A strain of Paecilomyces lilacinus M-2 for degrading thiathiazolyl in vegetable soil and its preparation

Abstract

The present invention discloses a strain of Paecilomyces lilacinus M-2 for degrading thiathiazolyl in vegetable soil of a facility and its preparation. The strain is Paecilomyces lilacinus ( Purple cilium lilacinum )M‑2, the deposit number is: GDMCC No: 65294. The Paecilomyces lilacinus M‑2 provided by the present invention is domesticated and prepared into a thiazolyl degrading bacterial agent. Experiments have shown that the degradation bacterial agent has a rapid degradation effect on pesticides in facility vegetable soil contaminated by thiazolyl, and does not affect the control effect of thiazolyl on root-knot nematodes; at the same time, it effectively reduces the enhancement of pathogen resistance caused by the action of chemical pesticides and protects the balance of the soil micro-ecological system.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to a strain of Paecilomyces lilacinus ( Purple lilac ) M-2 and its preparation. Background Art

[0002] Thiazole is a commonly used organophosphorus pesticide in greenhouse vegetables. It is used to control various root-knot nematodes, aphids, etc. It also has a broad spectrum of activity against plant parasitic nematodes and other pests. Thiazole is easily degraded in open soil due to its strong photolysis and hydrolysis. However, there is a great difference between the greenhouse and the open environment. The degradation of pesticides is limited by factors such as the intensity of ultraviolet rays in sunlight and air circulation, making it relatively easy for pesticides to remain in vegetables and accumulate in the soil, reducing the quality of vegetables and soil. At the same time, due to the continuous cropping of greenhouse vegetables all year round, thiazole will be applied for a long time, in large quantities, and continuously. At the same time, due to the presence of greenhouse film, the soil is protected from rainwater erosion and the photolysis rate of thiazole is diluted, resulting in the long-term accumulation of thiazole in the soil of the facility, causing serious harm to the environment and human health.

[0003] At present, the main measures for the remediation of pesticide-contaminated soil include physical remediation, chemical remediation, and biological remediation. Bioremediation has become a hot topic in recent years. Bioremediation is a bioengineering technology that uses microorganisms, plants, or animals to degrade, absorb, or enrich pollutants in soil, groundwater, or the ocean. It can be mainly divided into three types: phytoremediation technology, microbial remediation technology, and mycorrhizal remediation technology. Among them, microbial remediation technology is to screen fungi, bacteria, actinomycetes, nitrogen-fixing bacteria, yeasts, and molds that can degrade pollutants from contaminated soil and water bodies, improve their degradation ability through laboratory domestication and modification, make bacterial agents, and then put them into the contaminated field. It is currently a field with more research.

[0004] At present, the main degrading bacteria of thiazolyl reported in public data are Bacillus mycoides. Bacillus Paramycoid 1-53 (Li Long: Evaluation of the remediation effect of microbial preparations on pesticide pollution in greenhouse vegetable soil), Bacillus subtilis Bacillus subtilis H27 (Shandong Agricultural University: a multifunctional Bacillus subtilis and its application), Brevibacterium frostii Brevibacterium frigoritolerans 1-9-1 (Qingdao Weilan Biotechnology Group Co., Ltd.: A cold-resistant brevibacterium that can rapidly degrade multiple pesticide residues), Bacillus cereus Bacillus cereus 22-2 (Qingdao Weilan Biotechnology Group Co., Ltd.: A strain of Bacillus cereus that can rapidly degrade multiple pesticide residues). All four microorganisms belong to the Bacillus family, and most of them are in the theoretical research stage and are not yet sufficient for production application. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention aims to provide a strain of Paecilomyces lilacinus ( Purple lilac ) M-2 and its preparation process. The present invention reports for the first time that the fungus Paecilomyces lilacinus is used to degrade thiazolyl in the soil of greenhouse vegetables, and is prepared into a bacterial agent for use in greenhouses. The Paecilomyces lilacinus used in the present invention has a function similar to that of thiazolyl, and can have a good biological control effect on root-knot nematodes in the soil. While the bacterial agent is applied to degrade thiazolyl, it does not affect the control effect on root-knot nematodes.

[0006] The present invention achieves the above object through the following technical solutions:

[0007] The present invention provides a strain of Paecilomyces lilacinus ( Purple lilac ) M-2, referred to as Pseudomonas lilacinus M-2 in the present invention, was deposited in Guangdong Microbiological Culture Collection Center (GDMCC) on October 18, 2024, with the address at 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is: GDMCC No: 65294.

