Penicillium strain F5 and application thereof

Abstract

The invention relates to the technical field of biological control, in particular to a penicillium strain F5 and application thereof. The invention provides a Penicilliumsp. Strain F5, and the preservation number of the strain is GDMCC No: 65364. The invention also provides a preparation method of the Penicilliumsp. Strain F5. The invention further provides application of the penicillium strain F5 in preventing and treating plant wilt caused by fusarium oxysporum and tobacco black shank caused by phytophthora nicotianae. The penicillium strain F5 not only can obviously inhibit the growth of fusarium oxysporum and phytophthora nicotianae, but also can effectively promote the growth of plants, and has a good application prospect in the prevention and treatment of plant diseases.

Description

Technical Field

[0001] The invention relates to the technical field of biological control, and in particular to a Penicillium strain F5 and an application thereof. Background Art

[0002] Soilborne diseases are caused by pathogens living in the soil and are an urgent problem to be solved in modern agricultural production. Fusarium and Phytophthora are two important soil-borne pathogenic fungi that can cause crop yields to decrease by 20% to 30%, resulting in significant economic losses.

[0003] Fusarium spp. is a widely distributed soil-borne pathogenic fungus belonging to the Ascomycetes, the order Psoraleales, the family Nodules, and the genus Fusarium. It has a very wide host range and can cause wilt in more than 100 species of plants, including melons, Solanaceae, and Leguminosae. Infection by Fusarium spp. can cause symptoms such as browning of plant vascular bundles, wilting and death of plants, rot of bulbs and roots, and weak growth of plants. These symptoms develop most rapidly and seriously during high temperatures in summer. Fusarium spp. wilt poses a major threat to agricultural production, especially in heavily overgrown crops, which directly affects the yield and economic benefits of crops.

[0004] There are many types of Phytophthora, among which tobacco black shank caused by Phytophthora nicotianae is an important soil-borne fungal disease, which mainly infects the roots and stem base of tobacco, forming black sunken lesions. This disease is distributed worldwide and is more serious in temperate, subtropical and tropical regions. In recent years, tobacco black shank has seriously threatened the production of flue-cured tobacco in my country.

[0005] At present, the prevention and control of diseases caused by plant pathogens mainly rely on chemical pesticides. However, excessive use of chemical agents will not only lead to excessive pesticide residues in agricultural products, endangering the health of consumers, but may also cause environmental pollution and damage to the ecological balance, affecting the sustainable development of agriculture. Therefore, it is necessary to seek more environmentally friendly and sustainable prevention and control methods. As an important plant disease prevention and control measure, biological control prevents or alleviates diseases by inducing disease resistance in host plants or by antagonizing pathogenic fungi. Biological agents or preparations can reduce or replace the use of chemical pesticides, effectively preventing and controlling diseases while avoiding the negative effects of chemical pesticides. This method not only helps to protect the environment, but also maintains ecological balance and promotes the sustainable development of agriculture. Summary of the invention

[0006] The invention aims to utilize microorganisms to prevent and control plant wilt caused by Fusarium oxysporum and tobacco black shank disease caused by Phytophthora nicotianae and promote the growth of plants.

[0007] To achieve the above object, the present invention provides a Penicillium sp. strain F5, the deposit number of which is GDMCC No:65364.

[0008] The Penicillium strain F5 was isolated from corn rhizosphere soil, and the nucleotide sequence of its endogenous transcribed spacer (ITS) is shown in SEQ ID NO: 3. After the strain was grown on potato dextrose agar medium for 7 days, the colony color was light green or light blue green, the hyphae were well-developed and short, and were felt-like ( Figure 3 The hyphae are multi-branched, long, thin lines, with erect conidiophores on the aerial hyphae, and the conidial heads at the top are broom-shaped ( Figure 4 ).

[0009] The present invention also provides a culture of the Penicillium strain F5.

[0010] The culture may be a liquid culture, such as a fermentation broth obtained by culturing the Penicillium strain F5 in a potato dextrose liquid medium. The culture may also be a solid culture, such as a culture obtained by culturing the Penicillium strain F5 in a potato dextrose agar medium.

[0011] The present invention also provides a bacterial agent, which comprises the Penicillium strain F5.

[0012] The bacterial agent can be a solid or liquid bacterial agent.

[0013] The bacterial agent may contain a suitable solid or liquid carrier. The solid or liquid carrier may be an organic carrier, an inorganic carrier or a biological carrier. A suitable surfactant, stabilizer or pH regulator may be added to the bacterial agent.

