Klebsiella oxytoca G1-2-4 and its application

Abstract

The present invention discloses Klebsiella oxytoca G1-2-4 and its application, Klebsiella oxytoca ( Klebsiella oxytoca ) G1-2-4, whose deposit number is CGMCC NO.30986, application of acid-producing Klebsiella G1-2-4 in the preparation of biological control agents or feeds for preventing and controlling aquatic diseases; application of acid-producing Klebsiella G1-2-4 in inhibiting the growth of Pseudomonas aeruginosa, and biological control agents or feeds for preventing and controlling aquatic diseases containing acid-producing Klebsiella G1-2-4. The present invention isolates and cultures an acid-producing Klebsiella, verifies the disease resistance of the bacterium through in vitro and in vivo experiments, and preliminarily explores its disease resistance mechanism, providing a reference for the research on the prevention and control of white spot disease in the viscera of small yellow croaker.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to Klebsiella oxytoca G1-2-4 and applications thereof. Background Art

[0002] Small yellow croaker is an important catch fish in my country. It is known as one of my country's "four major seafoods" along with large yellow croaker, hairtail and squid. It has high nutritional value and is deeply loved by the people.

[0003] Since the realization of fully artificial breeding, the frequent occurrence of diseases has become an important bottleneck restricting the further development of its breeding industry. Among them, visceral white spot disease has become the main disease type in yellow croaker breeding due to its frequent occurrence, high mortality rate and difficulty in treatment, causing great economic losses to the yellow croaker breeding industry.

[0004] At present, Pseudomonas aeruginosa, or pps, has developed resistance to a variety of commonly used antibiotics in aquaculture, and the use of antibiotics can easily affect the environment and food safety. In large yellow croaker, it can survive, replicate and release in macrophages. The use of probiotics to resist diseases has been successful in many other fish, but the technology of using probiotics to resist diseases in small yellow croaker is rare. Summary of the invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to design and provide a technical solution for Klebsiella oxytoca G1-2-4 and its application.

[0006] The present invention is specifically implemented by the following technical solutions:

[0007] The first aspect of the present invention provides a Klebsiella oxytoca ( Klebsiella oxytoca )G1-2-4, its deposit number is CGMCC NO.30986, and the deposit date is June 18, 2024.

[0008] The second aspect of the present invention provides the use of the above-mentioned Klebsiella oxytoca G1-2-4 in the preparation of a biocontrol agent or feed for preventing and controlling aquatic diseases.

[0009] Furthermore, the biological control agent or feed for preventing and controlling aquatic diseases contains Klebsiella oxytoca G1-2-4 bacteria or its lysate.

[0010] Furthermore, the aquatic disease is white spot disease of small yellow croaker viscera caused by Pseudomonas aeruginosa.

[0011] The third aspect of the present invention provides the use of Klebsiella oxytoca G1-2-4 in inhibiting the growth of Pseudomonas ayucigensis.

[0012] The fourth aspect of the present invention provides a biocontrol agent or feed for preventing and controlling aquatic diseases containing the above-mentioned Klebsiella oxytoca G1-2-4.

[0013] Furthermore, the biocontrol agent or feed contains Klebsiella oxytoca G1-2-4 bacteria or its lysate.

[0014] The fifth aspect of the present invention provides the use of the above-mentioned biological control agent or feed for preventing and controlling aquatic diseases in inhibiting the growth of Pseudomonas aquaticus.

[0015] The present invention isolated a strain of Klebsiella oxytoca from the intestine of healthy small yellow croaker ( Klebsiella oxytoca )G1-2-4. In the in vitro validation experiment, it was found that its lysate can inhibit the growth and reproduction of pathogenic bacteria Pseudomonas aeruginosa, and its own number increases when coexisting with Pseudomonas aeruginosa. In the in vivo validation experiment of the disease resistance of Klebsiella oxytoca, the control challenge group began to die from the 6th day, and the mortality rate reached 100% on the 14th day; the feeding bacteria challenge group began to die from the 7th day, and the survival rate throughout the whole process was greater than that of the control challenge group, and the difference was significant. On the 14th day, 30.56% of them survived, proving that feeding Klebsiella oxytoca has a significant effect on the resistance of small yellow croaker to visceral white spot disease caused by Pseudomonas aeruginosa. The detection of tissue bacterial load found that the content of Pseudomonas aeruginosa in the feeding bacteria challenge group was significantly lower than that in the control challenge group, proving that Klebsiella oxytoca can significantly inhibit the growth of pathogenic bacteria Pseudomonas aeruginosa.