[0008] The rDNA-ITS gene sequence of the Paecilomyces lilacinus M-2 is shown in SEQ ID NO.1, specifically:

[0009] GACCTTACCTCAGTTGCCTCGGCGGGACCGCCCCGGCCGCCGCGCAAGCGGCGCCGGACTCCAAGGCGCCGGCCGCAGGGACCCAAAACTCTTTTGCATTAGGCCCAACGGCGGGAATTTTTTCTCTGAGTGCATAAGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTT TGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGC GACCTCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGCAGCGCGGAGACGGTCACGCCGTAAAACGCCCAACTTCTTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTA.

[0010] The present invention also provides the use of the above-mentioned Paecilomyces lilacinus M-2 in degrading thiathiazolyl.

[0011] Furthermore, the Paecilomyces lilacinus M-2 can degrade the pesticide residues of thiazolyl in the soil of greenhouse vegetables.

[0012] The present invention also provides a thiazolyl degrading bacterial agent for producing thiazolyl in facility vegetable soil using the Paecilomyces lilacinus M-2. The degrading bacterial agent has a rapid degradation effect on the pesticide contaminated by thiazolyl in facility vegetable soil, and does not affect the control effect on root-knot nematodes.

[0013] The preparation method of the degradation bacterial agent comprises the following steps:

[0014] (1) The slant strain of Paecilomyces lilacinus M-2 was inoculated into PDB liquid culture medium and cultured in a constant temperature oscillator at 28°C and 180 rpm for 72 h. Subsequently, 1 mL of Paecilomyces lilacinus liquid was added to PDB liquid culture medium containing different concentrations of thiazolylphos to culture for 120 h to obtain the domesticated strain of Paecilomyces lilacinus M-2.

[0015] (2) The domesticated species of Paecilomyces lilacinus M-2 was inoculated and streaked onto a PDA plate containing thiazolyl chloride, and cultured in a biochemical incubator at 28°C for 96 h. After a single colony was grown, the activated Paecilomyces lilacinus was inoculated into a PDA liquid culture medium containing 150-200 mg / L thiazolyl chloride, and cultured in a constant temperature oscillator at 28°C and 180 rpm for 84-96 h to obtain a seed solution.

[0016] (3) The seed liquid prepared above is inoculated into a koji plate containing 200 kg of solid fermentation medium at an inoculum amount of 5% by mass, and the plate is placed in a sterile culture room at 28°C for 5-7 days. After the culture is completed, the plate is dried by forced air at 35-40°C for 24-48 hours, and the dried material is crushed to obtain a thiazole phosphine-degrading bacterial agent.

[0017] Furthermore, the concentrations of thiazole in the PDB liquid culture medium containing different concentrations of thiazole are 50 mg / L, 100 mg / L, 150 mg / L, 200 mg / L, and 250 mg / L, respectively.

[0018] Furthermore, the formula of the solid fermentation medium is: bran: corn flour mass ratio is 1:1, glucose addition amount is 2.5%, sucrose addition amount is 2.5%, urea addition amount is 0.1%, ammonium sulfate addition amount is 0.1%, thiazolyl addition amount is 0.02%, and the material-water ratio is 1:0.67.

[0019] The present invention also provides the use of the above-mentioned degradation bacterial agent in degrading thiazolyl. Preferably, it is used in degrading thiazolyl pesticide residues in vegetable soil of a facility.

[0020] Beneficial effects of the present invention:

[0021] The Paecilomyces lilacinus M-2 bacterial agent provided by the present invention is applied to vegetable soil in facilities, can effectively degrade thiazolyl pesticide residues, reduce soil pollution caused by organophosphorus pesticides, and reduce pesticide residues in vegetable crops.

[0022] The Paecilomyces lilacinus M-2 used in the present invention has a function similar to that of thiazolyl, and can have a good biological control effect on root-knot nematodes in the soil. When the bacterial agent is applied to degrade thiazolyl, the control effect on the root-knot nematodes is not affected; at the same time, the enhancement of pathogen resistance caused by the action of chemical pesticides is effectively reduced, and the balance of the soil micro-ecological system is protected.

