The lethal gene Nlpfam fragment of Nilaparvata lugens and its application in biological control

Abstract

The present application provides a brown planthopper lethal gene Nlpfam and its application in biological control. After the brown planthopper lethal gene Nlpfam is interfered with, it can cause the death of brown planthoppers. Therefore, by transcribing the brown planthopper lethal gene Nlpfam to prepare dsRNA or an interfering reagent, injecting it into brown planthoppers can effectively interfere with the Nlpfam gene, causing the abdomen of brown planthoppers to turn black, effectively killing brown planthoppers, and achieving biological control of brown planthoppers.

Description

Technical Field

[0001] The present application relates to the field of agricultural science and technology, and in particular to a fragment of a brown planthopper lethal gene Nlpfam and its application in biological control. Background Art

[0002] Brown planthoppers are the most important agricultural pests in my country and other Asian countries that grow rice. Brown planthoppers have the habit of seasonal and long-distance migration. They migrate from south to north on a large scale in spring and summer every year with the help of monsoons, and migrate back from north to south in autumn. Brown planthoppers are monophagous insects that feed on rice and wild rice. They mainly harm rice directly by feeding, and also indirectly harm rice by spreading a variety of rice viruses, which seriously affect the quality, stable yield and high yield of rice. Since the 1960s, brown planthoppers have broken out in various rice-growing areas in Asia. During the period of 2020-2023, major brown planthopper disasters broke out in southern rice-growing areas of my country, causing rice grains to be not full and dry weight to decrease. At the same time, they caused large areas of rice plants to dry up and fall, causing serious losses to my country's grain production and supply. In view of the severity of its harm, my country's Ministry of Agriculture and Rural Affairs has included brown planthoppers in the "List of Class I Crop Pests and Diseases" for many consecutive years.

[0003] The control of brown planthoppers mainly relies on chemical pesticides, but the continuous and unreasonable use of chemical pesticides in large quantities not only accelerates the development of brown planthoppers' resistance, aggravates environmental pollution and ecosystem damage, but also poses a serious threat to my country's agricultural modernization, food, ecological and economic security. Therefore, in agricultural production practice, pest control methods other than chemical pesticides are urgently needed. With the development of science and technology, biotechnology has gradually been developed and utilized as an important means of pest control. RNA interference is a gene silencing technology mediated by double-stranded RNA. By introducing small molecule double-stranded RNA into the target pest, it specifically binds to the pest target gene mRNA, degrades or inhibits the protein translation of the target gene, and causes teratogenicity or death to the pest. RNA interference technology has the characteristics of high specificity, good effect, and green environmental protection, and has been widely used in the prevention and control of various agricultural pests. Summary of the invention

[0004] The present application provides a fragment of the Nlpfam gene that causes brown planthoppers and its application in biological control to solve the problems existing in the related technologies. The technical solution is as follows:

[0005] In a first aspect, an embodiment of the present application provides a fragment of a brown planthopper lethal gene Nlpfam, and the nucleotide sequence of the fragment of the brown planthopper lethal gene Nlpfam is shown in SEQ ID NO.1.

[0006] In one embodiment, the amino acid sequence encoded by the Nlpfam fragment of the brown planthopper lethal gene is shown as SEQ ID NO.2.

[0007] In a second aspect, an embodiment of the present application provides a primer set for amplifying the above-mentioned Nlpfam fragment of the brown planthopper lethal gene, including an upstream primer SEQ ID NO.3 and a downstream primer SEQ ID NO.4.

[0008] In a third aspect, an embodiment of the present application provides a dsRNA of the brown planthopper lethal gene Nlpfam, and the dsRNA targets and silences the brown planthopper lethal gene Nlpfam.

[0009] In one embodiment, the nucleotide sequence of the dsRNA of the brown planthopper lethal gene Nlpfam is as shown in SEQ ID NO.5.