[0016] In summary, the present invention isolated and cultured a strain of Klebsiella oxytoca, verified the disease resistance of the bacteria through in vitro and in vivo experiments, and preliminarily explored its disease resistance mechanism, which provides a reference for the research on the prevention and control of white spot disease in the viscera of small yellow croaker. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Results of co-culture of four experimental bacteria with Pseudomonas aeruginosa (a: culture of Bacillus brevis alone; b: culture of Pseudomonas aeruginosa pps alone; c: co-culture of Bacillus brevis and pps; d: culture of Sphingomonas alone; e: culture of pps alone; f: co-culture of Sphingomonas and pps; g: culture of Klebsiella oxytoca alone; h: culture of pps alone; i: co-culture of Klebsiella oxytoca and pps; j: culture of Staphylococcus epidermidis alone; k: culture of pps alone; l: co-culture of Staphylococcus epidermidis and pps);

[0018] Figure 2 The results of co-culture of the lysates of four experimental bacteria with Pseudomonas aeruginosa (a: pps cultured alone; b: the effect of the lysate of Bacillus brevis on pps; c: the effect of the lysate of Klebsiella oxytoca on pps; d: the effect of the lysate of Staphylococcus epidermidis on pps; e: the effect of the lysate of Sphingomonas spp on pps);

[0019] Figure 3 The relative quantification of Klebsiella oxytoca in the tissues of the experimental group and the control group in the first 5 weeks;

[0020] Figure 4 The relative quantification of Klebsiella oxytoca in the tissues of the four groups of samples after pps challenge;

[0021] Figure 5 is the relative quantification of Pseudomonas ayutans in the tissues of the four groups of samples after pps challenge;

[0022] Figure 6 is the survival rate of each group after pps challenge;

[0023] Figure 7 Comparison of tissue sections of the experimental group and the control group 7 days before the in vivo validation experiment (a. tissue sections of the experimental group; b. tissue sections of the control group);

[0024] Figure 8 The tissue sections, scanning electron microscopy and transmission electron microscopy photos of the experimental group and the control group during the in vivo validation experiment of feeding Klebsiella oxytoca (a. tissue sections of the experimental group at week 1; b. tissue sections of the experimental group at week 2; c. tissue sections of the experimental group at week 3; d. tissue sections of the experimental group at week 4; e. tissue sections of the control group at week 1; f. tissue sections of the control group at week 2; g. tissue sections of the control group at week 3; h. tissue sections of the control group at week 4; i. scanning electron microscopy of the experimental group at week 1; j. scanning electron microscopy of the experimental group at week 2; k. scanning electron microscopy of the experimental group at week 3; l. scanning electron microscopy of the experimental group at week 4; m. scanning electron microscopy of the control group at week 1; n. scanning electron microscopy of the control group at week 2; o. scanning electron microscopy of the control group at week 3; p. scanning electron microscopy of the control group at week 4; q. transmission electron microscopy of the experimental group at week 1; r. transmission electron microscopy of the experimental group at week 2; s. transmission electron microscopy of the experimental group at week 3 TEM of the experimental group at week 1; t. TEM of the experimental group at week 4; u. TEM of the control group at week 1; v. TEM of the control group at week 2; w. TEM of the control group at week 3; x. TEM of the control group at week 4);

[0025] Figure 9For the in vivo validation experiment, the tissue sections, scanning electron microscopy and transmission electron microscopy photos of the control challenged group, the control non-challenge group, the bacteria-challenge group, and the bacteria-challenge group without challenged group after pps challenge were shown (a. tissue section of the control challenged group; b. tissue section of the control non-challenge group; c. tissue section of the bacteria-challenge group; d. tissue section of the bacteria-challenge group without challenged group; e. scanning electron microscopy of the control challenged group; f. scanning electron microscopy of the control non-challenge group; g. scanning electron microscopy of the bacteria-challenge group; h. scanning electron microscopy of the bacteria-challenge group without challenged group; i. transmission electron microscopy of the control challenged group; j. transmission electron microscopy of the control non-challenge group; k. transmission electron microscopy of the bacteria-challenge group; l. transmission electron microscopy of the bacteria-challenge group without challenged group). DETAILED DESCRIPTION

[0026] The present invention is further described below with reference to the examples.

[0027] Based on previous research findings, there are Lactobacillus species in the intestines of healthy yellow croaker Lactobacillus , Bifidobacterium Bifidobacterium , Streptococcus Streptococcus , Lachnospira Lachnospira , Escherichia Escherichia , Shigella Shigella , Sphingomonas Sphingomonas , Klebsiella Klebsiella , Collinsella Collinsella , Roseburia Romboutsia , Staphylococcus Staphylococcus , Stibacillus Empedobacter , Corynebacterium Corynebacterium , Ruminococcus Ruminococcus Christensenella Christensenellaceae Eubacterium Blautia Eubacterium Eubacterium Sutterella Sutterella Allobacterium Allobaculum Fusobacterium Fusobacterium Prevotella Prevotellaceae and other potential beneficial bacteria.