[0014] The present invention also provides a method for preparing the bacterial agent, which comprises culturing the Penicillium strain F5 and using it as an active ingredient to prepare the bacterial agent.

[0015] The use of the Penicillium strain F5 in inhibiting the growth of Fusarium oxysporum and Phytophthoranicotianae also belongs to the scope of the present invention.

[0016] The use of the Penicillium strain F5 in preventing and treating plant wilt caused by Fusarium oxysporum also belongs to the scope of the present invention.

[0017] The use of the Penicillium strain F5 in preventing and treating tobacco black shank disease caused by Phytophthoranicotianae also belongs to the scope of the present invention.

[0018] The application of the Penicillium strain F5 in promoting the growth of corn and tomatoes also belongs to the scope of the present invention.

[0019] The present invention also provides a method for preventing and controlling tobacco black shank disease, which comprises: applying the Penicillium strain F5 or a culture thereof to the soil around the roots of tobacco plants.

[0020] The isolated Penicillium strain F5 of the present invention not only has a broad-spectrum fungal antibacterial effect, can significantly inhibit the growth of Fusarium oxysporum and tobacco phytophthora, but also has a significant plant growth-promoting ability. The results of the plate confrontation experiment showed that the mycelial growth inhibition rate of strain F5 on Fusarium oxysporum was 65% ( Figure 1 ), the mycelial growth inhibition rate of tobacco phytophthora was 68.3% ( Figure 2 ). The results of the biocontrol pot experiment showed that strain F5 had a 64.69% preventive effect on tobacco black shank. The results of the corn growth experiment showed that after strain F5 was applied to the planting soil, the height of the corn plants increased by 38.78%, the root length increased by 94.36%, the plant fresh weight increased by 37.27%, and the root fresh weight increased by 74.3% ( Figure 6 ). The results of the tomato seed germination experiment showed that after soaking the tomato seeds with the spore suspension of strain F5, the root length of the tomato seedlings increased by 28.45% and the shoot length increased by 22.43%.

[0021] In summary, the Penicillium strain F5 provided by the present invention can enhance the resistance of plants to fungal diseases and increase plant yield, while avoiding environmental pollution, protecting ecological balance and food safety, and has good application prospects in plant disease prevention and control.

[0022] The deposit information of the Penicillium strain F5 provided by the present invention is as follows:

[0023] Biomaterial name: Penicillium sp. F5

[0024] Taxonomic name: Penicillium sp.

[0025] Deposit date: October 28, 2024

[0026] Deposit number: GDMCC No:65364

[0027] Depository: Guangdong Microbiological Culture Collection Center (GDMCC)

[0028] Address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1The results of the plate confrontation experiment between strain F5 and Fusarium oxysporum; the left picture is the control group: Fusarium oxysporum was only inoculated in the center of the potato dextrose agar (PDA) plate; the right picture is the treatment group: the colony located in the center of the PDA plate is Fusarium oxysporum, and the light green colonies located around Fusarium oxysporum are strain F5.

[0030] Figure 2 The results of the plate confrontation experiment between strain F5 and tobacco phytophthora; the left picture is the control group: tobacco phytophthora was only inoculated in the center of the PDA plate; the right picture is the treatment group: the colony located in the center of the PDA plate is tobacco phytophthora, and the light green colonies located around tobacco phytophthora are strain F5.

[0031] Figure 3 These are colonies of strain F5 grown on PDA plates for 7 days.

[0032] Figure 4 Conidiophores and conidia of strain F5 observed under a microscope.

[0033] Figure 5 This is the phylogenetic tree of strain F5.

[0034] Figure 6 The results of the growth promotion experiment of strain F5 on corn; CK in the figure represents corn plants in the control group (strain F5 was not inoculated in the planting soil); F5 in the figure represents corn plants in the treatment group (strain F5 was inoculated in the planting soil).

[0035] Sequence Description

[0036] SEQ ID NO: 1 is the nucleotide sequence of primer ITS1.

[0037] SEQ ID NO: 2 is the nucleotide sequence of primer ITS4.

[0038] SEQ ID NO: 3 is the nucleotide sequence of the endogenous transcribed spacer (ITS) of strain F5. DETAILED DESCRIPTION

[0039] The following implementation plans are provided:

[0040] 1. A Penicillium sp. strain F5, the deposit number of which is GDMCC No: 65364.

[0041] 2. A culture of the Penicillium strain F5 according to embodiment 1.

[0042] 3. The culture according to embodiment 2, comprising a fermentation broth obtained by culturing the Penicillium strain F5 in a liquid culture medium.