[0010] In a fourth aspect, an embodiment of the present application provides a preparation method of the above-mentioned dsRNA of the brown planthopper lethal gene Nlpfam. Using the nucleotide sequence SEQ ID NO.5 of the brown planthopper lethal gene Nlpfam as a template, it is prepared by transcription using a T7 High Yield RNA Transcription Kit.

[0011] In one embodiment, the reaction system is: 2 μl of 10x Reaction Buffer, 2 μl of Enzyme mix, 2 μl of ATP solution, 2 μl of UTP solution, 2 μl of CTP solution, 2 μl of GTP solution, 1 μg of DNA template, and water is added to a total volume of 20 μl; after mixing well, incubate overnight at 37°C, add DNase and mix well, then treat at 37°C for 15 min and at 65°C for 5 min to obtain the dsRNA of the brown planthopper lethal gene Nlpfam.

[0012] In a fifth aspect, an embodiment of the present application provides the application of the above-mentioned brown planthopper lethal gene Nlpfam or the above-mentioned dsRNA of the brown planthopper lethal gene Nlpfam in the control of brown planthoppers.

[0013] In a sixth aspect, an embodiment of the present application provides an interfering reagent for the brown planthopper lethal gene Nlpfam, and the interfering reagent includes the above-mentioned dsRNA of the brown planthopper lethal gene Nlpfam; or includes a gene fragment transcribed from the above-mentioned brown planthopper lethal gene Nlpfam.

[0014] In one embodiment, the interfering reagent for the brown planthopper lethal gene Nlpfam acts on brown planthoppers by injection.

[0015] The advantages or beneficial effects in the above technical solutions at least include:

[0016] The present application discloses a brown planthopper lethal gene Nlpfam, which plays a key role in the survival process of the brown planthopper. By targeting and interfering with the brown planthopper lethal gene Nlpfam to prevent its expression, it can cause the death of the brown planthopper. This helps to control the brown planthopper through biological means and reduce the damage of the brown planthopper to food crops; at the same time, compared with chemical pesticide control, it is harmless to the environmental ecology and food, and improves environmental and food safety.

[0017] A dsRNA or interfering reagent of the brown planthopper lethal gene Nlpfam of the present application is prepared by transcribing the brown planthopper lethal gene Nlpfam. After being injected into the brown planthopper, it can effectively interfere with the expression of the brown planthopper lethal gene Nlpfam, cause the death of the brown planthopper, and thus control the brown planthopper population, providing a new strategy for the green control of the brown planthopper.

[0018] The above summary is only for the purpose of the specification and is not intended to be limiting in any way. In addition to the illustrative aspects, embodiments, and features described above, further aspects, embodiments, and features of the present application will become apparent by reference to the drawings and the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In the drawings, unless otherwise specified, the same reference numerals throughout the several views denote the same or similar components or elements. These drawings are not necessarily drawn to scale. It should be understood that these drawings only depict some embodiments disclosed in the present application and should not be regarded as limiting the scope of the present application.

[0020] Figure 1 Results of PCR amplification of the brown planthopper lethal gene Nlpfam fragment;

[0021] Figure 2 Synthesis of dsRNA of the brown planthopper lethal gene Nlpfam;

[0022] Figure 3 Comparison of the emergence morphology of the brown planthopper after the dsRNA of the brown planthopper lethal gene Nlpfam is introduced into the brown planthopper with the control group;

[0023] Figure 4 Emergence rate of the brown planthopper after the dsRNA of the brown planthopper lethal gene Nlpfam is introduced into the brown planthopper. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0024] In the following, only some exemplary embodiments are briefly described. As those skilled in the art can recognize, the described embodiments can be modified in various different ways without departing from the spirit or scope of the present application. Therefore, the drawings and the description are considered to be exemplary in nature and not restrictive.

[0025] RNA interference (RNAi) technology has been widely applied to the prevention and control of various agricultural pests. By searching for key lethal genes of pests and causing teratogenesis or lethality of pests through interfering with the expression of lethal genes, the effect of pest control can be achieved. Therefore, this application provides a lethal gene Nlpfam fragment of Nilaparvata lugens and its application in biological control.