[0028] Example 1: Isolation, culture and functional verification of potential beneficial bacteria in the intestines of small yellow croaker

[0029] 1 Materials and Methods

[0030] 1.1 Experimental Materials

[0031] The culture medium involved in this embodiment includes MRS culture medium, SS culture medium, PYG culture medium, GAM culture medium, ATCC Medium 1365 culture medium, ATCC Medium 1490 culture medium, 2216E culture medium, lactobacillus culture medium, bifidobacterium culture medium and nutrient broth culture medium. The above culture media are all existing culture media, among which MRS culture medium and SS culture medium are produced and sold by Hangzhou Baisi Biotechnology Co., Ltd., PYG culture medium, GAM culture medium and 2216E culture medium are produced and sold by Haibo Biotechnology Co., Ltd., ATCC Medium 1365 culture medium and ATCC Medium 1490 culture medium are produced and sold by ELITE-MEDIA, and lactobacillus culture medium, bifidobacterium culture medium and nutrient broth culture medium are produced and sold by Shanghai Shifeng Biotechnology Co., Ltd.

[0032] 1.2 Isolation and culture of bacteria from the digestive tract of small yellow croaker

[0033] Use sterile tweezers and scissors to dissect out the digestive tract of small yellow croaker, wash it with sterile saline, flush the inside of the intestine with a needle, cut the intestine into pieces and break it with a fully automatic sample rapid grinder, and use a sterile inoculation loop to streak the above-mentioned culture plates in an ultra-clean bench. Each plate was cultured at 28°C, 37°C, in aerobic or anaerobic environments for 48 hours.

[0034] Pick a single colony from the culture plate, put it into the corresponding liquid culture medium, and culture it in a constant temperature shaker (200r / min). Then use the DNA extraction kit to extract DNA according to the instructions, and then use primers 27F and 1492R for PCR. The PCR program and system are shown in Table 1. The PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0035] The sequencing results were compared with the NCBI database by Blast to determine the strain type. Common pathogenic bacteria and harmful bacteria were removed, and 1400ul of the remaining strains were placed in a sterile 1.5ml centrifuge tube, centrifuged at 3000rpm for 5min using an ultracentrifuge, and after removing the supernatant, 400ul of 20% sterile glycerol and 1ml of the original liquid culture medium were added, and the mixture was blown with a pipette tip and then frozen in a -80℃ refrigerator.

[0036] Table 1 PCR procedures and systems

[0037]

[0038] 1.3 Co-culture test of potential beneficial bacteria and Pseudomonas aeruginosa

[0039] Potential beneficial bacteria and Pseudomonas aeruginosa were cultured in nutrient broth at 28°C for 24 h, and the OD 600 Adjust to 0.6 and dilute 100,000 times for later use.

[0040] 30 μl of a 100,000-fold dilution of potential beneficial bacteria was spread on a nutrient agar medium as a control. Similarly, 30 μl of a 100,000-fold dilution of Pseudomonas aeruginosa was spread on a nutrient agar medium as a control.

[0041] Take 30 microliters of a 100,000-fold dilution of potential beneficial bacteria and spread it on a nutrient agar medium, and then take 30 microliters of a 100,000-fold dilution of Pseudomonas aeruginosa and spread it on the same medium to observe the results of the co-culture of live bacteria.

[0042] All the above culture media were cultured at 28°C for 24 hours, and all single colonies on the culture media were picked and cultured in nutrient broth medium at 28°C overnight. DNA was extracted using a DNA extraction kit according to the instructions, and then PCR was performed using primers 27F and 1492R. The PCR program and system are shown in Table 1. The PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing to determine the number of each bacteria on the co-culture plate.

[0043] 1.4 Effect of potential beneficial bacteria lysate on Pseudomonas aeruginosa

[0044] Potential beneficial bacteria and Pseudomonas aeruginosa were cultured in nutrient broth at 28°C for 24 h, and the OD 600 Adjust to 0.6 and dilute 100,000 times for later use.

[0045] After enrichment, the potential beneficial bacteria are repeatedly frozen and thawed and ultrasonically disrupted, and filtered through a 0.22-micron filter for later use.

[0046] Take 30 microliters of the 100,000-fold dilution of Pseudomonas aeruginosa and spread it on the nutrient agar medium as a control.

[0047] 30 μl of a 100,000-fold dilution of Pseudomonas aeruginosa was spread on a nutrient agar medium, and 30 μl of a lysate of potential beneficial bacteria was spread on a nutrient agar medium to observe the effect of the lysate of potential beneficial bacteria on Pseudomonas aeruginosa.

[0048] All the above culture media were cultured at 28°C for 24 hours, and all single colonies on the culture media were picked and cultured in nutrient broth medium at 28°C overnight. DNA was extracted using a DNA extraction kit according to the instructions, and then PCR was performed using primers 27F and 1492R. The PCR program and system are shown in Table 1. The PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing to determine the number of each bacteria on the co-culture plate.

[0049] 2 Experimental results

[0050] 2.1 Results of bacterial isolation and culture in the digestive tract of small yellow croaker

[0051] After exploration and more than 300 batches of experiments and tests, Bacillus subtilis, Photobacterium mermanii, Vibrio navarroa, Vibrio harveyi, Aeromonas caviae, Aeromonas versii, Citrobacter rodentium, Aeromonas hydrophila, etc. were identified.

