Sulfo-CY3-collagen was retained and the concentration was detected. The concentration was prepared to 100 μg / mL for use.

[0135] 2) Immediately after killing the nude mouse, peel off the skin of the whole body, remove the subcutaneous tissue and rinse it with saline, soak it in saline for about 30 minutes, take it out, dry it with filter paper and set aside.

[0136] 3) Take out the -80℃ stored mouse skin (or fresh mouse skin), thaw it, wash it with physiological saline, and sandwich it between the receiving chamber and the supply chamber, with the outer epidermis of the skin facing the supply chamber. Adjust the water temperature system temperature to 37±1℃ and the stirring rate to 200r / min. Add PBS solution preheated to 37±1℃ into the receiving chamber, expel all bubbles, and contact the inner surface of the pig skin with the receiving solution. Then inject blank PBS, the sample solution to be tested, and the control sample solution into the supply chamber close to the mouse skin surface. Remove the sample solution to be tested at 0h, 12h, 18h, and 36h, wash the epidermis with PBS, and fix the skin in contact with the sample to be tested with paraformaldehyde for 24h.

[0137] 4) The fixed tissue was dehydrated (gradient ethanol infiltration + xylene infiltration), paraffin-embedded, sliced, rehydrated (xylene infiltration + gradient ethanol infiltration), cell nuclei were stained with DAPI solution, and rinsed with PBS, and photographed using a fluorescence microscope.

[0138] 5) Experimental results from Fig. 9 It can be seen that at 12 hours, red fluorescence appeared below the epidermis, and part of the Sulfo-Cy3 collagen entered the cell epidermis. At 18 hours, the part entering the epidermis increased and the red fluorescence increased. In the in vitro transdermal diffusion cell method, the recombinant humanized type III small molecule collagen was able to partially penetrate the skin barrier of nude mice and reach the epidermis and dermis at 12 hours.

[0139] This application uses molecular docking screening technology based on simulated structures to screen the functions of the triple helical region of human type III collagen (collagen alpha-1(III) chain preproprotein [Homo sapiens], NCBI Reference Sequence: NP_000081.2), and screens out a recombinant humanized type III small molecule collagen (GAPGPQGPRGDKGETGER, as shown in SEQ ID NO: 1) with strong biological functions. The molecular weight is 1.7KDa, which is the smallest known collagen with biological functions. It can effectively solve the technical problem that collagen has a large molecular weight and is difficult to penetrate the skin. The small molecule collagen can achieve cell adhesion and scratch repair. The recombinant humanized type III small molecule collagen has a very high match with integrin α2β1, can activate integrin α2β1, and realize the transmission of signals from the outside to the inside.

[0140] The present application constructs and screens highly efficient genetically engineered bacterial strains, and the recombinant humanized type III small molecule collagen can be highly soluble and highly expressed in the genetically engineered bacterial strains, with the expression level reaching 40%-60%.

[0141] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present application rather than to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, ordinary technicians in this field should understand that the technical solution of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present application.

Claims

1. A recombinant humanized type III small molecule collagen, characterized in that: The amino acid sequence of the recombinant humanized type III small molecule collagen is shown in (a) or (b): (a) the amino acid sequence is shown in SEQ ID NO: 1; (b) An amino acid sequence derived from (a) in which at least one amino acid is substituted, deleted or added and which has collagen activity.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the recombinant humanized type III small molecule collagen described in claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

2.

4. An expression vector for efficiently expressing recombinant humanized type III small molecule collagen, characterized in that: The expression vector carries the nucleic acid molecule according to claim 2 or 3.

5. The expression vector according to claim 4, characterized in that The expression vector includes mini-JY-2-pET-32a(+).

6. A host cell, characterized in that The host cell contains the recombinant humanized type III small molecule collagen according to claim 1 or the nucleic acid molecule according to claim 2 or 3 or the expression vector according to claim 4.

7. A method for preparing the recombinant humanized type III small molecule collagen as claimed in claim 1, characterized in that: The following steps are involved: The recombinant humanized type III small molecule collagen is expressed by using the host cell described in claim 6, and then separated and purified.

8. A cell repair reagent, characterized in that: The cell repair reagent contains the recombinant humanized type III small molecule collagen according to claim 1.

9. Use of the recombinant humanized type III small molecule collagen as claimed in claim 1 in the preparation of cell repair reagents.

10. Use of the recombinant humanized type III small molecule collagen as claimed in claim 1, or the recombinant humanized type III small molecule collagen encoded by the nucleic acid molecule as claimed in claim 2 or 3, or the recombinant humanized type III small molecule collagen produced by the host cell as claimed in claim 6 in the preparation of food, cosmetics or medical device products.

Images