[0023] Paecilomyces lilacinus Purple lilac ) M-2 was deposited on October 18, 2024 in the Guangdong Microbiological Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is: GDMCC No: 65294. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the colony picture of Paecilomyces lilacinus M-2. DETAILED DESCRIPTION

[0025] The present invention is further explained below in conjunction with the accompanying drawings and specific examples, but the present invention is not limited thereto. Unless otherwise specified, the following examples are all conventional reagents and method steps in the art.

[0026] Example 1: Acclimation of Paecilomyces lilacinus M-2

[0027] (1) Inoculate the freeze-dried powder of Paecilomyces lilacinus M-2 onto a PDA plate and culture at 28°C for 72 h. Pick out a single colony ( Figure 1 ) were inoculated into a flask containing PDB liquid culture medium and cultured in a constant temperature oscillator at 28°C and 180 rpm for 72 h.

[0028] (2) Take 1 mL of Paecilomyces lilacinus M-2 culture medium and add it to PDB liquid medium containing different concentrations of thiazolylphos. Culture for 120 h. The initial concentration of thiazolylphos in the medium is 50 mg / L, until the concentration of thiazolylphos in the PDB liquid medium reaches 250 mg / L. During the acclimatization process, measure the spore production every 24 hours.

[0029] (3) The spore production of Paecilomyces lilacinus M-2 acclimatized with different thiazolyl concentrations is shown in Table 1.

[0030] As shown in Table 1, under the treatment of low concentration of thiazolyl, the growth of Paecilomyces lilacinus M-2 was less affected. It was in the retention period from 0 to 48 h, and the spore concentration basically did not increase; it was in the logarithmic period from 48 to 96 h, and the spore concentration increased rapidly, showing a logarithmic growth; then it entered the stable period and the decline period. With the increase of thiazolyl concentration, after multiple rounds of domestication, under the treatment of thiazolyl concentration of 250 mg / L, after 96 h of culture, the spore number could reach 421 / mL, and the domesticated species was obtained.

[0031] Table 1 Conidia production of Paecilomyces lilacinus M-2 at different time periods after acclimation with different thiazolyl concentrations

[0032]

[0033] Example 2: Preparation of Degradation Bacteria Samples

[0034] (1) The domesticated strain of Paecilomyces lilacinus M-2 was inoculated and streaked onto a PDA plate containing 0.025% thiazolyl sulfate by mass, and cultured in a biochemical incubator at 28°C for 72 h. After a single colony grew, the activated Paecilomyces lilacinus M-2 was inoculated into a PDA liquid culture medium containing 200 mg / L thiazolyl sulfate, and cultured in a constant temperature oscillator at 28°C and 180 rpm for 84-96 h to obtain a seed solution.

[0035] (2) The seed liquid prepared above was inoculated at an inoculum amount of 5% by mass into a koji plate containing 200 kg of solid fermentation medium (the formula is: bran: corn flour mass ratio of 1:1, glucose addition amount of 2.5%, sucrose addition amount of 2.5%, urea addition amount of 0.1%, ammonium sulfate addition amount of 0.1%, thiazolyl addition amount of 0.02%, and material-water ratio of 1:0.67), and placed in a sterile culture room at 28°C for 5-7 days. After the cultivation, the material was dried by forced air at 35-40°C for 24-48 hours, and the dried material was crushed to obtain a thiazolylphosphine-degrading bacterial agent.

[0036] (3) The dilution coating method was used to count the viable bacteria of the prepared thiazolylphosphine-degrading bacterial agent. The test result showed that the number of effective viable bacteria in the thiazolylphosphine-degrading bacterial agent was 13.2 billion CFU / g.

[0037] Example 3: Indoor degradation test of thiazole by degradation bacteria

[0038] The experimental group and the control group were set up, and the degradation bacteria prepared above were added to the PDB liquid culture medium at an inoculation rate of 0.2% by mass, and the PDB liquid culture medium without the degradation bacteria was used as a blank control, and the rest of the treatments were exactly the same; 1 mL of 4% thiazolyl emulsion was added to each group of samples to make the concentration of thiazolyl in the culture medium reach 400 μg / mL, and the shaking culture was continued on a constant temperature shaker for 7 days, with a speed of 180 rpm and a temperature set to 28°C; three replicates were set for both the experimental group and the control group. After 7 days of culture, samples were taken and the residual amount of thiazolyl in the experimental group and the control group was detected by gas chromatography-mass spectrometry, and the test results are shown in Table 2 below.