[0052] As for the target bacteria, Sphingomonas ( Sphingomonas echinoides ) B18, Klebsiella oxytoca ( Klebsiella oxytoca )G1-2-4, Staphylococcus epidermidis ( Staphylococcus epidermidis ) 2251, Bacillus brevis ( Empedobacter brevis ) HMF6096 four strains.

[0053] Sphingomonas Sphingomonas echinoides ) The sequence fragment of B18 is as shown in SEQ ID NO.1; Klebsiella oxytoca ( Klebsiella oxytoca )G1-2-4, as shown in SEQ ID NO.2; Staphylococcus epidermidis ( Staphylococcus epidermidis ) 2251, as shown in SEQ ID NO.3; Bacillus brevis ( E mpedobacterbrevis) HMF6096, as shown in SEQ ID NO. 4. The above sequence was compared by BLAST and its genus was determined.

[0054] 2.2 Results of co-culture experiment of potential beneficial bacteria and Pseudomonas aeruginosa

[0055] The results of the co-culture experiment of potential beneficial bacteria and Pseudomonas aeruginosa are shown in Figure 1 As shown. When Bacillus brevis and Pseudomonas aeruginosa were co-cultured, a single colony was picked on the co-culture plate and shaken for testing, and 159 Bacillus brevis and 59 pps were found, while the control plates for single culture were 94 Bacillus brevis and 6 pps. When Klebsiella oxytoca and Pseudomonas aeruginosa were co-cultured, a single colony was picked on the co-culture plate and shaken for testing, and 10 Klebsiella oxytoca and 97 pps were found, while the control plates for single culture were 4 Klebsiella oxytoca and 35 pps. When Sphingomonas and Pseudomonas aeruginosa were co-cultured, a single colony was picked on the co-culture plate and shaken for testing, and 15 Sphingomonas and 1 pps were found, while the control plates for single culture were 15 Sphingomonas and 1 pps. When Staphylococcus epidermidis was co-cultured with Pseudomonas aeruginosa, 35 Staphylococcus epidermidis and 4 pps were found on the co-culture plate after single colony was picked and shaken for testing, while 45 Staphylococcus epidermidis and 32 pps were found on the single culture plate used as control.

[0056] In summary, after the four experimental bacteria were co-cultured with Pseudomonas aeruginosa, only Staphylococcus epidermidis could significantly inhibit the number of Pseudomonas aeruginosa. On the other hand, co-culturing with Pseudomonas aeruginosa increased the number of Bacillus brevis and Klebsiella oxytoca, and reduced the number of Sphingomonas and Staphylococcus epidermidis.

[0057] 2.3 Results of the experiment on the effect of the lysate of potential beneficial bacteria on Pseudomonas aeruginosa

[0058] The results of co-culture of the lysate of potential beneficial bacteria with Pseudomonas aeruginosa are shown in Figure 2 As shown. As a control, there were 14 pps on the culture medium in which pps were cultured alone. The number of pps was more than 200 when lysate of Bacillus brevis was added, 10 pps were added when lysate of Klebsiella oxytoca was added, 38 pps were added when lysate of Staphylococcus epidermidis was added, and 9 pps were added when lysate of Sphingomonas was added.

[0059] In summary, among the four experimental bacterial lysates, the lysate of Klebsiella oxytoca and Sphingomonas spp. can inhibit the number of pps, while the lysate of Bacillus brevis and Staphylococcus epidermidis will increase the number of pps.

[0060] 2.4 Discussion

[0061] In this example, after obtaining a large number of small yellow croaker intestinal bacteria, the bacteria that have been reported in the literature to be harmful to the host were excluded, and Sphingomonas ( Sphingomonas echinoides ) B18, Klebsiella oxytoca ( Klebsiella oxytoca )G1-2-4, Staphylococcus epidermidis ( Staphylococcus epidermidis ) 2251, Bacillus brevis ( Empedobacter brevis )HMF6096 four strains were used for follow-up experiments. In the in vitro co-culture experiment with live bacteria Pseudomonas aeruginosa, we found that when only Staphylococcus epidermidis was co-cultured with Pseudomonas aeruginosa, the number of Pseudomonas aeruginosa on the co-culture plate would be less than the number on the single culture plate, while the live bacteria co-culture experiments of Sphingomonas, Klebsiella oxytoca and Bacillus brevis could not achieve this effect, which shows that Staphylococcus epidermidis may be able to inhibit Pseudomonas aeruginosa. In the experiment on the effect of the lysates of the four experimental bacteria on Pseudomonas aeruginosa, we found that the lysate of Klebsiella oxytoca and Sphingomonas oxytoca could inhibit the number of Pseudomonas aeruginosa, while the lysate of Bacillus brevis and Staphylococcus epidermidis would increase the number of Pseudomonas aeruginosa.