[0043] 4. The culture of embodiment 2, comprising a culture obtained by culturing the Penicillium strain F5 in a solid medium.

[0044] 5. A bacterial agent, comprising the Penicillium strain F5 described in embodiment 1.

[0045] 6. The bacterial agent according to embodiment 5, comprising a solid or liquid bacterial agent.

[0046] 7. A method for preparing the bacterial agent according to embodiment 5 or 6, the method comprising culturing the Penicillium strain F5 according to embodiment 1 and using it as an active ingredient to prepare the bacterial agent.

[0047] 8. Use of the Penicillium strain F5 described in embodiment 1 in inhibiting the growth of Fusarium oxysporum and Phytophthoranicotianae.

[0048] 9. Use of the Penicillium strain F5 described in embodiment 1 in preventing and controlling plant wilt caused by Fusarium oxysporum.

[0049] 10. The use according to embodiment 9, wherein the plants include plants of the cucurbitaceae, solanaceae and leguminosae families.

[0050] 11. Use of the Penicillium strain F5 described in embodiment 1 in preventing and controlling tobacco black shank disease caused by Phytophthoranicotianae.

[0051] 12. The use according to embodiment 11, comprising applying the Penicillium strain F5 to the soil around the roots of tobacco plants.

[0052] 13. The use according to embodiment 12, comprising pouring the fermentation liquid or spore suspension of the Penicillium strain F5 into the soil around the roots of the tobacco plants after transplanting the tobacco plants, or mixing the Penicillium strain F5 or its culture into the soil before transplanting the tobacco plants.

[0053] 14. Use of the Penicillium strain F5 described in embodiment 1 in promoting corn growth.

[0054] 15. The use described in embodiment 14 comprises soaking the corn seeds with the fermentation liquid or spore suspension of the Penicillium strain F5 after the corn seeds have germinated, and then continuing to culture the soaked corn seeds.

[0055] 16. The use according to embodiment 14, comprising applying the Penicillium strain F5 to the soil around the roots of corn plants.

[0056] 17. The use according to embodiment 16, comprising pouring the fermentation liquid or spore suspension of the Penicillium strain F5 into the soil around the roots of the corn plants after transplanting the corn plants, or mixing the Penicillium strain F5 or its culture into the soil before transplanting the corn plants.

[0057] 18. Use of the Penicillium strain F5 described in embodiment 1 in promoting tomato growth.

[0058] 19. The use according to embodiment 18, comprising soaking the tomato seeds with the fermentation liquid or spore suspension of the Penicillium strain F5 after the tomato seeds have germinated, and then continuing to culture the soaked tomato seeds.

[0059] 20. The use according to embodiment 18, comprising applying the Penicillium strain F5 to the soil around the roots of tomato plants.

[0060] 21. The use according to embodiment 20, comprising pouring the fermentation liquid or spore suspension of the Penicillium strain F5 into the soil around the roots of the tomato plants after transplanting the tomato plants, or mixing the Penicillium strain F5 or its culture into the soil before transplanting the tomato plants.

[0061] 22. A method for preventing and controlling tobacco black shank, the method comprising: applying the Penicillium strain F5 or a culture thereof according to embodiment 1 to the soil around the roots of tobacco plants.

[0062] The technical solution of the present invention is described in detail below in conjunction with the embodiments and drawings.

[0063] If not otherwise specified, the reagents used in the following examples are all conventional reagents in the art, which can be obtained commercially or prepared according to conventional methods in the art, and the specifications are laboratory pure. If not otherwise specified, the experimental methods and conditions used in the following examples are all conventional experimental methods and conditions in the art, and reference can be made to relevant experimental manuals, known documents or manufacturer specifications. Unless otherwise defined, the meanings of all technical and scientific terms used herein are the same as those generally understood by those of ordinary skill in the art to which the present invention belongs.

[0064] The Fusarium oxysporum used in the following examples was isolated by our laboratory from corn root rot diseased plants in Dongchuan, Yunnan. The Phytophthora thoranicotianae used in the following examples was isolated by our laboratory from tobacco plants with black shank disease in Yuxi tobacco area.