[0039] As shown in Table 2, after 7 days of treatment with the degradation bacteria, the degradation rate of thiazolylphos reached more than 98.60%, while the natural degradation rate of the control group was only 7.87%.

[0040] Table 2 Indoor degradation test of thiazolylphos by degradation bacteria

[0041]

[0042] Example 4: Evaluation of the degradation ability of degrading bacteria on thiazolyl residues in greenhouse vegetable soil

[0043] 1. Experimental location

[0044] A 2-acre greenhouse tomato planting base in a certain area of ​​Guangdong Province.

[0045] 2. Experimental design

[0046] According to the requirements of the pesticide residue test guidelines, test plots were set up, protection zones were set up between plots, and control plots were set up. Thiazophos (98% original drug) was diluted to 500 μg / mL, and 200 mL was evenly applied to the rhizosphere of tomato plants (plants one week after planting tomato seedlings), and 100 mL of a suspension containing 10 g of bacterial agent was applied at the same time, and a negative control was set up (200 mL of thiazophos pesticide with a concentration of 500 μg / mL and 100 mL of clean water were applied to the rhizosphere).

[0047] 3. Determination of the degradation effect of thiazolyl pesticide

[0048] Sampling was performed at 0, 7, 14, 21, and 30 days after application. For soil sampling, more than 5 root sampling points were selected, the soil depth was 0-10 cm, and the sampling volume was >1 kg. The gravel, weeds and debris in the soil were removed, and after mixing evenly in a stainless steel basin, 500 g was taken and put into a sample bag, labeled, and stored in a -20℃ refrigerator for testing. The content of thiazophos in soil samples was determined by gas chromatography-mass spectrometry. The test results are shown in Table 3. Seven days after the application of clean water, the degradation rate of thiazophos in the soil was 39.10%, and 30 days after the application of clean water, the degradation rate of thiazophos in the soil was 88.02%, which was consistent with the first-order reaction kinetic equation. The degradation half-life of thiazophos in the soil of greenhouse tomatoes was 9.76 days. After the addition of the degradation bacteria, the degradation rate of thiazophos was greatly improved. Seven days after the application of the bacteria, the degradation rate of thiazophos could reach 78.90%, which was 1 times higher than that of the control group. 21 days after applying the fungicide, the degradation rate of thiazolyl could reach over 99%, which was basically completely degraded.

[0049] Table 3 Test results of degradation ability of degradation bacteria on thiazolyl residues in greenhouse vegetable soil

[0050]

[0051] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Paecilomyces lilacinus Purpureocillium lilacinum )M-2, the deposit number is: GDMCC No:65294.

2. Use of the Paecilomyces lilacinus M-2 according to claim 1 in the degradation of thiazolyl.

3. The use according to claim 2, characterized in that: It is used in the degradation of thiazolyl pesticide residues in vegetable soil of facilities.

4. A bacterial agent containing the Paecilomyces lilacinus M-2 according to claim 1.

5. The bacterial agent according to claim 4, characterized in that The preparation steps of the bacterial agent are: (1) Inoculate the Paecilomyces lilacinus M-2 described in claim 1 onto a PDA plate containing thiazolylphos, and culture it in a 28°C biochemical incubator for 96 hours. After a single colony grows, inoculate the activated Paecilomyces lilacinus into a PDA liquid culture medium containing 150-200 mg / L thiazolylphos and culture it with shaking for 84-96 hours to obtain a seed solution; (2) Inoculate the seed liquid at a mass fraction of 5% into a koji plate containing solid fermentation medium, place it in a sterile culture room at 28°C for 5-7 days, and after the culture is completed, air dry it at 35-40°C for 24-48 hours, and then crush it to obtain the bacterial agent.

6. The bacterial agent according to claim 5, characterized in that The formula of the solid fermentation medium is as follows: the mass ratio of bran to corn flour is 1:1, the added amount of glucose is 2.5%, the added amount of sucrose is 2.5%, the added amount of urea is 0.1%, the added amount of ammonium sulfate is 0.1%, the added amount of thiazolyl is 0.02%, and the material-water ratio is 1:0.

67.

7. Use of the bacterial agent according to any one of claims 4 to 6 in the degradation of thiathiazolyl.

8. The use according to claim 7, characterized in that: It is used in the degradation of thiazolyl pesticide residues in vegetable soil of facilities.

Images