[0062] Combining the experimental results of the above two experiments, it is necessary to select a strain from Staphylococcus epidermidis, Klebsiella oxytoca and Sphingomonas for subsequent in vivo verification experiments. Although Staphylococcus epidermidis caused a decrease in the number of Pseudomonas aeruginosa in the live bacteria mixed culture experiment, its own number also decreased compared with the control group. Considering that in actual production, it is more hoped that the bacteria can be effective for a longer time after one feeding, it is not desirable to select Staphylococcus epidermidis, which will also reduce its own number when coexisting with and inhibiting Pseudomonas aeruginosa. Although the lysate of Sphingomonas can inhibit Pseudomonas aeruginosa, the same problem of its own number reduction occurred in the live bacteria mixed culture experiment. Compared with the first two, not only can the lysate of Klebsiella oxytoca inhibit Pseudomonas aeruginosa, but its own number also increased when it coexists with Pseudomonas aeruginosa in the live bacteria mixed culture experiment. Therefore, Klebsiella oxytoca was finally selected for subsequent in vivo verification experiments.

[0063] Finally, Klebsiella oxytoca ( Klebsiella oxytoca ) G1-2-4 is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, the deposit date is June 18, 2024, the deposit number is: CGMCC NO.30986, the address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Postal Code 100101.

[0064] Example 2: Klebsiella oxytoca ( Klebsiella oxytoca )In vivo verification of G1-2-4's ability to resist visceral white spot disease

[0065] 1 Experimental design

[0066] 1.1 The experimental site, related facilities and experimental fish were provided by Xiangshan Gangwan Aquatic Seed Co., Ltd. (Ningbo, China). The number of healthy small yellow croakers used was about 1000, which were planned to be divided into a control group (3 buckets) and an experimental group (3 buckets). About 160 fish were placed in each bucket. The weight and total length of the fish were weighed before sorting (the average total length was 12.35±0.6cm; the average weight was 20.38±2.27g). The experimental group was fed with enrofloxacin (the standard is 50mg / Kg body weight, and the amount was used twice in the preliminary experiment) and doxycycline (20mg / Kg, and the amount was used twice in the preliminary experiment) for 1 week. After that, the intestinal contents of 5 fish were taken for plating or streaking culture, and the culture results were observed to determine whether some of the original microorganisms had been eliminated, which was conducive to the colonization of the experimental bacteria after feeding. Feed containing acid-producing Klebsiella (1×108cfu / Kg, 1% mixed feed) was continuously fed for 4 weeks, and the intestines were randomly taken once every 7 days (control group and experimental group), with 6 fish in each bucket each time, of which 4 fish were frozen in liquid nitrogen (1 tube for each fish), 1 fish was fixed with PFA (the same group and the same period can be mixed and fixed), and 1 fish was fixed with 2.5% glutaraldehyde fixative for electron microscopy experiments. After four weeks of feeding with acid-producing Klebsiella, each bucket of fish was divided into two, half of which was used for attack with Pseudomonas australis (pps), and the other half was used as control. At this time, the control group (3 buckets) and the experimental group (3 buckets) were divided into 4 groups: control attack group (3 buckets), control non-attack group (3 buckets), feeding bacteria attack group (3 buckets), and feeding bacteria non-attack group (3 buckets), with about 60 fish in each bucket. The attack bacteria Pseudomonas australis strain XSDHY was isolated and cultured from the liver of small yellow croaker with visceral white spot disease in our laboratory. The volume of each barrel of water is 450L, the water temperature is heated to 22℃, 300ml of the virus-infecting bacteria is used per barrel, and the OD of the virus-infecting bacteria is 600 =0.25, no feeding and no water change during the whole process of the challenge. After the challenge, 6 samples were taken from each barrel, of which 4 were frozen in liquid nitrogen (1 tube for each), 1 was fixed with PFA, and 1 was fixed with 2.5% glutaraldehyde fixative for electron microscopy. The death situation during the challenge was recorded and the mortality rate of each group was calculated. The samples frozen in liquid nitrogen were used to measure the changes in tissue bacterial load, changes in intestinal microbial composition, and changes in intestinal immune factors. The PFA-fixed samples were made into paraffin sections for HE staining, and the intestinal changes were observed under a microscope. For the electron microscopy experiment, the samples fixed with 2.5% glutaraldehyde fixative were dehydrated with ethanol step by step, and then dehydrated with 100% acetone. After that, the embedding agent was infiltrated, embedded, sliced, stained, and observed with a scanning electron microscope and a transmission electron microscope, and photographed and preserved.