[0065] Example 1: Isolation, screening and identification of biocontrol bacteria

[0066] 1. Isolation and screening of strains

[0067] Select 10 corn rhizosphere soil samples, transfer them into sterile physiological saline, add glass beads to break them up, and obtain soil suspension. Dilute the soil suspension 10 times with sterile water. 3 , 10 4 , 10 5 , 10 6 times, take 100 μL of each dilution and spread it on Red Bengal agar medium (5g / L peptone, 10g / L glucose, 1g / L potassium dihydrogen phosphate, 0.5g / L magnesium sulfate, 15g / L agar, 0.03g / L Red Bengal, 0.1g / L chloramphenicol, final pH 7.2±0.2), and culture at 28℃ for 7 days. Pick a single colony and purify it 2-3 times with potato glucose agar medium (take 200g of potatoes, wash and cut into pieces, add appropriate amount of water and boil for 20-30 minutes, filter the potato juice with gauze, add 20g of glucose and 20g of agar, make up to 1000ml, natural pH).

[0068] Single mold colonies were picked and the antagonistic effect of candidate molds on Fusarium oxysporum and Phytophthoranicotianae was tested by plate confrontation experiment. The method is as follows: the candidate mold and two pathogens (Fusarium oxysporum and Phytophthoranicotianae) were inoculated on potato dextrose agar (PDA) plates, activated and cultured at 26-28°C for 3-5 days for use. A control group and a treatment group were set up in the plate confrontation experiment for each pathogen, and three replicates were set up for each group. Treatment group: The pathogen was inoculated in the center of the PDA plate, and the candidate mold was inoculated at four evenly distributed positions on the culture medium around the pathogen. The inoculation point of the candidate mold was 4 cm away from the center of the pathogen, and then the culture dish was inverted in the incubator and cultured at 26-28°C for 10 days. Control group: The candidate mold was not inoculated, and the rest of the experimental steps were the same as the treatment group. The antibacterial effect of the candidate mold was observed, the colony radius of the pathogen was measured with a ruler, and the mycelial growth inhibition rate of the candidate mold on the pathogen was calculated using formula (1).

[0069] Mycelium growth inhibition rate = [(R1-R2) / R1] × 100% (1)

[0070] Where R1 is the colony radius of the pathogen in the control group, and R2 is the colony radius of the pathogen in the treatment group.

[0071] After extensive screening, a fungus with strong inhibitory effect on the mycelial growth of Fusarium oxysporum and Phytophthoranicotianae was obtained, which was numbered F5. The results of the plate confrontation experiment between strain F5 and Fusarium oxysporum are shown in the figure below. Figure 1The results of the plate confrontation experiment between strain F5 and tobacco phytophthora are shown in Figure 2 The calculation results show that the mycelial growth inhibition rate of strain F5 against Fusarium oxysporum is 65%, and the mycelial growth inhibition rate against Phytophthora nicotianae is 68.3%, so strain F5 has a broad-spectrum antibacterial activity.

[0072] 2. Morphological observation of strain F5

[0073] Strain F5 was inoculated on potato dextrose agar medium and cultured at 25°C for 7 days. The colony was light green or light blue-green in color, with well-developed hyphae of short length and felt-like shape. Figure 3 ). Observed under a microscope, the hyphae of strain F5 were multi-branched, thin lines, with upright conidiophores on the aerial hyphae, and the conidial heads at the top were broom-shaped ( Figure 4 ).

[0074] 3. Molecular identification of strain F5

[0075] Extract genomic DNA from strain F5. Use genomic DNA as template and universal primers ITS1 and ITS4 to perform PCR to amplify the internal transcribed spacer (ITS) of strain F5. The nucleotide sequences of the primers are as follows:

[0076] ITS1:5'-TCCGTAGGTGAACCTGCGG-3'(SEQ ID NO:1)

[0077] ITS4:5'-TCCTCCGCTTATTGATATGC-3'(SEQ ID NO:2)

[0078] The PCR reaction system was: 2×PCR Master Mix 12.5 μL, ITS1 (10 μM) 1 μL, ITS4 (10 μ

[0079] M) 1μL, template 1μL, ddH2O 9.5μL.

[0080] The PCR reaction program was as follows: pre-denaturation at 94°C for 10 min; (denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 1 min) repeated for 30 cycles; and final extension at 72°C for 10 min.

[0081] After the reaction, the amplified product was sent to Shanghai Paisono Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the nucleotide sequence of the ITS fragment of strain F5 was shown in SEQ ID NO:3. The ITS sequence of strain F5 was compared with the ITS sequences of known fungi in the NCBI database. The comparison results showed that the sequence match rate between strain F5 and Penicilliumoxalicum strainrubem E2 (GenBank: MH282514.1) reached 99.64%. By establishing a phylogenetic evolutionary tree ( Figure 5 ), it was determined that strain F5 belongs to the genus Penicillium. Strain F5 was deposited in Guangdong Microbiological Culture Collection Center on October 28, 2024, with the deposit number GDMCC No: 65364 and the classification name Penicillium sp. F5.