[0026] Example 1 Cloning of the lethal gene Nlpfam fragment of Nilaparvata lugens

[0027] 1. Amplification of the lethal gene Nlpfam fragment of Nilaparvata lugens:

[0028] (1) Take adult or nymph of Nilaparvata lugens, wash it 3 times with 1x PBS (2.68 mM KCl, 37 mM NaCl, 8.1 mM Na2HPO4, 1.47 mM KH2PO4, pH 7.4), and then extract total RNA by TrizoL method: add 1 mL TrizoL and grind the insect body thoroughly; add 500 μL chloroform and mix vigorously; centrifuge at 12000 rpm at 4 °C for 15 min; carefully aspirate the supernatant and transfer it to a new centrifuge tube; add an equal volume of isopropanol, mix well and let it stand for 10 min; centrifuge at 12000 rpm at 4 °C for 10 min, discard the supernatant; add 1 mL of 75% ethanol, centrifuge and discard the supernatant; dissolve the precipitate with RNase-free water and measure the RNA concentration.

[0029] (2) Using the total RNA as a template, reverse transcribe the RNA with One-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcription kit: 5 μg of total RNA, 1 μL of Oligo(dT), 10 μL of 2xTS Reaction Mix, 1 μL of Enzyme Mix, 1 μL of gDNA Remover, add RNase-free water to make up the total volume to 20 μL; mix well and incubate at 42 °C for 30 min; denature at 85 °C for 5 s to inactivate the reverse transcriptase and obtain the cDNA of Nilaparvata lugens;

[0030] (3) Design primers according to the SEQ ID NO.1 of the Nlpfam gene of Nilaparvata lugens and the SEQ ID NO.2 of the amino acid encoded by the Nlpfam gene,

[0031] SEQ ID NO.1:

[0032]

[0033] SEQ ID NO.2:

[0034] GGDREVARERDSGRESGGRRNFKPSKASSNSNNDHQSTSLYKFKLSRPSGRWQYKTTPKPRIQIRRQDNDLENNHNAAQQQLTTTADQSTSSDLEGSNSEVGSAVDQLLDQAVNSGGQAAEPTVTAETIKVEISTPADFKDTYYEIQTIKSPYTFQVGTIKNTRFITVTSTVEKSLVEPTEAPQLRPSEPLTENILATATQNVYDNKEPPLDSSVATLPPIALAGDAETPPLETMTESFSTTQLMLKTHLLPVVRAGNTSTYTLVQSYHVTRLVTAVKTLPPMEVYQFVPSKTLNEFNTRLDEAGSELHLELEFGDNNNNDDLPSAKAFPPDLDLANVGSEFDLSEMDKTKFPDMHLRLKKAHQNAPAQQNQIQPVSTTQELATPSLSPEQLQQLALYRFLNPNAPLPPQLLTTSRPVLKVETIYESHVIPLFNGQSTLFSTISRPIATVSKTEYEVVTNSLALPPVQPPVNTINPFLQQPQPQFAVTSTP。

[0035] The primers are shown as SEQ ID NO.3 and SEQ ID NO.4,

[0036] SEQ ID NO.3: CACCTCCACCGTCGAGAAAA;

[0037] SEQ ID NO.4: GGAAAGCCTTAGCGGAAGGT;

[0038] (4) Using the cDNA of Nilaparvata lugens as a template, and using the primers SEQ ID NO.3 and SEQ ID NO.4, perform PCR amplification on the Nlpfam gene. The reaction system is as follows: 5 μL of 2x ApexHF Mix, 1 μL of the upstream primer Nlpfam-F (SEQ ID NO.3), 1 μL of the downstream primer Nlpfam-R (SEQ ID NO.4), 2 μL of the cDNA of Nilaparvata lugens, 1 μL of ddH2O, for a total of 10 μL; The PCR amplification reaction conditions are as follows: 95°C, 2 min; 95°C for 20 s, 55°C for 20 s, 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0039] 2. Monoclonal cloning of the Nlpfam gene of the brown planthopper:

[0040] (1) Separate the PCR products by 1% agarose gel electrophoresis, and the results are as Figure 1 shown; cut the band with a blade and recover the PCR products using a DNA agarose gel kit; obtain the purified DNA fragment of the Nlpfam gene of the brown planthopper; use a blunt-end cloning kit to ligate the DNA fragment of the Nlpfam gene of the brown planthopper to the pClone007 vector, and the reaction system is as follows: 2 μL of 10x Buffer, 2 μL of pClone007 Blunt simple vector, 2 μL of the DNA fragment of the Nlpfam gene of the brown planthopper, 14 μL of ddH2O, with a total volume of 20 μL. After mixing the reagents, perform the ligation reaction at 25 °C for 5 min.

[0041] (2) Transform the ligation products into competent cells. The transformation procedure is as follows: add the ligation products to the competent cells, gently flick the tube wall to mix, and incubate on ice for 30 min; quickly incubate on ice for 2 min after 42 °C for 90 s; transfer the competent cells into LB medium without antibiotics and culture at 180 rpm for 1 h; take 150 μL of the resuscitated bacterial solution and spread it on an LB medium plate containing ampicillin, and incubate overnight; pick a single colony into an LB liquid medium containing ampicillin and culture at 180 rpm for 6 h for colony culture.

[0042] (3) Verify the DNA fragment of the Nlpfam gene of the brown planthopper by colony PCR. The reaction system is as follows: 5 μL of 2×ApexHF Mix, 1 μL of the upstream primer Nlpfam (SEQ ID NO.3), 1 μL of the downstream primer Nlpfam-R (SEQ ID NO.4), 2 μL of the cDNA of the brown planthopper, 1 μL of ddH2O, with a total volume of 10 μL; the PCR amplification reaction conditions are as follows: 95 °C, 2 min; 95 °C for 20 s, 55 °C for 20 s, 72 °C for 1 min, for 35 cycles; extend at 72 °C for 10 min. Separate the PCR amplification products by 1% agarose gel electrophoresis; cut the band with a blade and recover the PCR products using a DNA agarose gel kit; send them to the company for sequencing, and obtain the DNA sequence fragment of the Nlpfam gene of the brown planthopper as shown in SEQ ID NO.5;

[0043] SEQ ID NO.5:

[0044] CACCTCCACCGTCGAGAAAAGCCTAGTGGAACCCACAGAGGCACCCCAATTGCGCCCCTCAGAACCCCTTACCGAGAACATTCTCGCCACAGCCACCCAGAACGTCTATGACAACAAGGAACCCCCTCTAGATTCCAGTGTGGCCACCCTTCCACCCATTGCACTGGCTGGCGACGCTGAAACTCCACCCCTAGAGACCATGACTGAGTCTTTCAGTACTACACAGCTCATGTTGAAGACTCATCTGTTACCTGTGGTGAGAGCTGGAAATACGTCAACATATACATTGGTGCAATCATACCATGTGACCAGGTTGGTAACAGCTGTGAAGACTCTACCTCCGATGGAAGTCTACCAGTTTGTCCCAAGTAAAACACTGAACGAGTTTAACACGAGGTTGGACGAGGCTGGATCAGAGTTGCATCTAGAACTAGAGTTTGGGGATAACAATAACAATGATGATCTACCTTCCGCTAAGGCTTTCC。