[0067] 2 Experimental methods

[0068] 2.1 Measurement of bacterial load in tissues in in vivo validation experiments

[0069] Take out the samples frozen in liquid nitrogen, and use a DNA extraction kit to extract DNA for later use. According to the sequence of Klebsiella oxytoca, primers were designed using NCBI's Primer-BLAST. The designed primers were used to perform fluorescence quantitative PCR experiments on the previously extracted sample DNA, and the products were sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were Blast aligned in the NCBI database to verify the specific primers for Klebsiella oxytoca. After verification, a pair of specific primers were obtained, the sequences of which were forward AGTACGGCCGCAAGGTTAAA, reverse GCAGCACCTGTCTCAGAGTT, and the product size was 166. The primers were used to perform fluorescence quantitative PCR experiments on sample DNA, and the internal reference gene was selected as small yellow croaker β-Actin. The reaction system is shown in Table 2. According to the results of fluorescence quantitative PCR, the qPCR relative quantitative calculation method 2^-(△△Ct) was used to calculate the content of Klebsiella oxytoca in the sample tissue.

[0070] Real-time fluorescence quantitative PCR detection technology was used to detect the content of Pseudomonas aeruginosa in the sample tissues after infection.

[0071] Table 2: Reaction system

[0072]

[0073] 2.2 Calculation of mortality in in vivo validation experiments

[0074] After four weeks of feeding with Klebsiella oxytoca, each bucket of fish was divided into two, half for pps challenge and the other half for control. At this time, the control group (3 buckets) and the experimental group (3 buckets) were divided into 4 groups: control challenge group (3 buckets), control non-challenge group (3 buckets), bacteria-fed challenge group (3 buckets), bacteria-fed non-challenge group (3 buckets). The number of deaths in each bucket was then recorded every day, and the recorded data were analyzed for correlation using SPSS 27 and plotted using GraphPad Prism 8.

[0075] 2.3 Tissue sectioning and HE staining

[0076] Dehydration and paraffinization: Take out the intestinal tissue preserved in 4% paraformaldehyde, cut out small segments of 2 mm with a sterile knife, put them into an embedding box, first dehydrate (70% ethanol 3 times for 5 minutes each, 80%, 90%, 95% ethanol once for 5 minutes each, 100% ethanol 3 times for 5 minutes each), then make it transparent (ethanol and xylene mixed in a volume of 1:1 for 10 minutes, xylene I and xylene II for 10 minutes each), and finally dip into wax (xylene and paraffin mixed in a volume of 1:1 for 1 hour, paraffin for 2 hours).

[0077] Embedding and sectioning: Take out the intestinal tissue from the embedding box, put it in the middle of the groove of a small metal dish, add wax liquid and cool it to solidify, remove the wax block and cut it into 5mm in length and width with a blade, fix it on the slicer, and set the wax strip with a slice thickness of 5μm.

[0078] Spreading and drying the slides: Apply egg white on the glass slide to increase the stickiness, spread the cut wax strips on the 40°C water surface, pick them up with a glass slide, and put them in a slide drying machine to dry at 40°C for 3 hours.

[0079] HE (hematoxylin-eosin) staining: first dewax with xylene (xylene I and xylene II for 10 minutes each), then rehydrate with gradient ethanol (100% ethanol for 5 minutes, 90% ethanol, 80% ethanol, 70% ethanol, and water for 2 minutes each), then stain (hematoxylin for 15 seconds, water rinse for 20 minutes, eosin for 30 seconds), and finally dehydrate with gradient ethanol (70% ethanol, 80% ethanol, 90% ethanol for 2 minutes each, 100% ethanol for 10 minutes).

[0080] The stained slides were placed under a microscope (YS-100; Nikon Corporation, Tokyo, Japan) for observation and photography. The intestinal villus width, intestinal villus length, intestinal wall thickness, and intestinal cavity diameter of the challenge group and the control group were measured. The average intestinal villus width ÷ intestinal cavity diameter = relative intestinal villus width, the average intestinal villus length ÷ intestinal cavity diameter = relative intestinal villus length, and the average intestinal wall thickness ÷ intestinal cavity diameter = relative intestinal wall thickness were calculated, and their correlation was analyzed using SPSS 27.

[0081] 2.4 Transmission electron microscopy experimental method

[0082] Dehydration: Remove the intestinal tissue preserved in 2.5% glutaraldehyde fixative and first dehydrate it with alcohol (50%, 70%, 80%, 90%, 95%, 100%, 100% for 15 minutes each), and then dehydrate it with 100% acetone for 20 minutes.

[0083] Infiltration and embedding: First, use acetone and SPURR embedding agent in a ratio of 3:1 for 2 hours, then use acetone and SPURR embedding agent in a ratio of 1:1 for 4 hours, then use acetone and SPURR embedding agent in a ratio of 1:3 for 4 hours, then change to pure SPURR embedding agent for infiltration overnight, and finally use an oven at 70℃ for polymerization for 24 hours.

[0084] Sectioning and staining: Use an ultrathin slicer set to 60nm thickness, then perform uranium-lead double staining (use 2% uranyl acetate saturated alcohol solution and lead citrate for 15 minutes each), and dry at room temperature overnight.

[0085] A Hitachi H7650 transmission electron microscope was used for observation and photography.