[0082] The nucleotide sequence of the ITS fragment of strain F5 is:

[0083] TGACCTCCTGATCGAGGTCACCTGGTTAAGATTGATGGTGTTCGCCGGCGGGCCGCCGGCC

[0084] GGGCCTACAGAGCGGGTGACGAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCG

[0085] CTGCCTTTCGGGCCCGCCCCCCGGAAGCGGGGGGCGAGAGCCCAACACACAAGCCGTGC

[0086] TTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATG

[0087] TGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGC

[0088] TGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTTAGT

[0089] CAAGTACTCAGACTGCAATCTTCAGACAAGAGTTCGTTTGTGTGTCTTCGGCGGGCGCGG

[0090] GCCCGGGGGCCGGATGCCCCCCGGCGGCCGTGAGGCGGGCCCGCCGAAGCAACAAGGTAC

[0091] GATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCCTACGGAAG(SEQ ID NO:3)

[0092] Example 2: Biocontrol pot experiment of strain F5 against tobacco black shank

[0093] In order to confirm the control effect of strain F5 on tobacco black shank, a tobacco pot experiment was conducted. The name of the tested tobacco (Nicotiana tabacum) variety is Yunyan 87, which was purchased from a local agricultural material company and preserved by the laboratory itself.

[0094] 1. Preparation of tobacco phytophthora spp.

[0095] The rice grains were placed in distilled water and boiled at high temperature until 2 / 3 of the grains bloomed. After draining the water with gauze, they were placed in a 500 mL conical flask and sterilized at 121°C for 1 hour. At the same time, tobacco phytophthora (Phytophthoranicotianae) was inoculated on a potato dextrose agar (PDA) plate and activated and cultured at 28°C for 7 days. The hyphae of tobacco phytophthora was picked up with an inoculation loop and inoculated into the sterilized grains. The grains were cultured at 28°C until the hyphae covered the grain culture medium to obtain tobacco phytophthora grains.

[0096] 2. Tobacco pot experiment

[0097] The strain F5 was inoculated into PDA liquid culture medium and cultured at 28° C. for 7 days to obtain the strain F5 fermentation liquid.

[0098] The test soil was collected from the field soil (red soil) of the tobacco area in Yuxi, Yunnan. The tobacco phytophthora spp. was added to the soil and mixed at a ratio of soil: tobacco phytophthora spp. = 1000g: 10g to serve as the diseased soil. The Yunyan 87 seedlings with basically uniform growth and 5 true leaves were transplanted into pots containing 500g of diseased soil, with one plant per pot. A control group and a treatment group were set up, with 4 replicates in each group and 10 pots in each replicate. Control group: No F5 fermentation liquid was applied. Treatment group: 5mL of F5 fermentation liquid was poured into the soil around the roots of the tobacco seedlings on the day of transplanting. All tobacco seedlings were placed at 28°C and 70% relative humidity for routine culture. The grade and incidence of tobacco black shank disease were counted on the 9th day after inoculation of black shank pathogen (transplanted to diseased soil), and the disease index and disease prevention effect were calculated.

[0099] Grading standards for tobacco black shank disease: Grade 0, the whole plant is disease-free; Grade 1, stem lesions do not exceed 1 / 3 of the stem circumference, or less than 1 / 3 of the leaves are withered; Grade 3, stem lesions surround 1 / 2 to 2 / 3 of the stem circumference, or 1 / 3 to 1 / 2 of the leaves are slightly withered; Grade 5: stem lesions exceed 1 / 2 of the stem circumference but do not completely surround the stem circumference, or 1 / 2 to 2 / 3 of the leaves are withered; Grade 7, stem lesions completely surround the stem circumference, or more than 2 / 3 of the leaves are withered; Grade 9: the diseased plant is basically dead.

[0100] Incidence rate = (number of diseased plants / total number of inoculated plants) × 100%;

[0101] Disease index = [(number of plants at each disease level × representative level value) / (total number of plants × representative level value of the highest disease level)] × 100;

[0102] Control effect = [(control disease index - treatment disease index) / control disease index] × 100%.

[0103] The experimental results are shown in Table 1. The preventive effect of strain F5 on tobacco black shank disease reached 64.69%.