[0045] Example 2: Synthesis of dsRNA of the brown planthopper lethal gene Nlpfam

[0046] (1) PCR amplify the Nlpfam gene fragment as shown in SEQ ID NO.5 with primers containing the T7 promoter. Using the bacterial solution containing the brown planthopper lethal gene Nlpfam fragment shown in SEQ ID NO.5 as a template, amplify the target gene with primers SEQ ID NO.6 and SEQ ID NO.7 containing the T7 promoter sequence. The reaction system is as follows: 50 μL of 2× ApexHF Mix, 10 μL of the upstream primer Nlpfam-F (SEQ ID NO.6), 10 μL of the downstream primer Nlpfam-R (SEQ ID NO.7), 20 μL of the bacterial solution containing the brown planthopper lethal gene Nlpfam, 10 μL of ddH2O, and the total volume is 100 μL; The PCR amplification reaction conditions are as follows: 95°C, 2 min; 95°C for 20 s, 55°C for 20 s, 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0047] SEQ ID NO.6 (dsNlpfam-F):

[0048] TAATACGACTCACTATAGGGG CACCTCCACCGTCGAGAAAA;

[0049] SEQ ID NO.7 (dsNlpfam-R):

[0050] TAATACGACTCACTATAGGGG GGAAAGCCTTAGCGGAAGGT.

[0051] (2) Recovery and purification of PCR products. The PCR products were separated by 1% agarose gel electrophoresis, the target band was cut with a blade, and the PCR products were recovered using a DNA agarose gel kit to obtain a large amount of single Nlpfam fragment of the brown planthopper lethal gene containing the T7 promoter.

[0052] (3) Synthesis and purification of Nlpfam dsRNA of the brown planthopper lethal gene. The synthesis of Nlpfam dsRNA of the brown planthopper lethal gene was carried out using the T7 High Yield RNA Transcription kit, and the method was as follows: Using the Nlpfam fragment of the brown planthopper lethal gene containing the T7 promoter as the DNA template, 2 μl of 10x Reaction Buffer, 2 μl of Enzyme mix, 2 μl of ATP solution, 2 μl of UTP solution, 2 μl of CTP solution, 2 μl of GTP solution, 1 μg of DNA template, and adding water to a total volume of 20 μl. After the reaction system was prepared and mixed evenly, it was incubated overnight at 37 °C, DNase was added and mixed evenly, then incubated at 37 °C for 15 min and at 65 °C for 5 min to obtain the dsRNA of the brown planthopper lethal gene Nlpfam. Measure the solubility of Nlpfam dsRNA of the brown planthopper lethal gene, and at the same time use 1% agarose gel electrophoresis to determine the quality of the dsRNA, as Figure 2 shown.

[0053] Example 3 Injection of dsRNA of the brown planthopper lethal gene Nlpfam into the brown planthopper

[0054] (1) Take 3-4 instar nymphs of the brown planthopper, about 100 in each group, a total of 6 groups, freeze them on ice for 10 min, and wait for injection.

[0055] (2) The glass capillary tubes required for microinjection were pulled to the appropriate size using a needle puller (NARISHIGE, PC-10), and the needle pulling parameters were as follows: STEP1, HEATER 62 °C.

[0056] (3) After adding the dsRNA of the brown planthopper lethal gene Nlpfam into a glass capillary with an Eppendorf micropipette tip, the glass capillary was installed on a micromanipulator (FemtoJet 4x, Eppendorf), and the dsRNA was injected into the body of the brown planthopper under a microscope. The injection parameters were as follows: pi = 1000 pah; ti[s]: 0.3 s; pc = 10 pah. Three groups of brown planthopper nymphs were injected, with about 100 in each group.

[0057] (4) The dsRNA of the jellyfish green fluorescent protein gene (GFP, Aequorea Victoria green fluorescent protein) was used as a control group, and three groups of brown planthopper nymphs were injected in the same way, with about 100 in each group.

[0058] (5) After the brown planthopper nymphs injected with the dsRNA of the brown planthopper lethal gene Nlpfam and dsGFP woke up, they were transferred to rice plants for normal rearing. The rearing conditions were as follows: temperature 26 ± 0.5 °C, light 16:8 h (day: night), humidity 50 ± 5%.