[0086] 2.5 SEM experimental method

[0087] The intestinal tissue preserved in 2.5% glutaraldehyde fixative was removed and first dehydrated with alcohol (50%, 70%, 80%, 90%, 95%, 100%, 100% for 15 minutes each), then infiltrated with 100% alcohol and isoamyl acetate in a ratio of 1:1 for 30 minutes, then switched to pure isoamyl acetate for infiltration overnight, dried in a desiccator, and then coated. A scanning electron microscope Hitachi Regulus8100 was used for observation and photography.

[0088] 2.6 Data Analysis

[0089] SPSS 27 was used to analyze the correlation between the results of tissue bacterial load detection and the mortality statistics of each group after pps challenge, and statistics were performed according to the standard of significant difference (P value less than 0.05 was marked with *).

[0090] 3. Experimental results

[0091] 3.1 In vivo validation experiment: detection of bacterial load in tissues

[0092] According to the results of fluorescence quantitative PCR, the qPCR relative quantitative calculation method 2^-(△△Ct) was used to calculate the tissue bacterial load of the sample. SPSS 27 was used to analyze the correlation and GraphPad Prism 8 was used to draw the graph. The results showed that Klebsiella oxytoca was a bacteria that existed in the body of small yellow croaker and existed before co-feeding. Since the seventh day when the experimental group began to co-feed with Klebsiella oxytoca, the content of Klebsiella oxytoca in the experimental group was significantly higher than that in the control group, proving that the amount of this bacteria in the intestine increased significantly after co-feeding. Figure 3 shown.

[0093] After pps challenge, the content of Klebsiella oxytoca in the group fed with bacteria was significantly higher than that in the group fed with bacteria but not challenged. Figure 4 This is consistent with the experimental results in vitro that the amount of acid-producing Klebsiella increased after co-culture of the two live bacteria.

[0094] After pps challenge, the levels of Pseudomonas aeruginosa in each group were detected. Figure 5 As shown in the figure, the content of Pseudomonas killing sweetfish in the bacteria-fed group was significantly lower than that in the control group, indicating that feeding acid-producing Klebsiella in advance can significantly inhibit the growth of pathogenic bacteria Pseudomonas killing sweetfish. This is consistent with the experimental results of the inhibition of Pseudomonas killing sweetfish by the acid-producing Klebsiella lysate in the in vitro experiment.

[0095] 3.2 Survival rate results of in vivo validation experiments

[0096] After the experimental group was fed with Klebsiella oxytoca for 4 weeks, each bucket of fish was divided into two, half of which was used to kill Pseudomonas auris (pps) and the other half was used as a control. At this time, the control group (3 buckets) and the experimental group (3 buckets) were divided into 4 groups: control challenge group (3 buckets), control non-challenge group (3 buckets), bacteria-fed challenge group (3 buckets), bacteria-fed non-challenge group (3 buckets), with about 60 fish in each bucket. The number of deaths in each bucket was recorded every day, and the recorded data was analyzed for correlation using SPSS 27 and plotted using GraphPad Prism8. The results are shown in Figure 6 shown.

[0097] No fish died in the four groups in the first five days of the challenge, and no fish died in the control group without challenge and the group fed with bacteria without challenge. The control group with challenge began to die from the sixth day, and the mortality rate reached 100% on the 14th day. The group fed with bacteria with challenge began to die from the seventh day, and the survival rate was higher than that of the control group with challenge, and the difference was significant. On the 14th day, 30.56% of the fish survived, indicating that feeding with acid-producing Klebsiella has a significant effect on the resistance of small yellow croaker to visceral white spot disease caused by Pseudomonas aeruginosa.

[0098] 3.3 Results of intestinal histological analysis of in vivo validation experiments

[0099] During the first seven days of the in vivo validation experiment (see Figure 7 ), after the experimental group was fed enrofloxacin and doxycycline, the intestinal structure was clear, the cells were intact, the goblet cells on the intestinal villi were arranged tightly, neatly and regularly, and the intestinal wall structure, intestinal villus morphology, goblet cell morphology, etc. were basically the same as those of the control group. This proves that feeding enrofloxacin and doxycycline has basically no effect on the intestinal structure of small yellow croaker.

[0100] During the subsequent four weeks of continuous feeding of feed containing Klebsiella oxytoca (see Figure 8 ), tissue sections show that the experimental group has a clear intestinal structure, complete cells, and goblet cells on the intestinal villi are arranged tightly and regularly. The intestinal wall structure, intestinal villus morphology, and goblet cell morphology are basically the same as those of the control group; scanning electron microscopy shows that the intestinal villi of the experimental group are densely arranged and flat, which is basically the same as the control group; transmission electron microscopy shows that the intestinal wall boundary of the experimental group is complete, the intestinal villi are densely arranged and the length and thickness are similar, which is also similar to the control group as a whole. These prove that continuous feeding of feed containing acid-producing Klebsiella for four weeks has basically no effect on the intestinal structure of small yellow croaker.