[0104] Table 1

[0105] Group Disease index Relative efficacy (%) Control group 80.18 —— Treatment Group 28.31 64.69

[0106] Example 3: Experiment on the growth promotion of corn by strain F5

[0107] In order to confirm the effect of strain F5 on plant growth, a corn growth experiment was conducted. The variety of corn (Zeamays) tested was Yanhejin 2000, which was obtained from Shouguang Jilong Seed Company.

[0108] The experimental method is as follows: strain F5 was inoculated on a potato dextrose agar (PDA) plate, and after activation culture at 26-28°C for 3-5 days, spores of strain F5 were directly scraped from the PDA plate, and the spores were suspended in purified water and adjusted to a concentration of 10 6 / mL, and obtain F5 spore suspension. After disinfecting the corn seeds, soak them for 6-8 hours, germinate them in the dark at 25℃ for 2-3 days, and select corn seeds with the same germination degree and plant them in pots filled with 1kg of sterile soil, with 3 corn seeds in each pot. Set up a control group and a treatment group, with 3 replicates in each group and 4 pots in each replicate. Treatment group: After planting the corn seeds in the pots, pour 20mL of 10 6 Control group: After corn seeds were planted in pots, 20 mL of pure water was poured into the soil without inoculating strain F5. All pots were cultured in a greenhouse. After 14 days of culture, the plant height, root length, plant fresh weight and root fresh weight of each corn plant were measured.

[0109] The results showed that compared with the control group, the plant height of the treated group increased by 38.78%, the root length increased by 94.36%, the plant fresh weight increased by 37.27%, and the root fresh weight increased by 74.3% ( Figure 6 ). Therefore, strain F5 can significantly promote the growth of corn plants and increase the biomass of corn plants.

[0110] Example 4: Experiment on growth promotion of tomato by strain F5

[0111] In order to confirm the effect of strain F5 on plant growth, a tomato seed germination experiment was conducted. The variety of the tested tomato (Solanum lycopersicum) was named Provence and was obtained from the local agricultural supply market.

[0112] The experimental method is as follows: strain F5 was inoculated on a potato dextrose agar (PDA) plate, and after activation culture at 26-28°C for 3-5 days, spores of strain F5 were directly scraped from the PDA plate, and the spores were suspended in purified water and adjusted to a concentration of 10 6 After disinfection, the tomato seeds were placed in moist sterile quartz sand and germinated for 2 to 3 days in a dark environment at 20°C. Tomato seeds with the same germination degree were selected and randomly divided into a control group and a treatment group. Each group had 3 replicates and 6 seeds in each replicate. Treatment group: Use a concentration of 10 6 Soak tomato seeds in a suspension of F5 spores of 1000 g / mL for half an hour. Control group: Soak tomato seeds in sterile water for half an hour. Place the soaked tomato seeds on a 0.8% agar plate and continue germinating for 2 to 3 days. Measure the shoot length and root length of each tomato seedling and calculate the average value of each group.

[0113] The results are shown in Table 2. Compared with the tomato seedlings in the control group, the root length of the tomato seedlings in the treatment group increased by 28.45%, and the shoot length increased by 22.43%. Therefore, strain F5 can significantly promote the germination and growth of tomato seeds.

[0114] Table 2

[0115] Group Root length (cm) Bud length (cm) Control group 2.32 4.86 Treatment Group 2.98 5.95

Claims

1. A Penicillium sp. strain F5, the deposit number of which is GDMCC No: 65364.

2. A culture of the Penicillium strain F5 according to claim 1.

3. A bacterial agent, comprising the Penicillium strain F5 according to claim 1.

4. The bacterial agent according to claim 3, characterized in that The bacterial agent is a solid or liquid bacterial agent.

5. A method for preparing the microbial agent according to claim 3 or 4, the method comprising culturing the Penicillium strain F5 according to claim 1 and using it as an active ingredient to prepare the microbial agent.

6. Use of the Penicillium strain F5 according to claim 1 in inhibiting the growth of Fusarium oxysporum and Phytophthoranicotianae.

7. Use of the Penicillium strain F5 according to claim 1 in preventing and treating plant wilt caused by Fusarium oxysporum.

8. Use of the Penicillium strain F5 according to claim 1 in preventing and treating tobacco black shank disease caused by Phytophthoranicotianae.

9. Use of the Penicillium strain F5 according to claim 1 in promoting the growth of corn and tomatoes.

10. A method for preventing and treating tobacco black shank, the method comprising: The Penicillium sp. strain F5 or a culture thereof according to claim 1 is applied to the soil around the roots of tobacco plants.

Images