[0059] (6) After the brown planthopper nymphs were injected with the dsRNA of the brown planthopper lethal gene Nlpfam and dsGFP, the nymphs were observed daily. The experimental results are as Figure 3 shown; the dead brown planthoppers were removed daily, and the number of dead insects per day was counted. The mortality rates of the brown planthopper nymphs injected with the dsRNA of the brown planthopper lethal gene Nlpfam and dsGFP were counted, and the results are as Figure 4 shown.

[0060] From Figure 3 it can be seen that the abdomens of the brown planthoppers injected with the lethal gene Nlpfam dsRNA turned black and showed death. The abdomens of the brown planthoppers in the control group injected with dsGFP were plump and shiny, and they grew normally.

[0061] From Figure 4 it can be seen that there was a significant difference in the survival rate of the brown planthoppers injected with the lethal gene Nlpfam dsRNA compared with the control group injected with dsGFP (P < 0.0001), indicating that the dsRNA of the brown planthopper lethal gene Nlpfam affected the survival of the brown planthopper, suggesting that the dsRNA of the Nlpfam gene has potential application value for the control of the brown planthopper.

[0062] In summary, the present application provides a fragment of the brown planthopper lethal gene Nlpfam and its application in biological control. According to the brown planthopper lethal gene Nlpfam, the corresponding dsRNA is prepared. After injecting the dsRNA into the brown planthopper to interfere with the lethal gene Nlpfam, the abdomen of the brown planthopper turns black, and the brown planthopper can be effectively killed. It realizes the control of the brown planthopper population, reduces the damage of the brown planthopper to food crops, and provides a new strategy for the green prevention and control of the brown planthopper.

[0063] In the description of this specification, the descriptions referring to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. Moreover, the specific features, structures, materials, or characteristics described may be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0064] In addition, the terms "first" and "second" are only used for descriptive purposes and cannot be understood as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. Thus, the features defined with "first" and "second" may explicitly or implicitly include at least one of these features. In the description of the present application, "a plurality of" means two or more, unless otherwise specifically defined.

[0065] The above is only the specific implementation manner of the present application, but the protection scope of the present application is not limited thereto. Any person skilled in the art within the technical scope disclosed in the present application can easily think of various changes or substitutions, and these should all be covered by the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. A brown planthopper lethal gene Nl dsRNA of pfam, characterized in that The dsRNA targets and silences the lethal gene of Nilaparvata lugens Nl pfam; the lethal gene of Nilaparvata lugens Nl The nucleotide sequence of pfam is shown in SEQ ID NO.1; the nucleotide sequence of the dsRNA is shown in SEQ ID NO.

5.

2. The brown planthopper lethal gene according to claim 1 Nl A method for preparing the dsRNA of pfam, characterized in that Using the nucleotide sequence SEQ ID NO.5 of the brown planthopper lethal gene Nl as a template, it was prepared by transcription using the T7 High Yield RNA Transcription Kit.

3. The brown planthopper lethal gene according to claim 2 Nl A method for preparing dsRNA of pfam, characterized in that The reaction system for transcription preparation is as follows: 2 μl of 10x Reaction Buffer, 2 μl of Enzyme mix, 2 μl of ATP solution, 2 μl of UTP solution, 2 μl of CTP solution, 2 μl of GTP solution, 1 μg of DNA template, and add water to a total volume of 20 μl; mix well, incubate overnight at 37°C, add DNase and mix well, then treat at 37°C for 15 min and at 65°C for 5 min to obtain the lethal gene of the brown planthopper Nl dsRNA of pfam.

4. Use of the dsRNA of pfam in controlling Nilaparvata lugens, which is the lethal gene described in claim 1 Nl Application of the dsRNA of pfam in the control of Nilaparvata lugens 5. A brown planthopper lethal gene Nl a pfam interfering reagent, characterized in that The interference reagent includes the brown planthopper lethal gene described in claim 1 Nl dsRNA of pfam.

6. The Nilaparvata lugens lethal gene according to claim 5 Nl The pfam interference reagent, characterized in that The brown planthopper lethal gene Nl The pfam interference reagent acts on the brown planthopper by injection.

Images