[0101] After the last step of the in vivo validation experiment, we took samples from four groups of fish (control challenged group, control non-challenge group, bacteria-fed challenged group, bacteria-fed non-challenge group).Figure 9 It can be seen that the intestinal tissue structure of the control challenge group and the bacteria-fed challenge group was unclear, the boundaries of the parenchymal cells were blurred, cell disintegration and tissue vacuolation occurred, the intestinal villi were destroyed, and the intestinal wall border was obviously damaged.

[0102] 3.4 Discussion

[0103] The intestine is not only a place for digestion and absorption of nutrients, but also plays an important role in nonspecific and specific immune responses because it contains immune cells such as lymphocytes, macrophages, granulocytes, and plasma cells. The epithelial layer, mucus layer, microbial community, and intestinal endocrine secretions constitute a complex intestinal defense system that can effectively prevent harmful bacteria and their toxins in the intestine from transferring to extra-intestinal tissues and exogenous pathogenic microorganisms from invading the body.

[0104] In the in vivo verification experiment of this embodiment, before the pps attack step, whether it is mixed with enrofloxacin and doxycycline or mixed with acid-producing Klebsiella, the tissue sections, scanning electron microscope, and transmission electron microscope of the intestinal samples are observed, and it is found that the intestinal structure is clear, the cells are intact, the goblet cells on the intestinal villi are arranged tightly and neatly with regularity, the intestinal villi are arranged densely and flatly, the intestinal wall border is intact, and the intestinal villi are arranged densely and neatly and the length and thickness are similar. It is proved that mixing enrofloxacin, doxycycline, and acid-producing Klebsiella will not destroy the intestinal structure, and the effect on small yellow croaker is small. After the pps attack step, the control non-attack group and the feeding bacteria non-attack group did not change, the intestinal tissue structure of the control attack group and the feeding bacteria attack group was unclear, the boundaries of the parenchymal cells were blurred, cell disintegration and tissue cavitation occurred, the intestinal villi were destroyed, and the intestinal wall border was obviously damaged. It is proved that it is pps that causes the intestinal structure of small yellow croaker to be destroyed.

[0105] The detection of the amount of bacteria in tissues found that before the co-feeding of Klebsiella oxytoca, Klebsiella oxytoca was already present in the digestive tract of small yellow croaker. As a common bacterium in wild small yellow croaker, it has the advantages of good safety and environmental protection. After the co-feeding of Klebsiella oxytoca, the content of Klebsiella oxytoca in the experimental group was significantly higher than that in the control group, proving that the amount of this bacterium in the intestine increased significantly after co-feeding, indicating that the co-feeding method is feasible. The method of co-feeding can significantly increase its relative content in the fish body, which has the advantage of a simple method. After the pps attack step, the content of Klebsiella oxytoca in the bacteria-fed attack group was significantly higher than that in the bacteria-fed but non-attack group, proving that the amount of Klebsiella oxytoca will increase when coexisting with pps, which is consistent with the experimental results of the increase of Klebsiella oxytoca after the co-culture of the two live bacteria in the in vitro experiment. After being attacked by pps, its relative content will also increase significantly, which has the advantage of good stability.

[0106] After the pps challenge, the levels of Pseudomonas killing sweetfish in each group were detected. The levels of Pseudomonas killing sweetfish in the bacteria-fed challenge group were significantly lower than those in the control challenge group, indicating that the advance feeding of Klebsiella oxytoca can significantly inhibit the growth of pathogenic bacteria Pseudomonas killing sweetfish. This is consistent with the experimental results of Klebsiella oxytoca lysate inhibiting Pseudomonas killing sweetfish in in vitro experiments.

[0107] The survival rate of each group in the in vivo validation experiment was statistically analyzed. No fish died in the four groups in the first five days of the challenge. There was no death in the control group without challenge and the group fed with bacteria without challenge. The control group with challenge began to die from the sixth day, and the mortality rate reached 100% on the 14th day; the group fed with bacteria with challenge began to die from the seventh day, and the survival rate was higher than that of the control group with challenge, and the difference was significant. On the 14th day, 30.56% of the fish were still alive, proving that feeding with acid-producing Klebsiella has a significant effect on the resistance of small yellow croaker to visceral white spot disease caused by Pseudomonas aeruginosa.

Claims

1. Klebsiella oxytoca ( Klebsiella oxytoca )G1-2-4, its deposit number is CGMCC NO.30986, and the deposit date is June 18, 2024.

2. Use of the lysate of Klebsiella oxytoca G1-2-4 according to claim 1 in the preparation of a biocontrol agent or feed for preventing and treating aquatic diseases, wherein the aquatic disease is white spot disease of yellow croaker viscera caused by Pseudomonas ayuciphila.

3. The use according to claim 2, characterized in that The biological control preparation or feed for preventing and controlling aquatic diseases contains the lysate of Klebsiella oxytoca G1-2-4.

4. A biocontrol agent or feed for preventing and controlling aquatic diseases containing the lysate of Klebsiella oxytoca G1-2-4 as claimed in claim 2.

Images