A gene RhWOX11 promoting the division of callus cells of Rhododendron and its application

Abstract

The present invention belongs to the technical field of plant genetic engineering. More specifically, it relates to a gene RhWOX11 that promotes the division of callus cells in rhododendron and its application. The nucleic acid sequence of the gene RhWOX11 is shown as SEQ ID NO.1. The expressed protein of the gene RhWOX11 has an amino acid sequence shown as SEQ ID NO.2. The present invention also includes the application of the gene RhWOX11 that promotes the growth of callus cells in rhododendron in accelerating the growth and development of callus. The present invention obtains the key gene RhWOX11 that promotes the division of rhododendron callus through genetic engineering means, and introduces the key gene RhWOX11 into plant cells such as tobacco cells, and transgenic callus with a faster division speed can be cultivated. Therefore, the key gene RhWOX11 can be applied to the division of plant callus, improve the success rate of callus division in plants with difficult regeneration, and provide technical means support for large-scale seedling breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to a gene RhWOX11 that promotes the division of callus cells of Rhododendron and its application. Background Art

[0002] Rhododendron belongs to the genus Rhododendron of the family Ericaceae, is a world-famous flower, rich in germplasm resources, with high ornamental value, accounting for about 65% of the annual flower market share. Some varieties can be edible, medicinal, and used for extracting essential oils, etc., and have important value of homology between medicine and food. Horticultural cultivars of Rhododendron lapponicum, due to their huge inflorescences, bright colors, and beautiful flower postures, are recognized as high-grade potted flowers and are also important flowers for improving the urban landscape quality. Due to the low flowering and fruiting rate of Rhododendron and the low survival rate of cuttings, the large-scale breeding of seedlings is restricted. The occurrence of plant callus is widely used because of its good genetic stability, fast propagation speed, and high propagation efficiency. Focusing on culturing callus provides good materials for studying the molecular mechanism of plant embryogenesis. Embryogenic callus is also an important medium for establishing an Agrobacterium-mediated genetic transformation system, a good receptor for foreign genes, and is of great significance for revealing cell differentiation, morphogenesis, and zygotic embryogenesis.

[0003] Plant growth regulators can induce the division of callus cells of plants with difficult regeneration and promote somatic embryogenesis. However, the occurrence of embryogenic callus under in vitro conditions is relatively difficult, the proportion of abnormal embryos is high, and it is difficult to synchronize. This problem has become an important factor restricting the rapid breeding of excellent plants by the technology of embryogenic callus occurrence, and at the same time leads to the difficulty of genetic transformation of specific genotype species, thus hindering functional genomics research and trait genetic improvement. With the continuous progress of genome editing technology, the current insufficient ability of embryogenic callus occurrence is still an important obstacle restricting future molecular design breeding.

[0004] The WOX transcription factor family is a class of transcription factor families unique to plants and plays a regulatory role in the development of plant stem cells. Genes of the WOX family have the ability to regulate somatic embryo division, differentiation, homeostasis, and plant organ development.

[0005] The technical problem to be solved by the present invention is to provide the RhWOX11 gene, its expressed protein, and their applications. Summary of the Invention

[0006] In view of the deficiencies in the prior art, the role of the present invention is to provide a RhWOX11 gene of Rhododendron, its expressed protein, and their applications.

[0007] The specific technical solution adopted by the present invention is as follows:

[0008] A gene RhWOX11 that promotes the division of Rhododendron callus cells, and the nucleic acid sequence of the gene RhWOX11 is shown as SEQ ID NO.1.

[0009] Specifically as follows:

[0010] ATGGAAGATCATGGCGGCCAAGAAGATGCTGGTGGTAGTAGAGAGAGAAACAACGAGGGAGTTAGATCAAGGTGGACTCCCAAACCAGAGCAAATCCTCATACTGGAATCAATCTTCAACAGTGGGATGGTAAATCCCCCGAAAGATGAAACGGTGAGGATCAGAAAACTACTGGAGAAATTCGGTTCAGTCGGGGACGCAAATGTCTTTTACTGGTTCCAGAACCGGAGGTCCCGGTCCCGCCGCCGGCAGCGCCAGCAGATTCATGAGGCGGCGGCCACCACCACCAGCCATGCCACGGCCACCCAACAACAACAACAGCAGCATGGTTATTATCAGACCACCAACGAAAGCGGTGGCGGTGGTAGTGGTGGTGGTGGTGCAATTCATCAGTATGAGATGAGTGGTTCTTCTTCTTCCTCGGGCGGCGGTGGTGGCGGTGGTGATTTTGTGAATGAGCATCTCTGCTCTTTTTCGGGTGAAATTGGTTTTCCAGGGTACTTCAGTGAGCAGATTTCCTCCTCCCCTTCAGTTTCGGCCCCGTTAGATACTTCTTCAACTTCTTTGCCATACCAATCTCCAGGATTTATAACGGTGTTCATAAATGGGGTGTCAACAGAAGTAGGGAGGGGCCCGATAGACATGAAAGGAACGTTTGGTGAAGATTTGGTGTTAGTCCACTCTTCTGGAATGCCAGTTGTCCCTTTCAACGACTTCGGCTTTTCCCTTCACACTTTGCACCATGGAGAGAGCTATTTCCTGGTTCCAAGGCCTGGTTAA

[0011] The expressed protein of the gene RhWOX11, and its amino acid sequence is shown as SEQ ID NO.2.

[0012] Specifically as follows:

[0013] MEDHGGQEDAGGSRERNNEGVRSRWTPKPEQILILESIFNSGMVNPPKDETVRIRKLLEKFGSVGDANVFYWFQNRRSRSRRRQRQQIHEAAATTTSHATATQQQQQQHGYYQTTNESGGGGSGGGGAIHQYEMSGSSSSSGGGGGGGDFVNEHLCSFSGEIGFPGYFSEQISSSPSVSAPLDTSSTSLPYQSPGFITVFINGVSTEVGRGPIDMKGTFGEDLVLVHSSGMPVVPFNDFGFSLHTLHHGESYFLVPRPG*

[0014] Application of a gene RhWOX11 promoting the division of Rhododendron callus in accelerating the growth and development of callus, and the specific application is as follows:

[0015] 1) Construct a vector of the key gene RhWOX11 for the division of Rhododendron callus;

[0016] 2) Transform the constructed vector of the key gene RhWOX11 for the division of Rhododendron callus into plant cells;

[0017] 3) Cultivate and screen to obtain transgenic callus with a faster growth rate compared to untreated materials.

[0018] The vector is a plant expression vector.

[0019] In step 2), the plant cells are plant leaf cells, and the vector transformation method is the Agrobacterium-mediated method.

[0020] The plant is tobacco.

[0021] The beneficial effects of the present invention are as follows:

[0022] The present invention obtains the key gene RhWOX11 promoting the division of Rhododendron callus by genetic engineering means, and introduces the key gene RhWOX11 into plant cells such as tobacco, and transgenic callus with a faster division rate can be cultivated. Therefore, the key gene RhWOX11 can be applied to the division of plant callus, improve the success rate of callus division of plants with difficult regeneration, and provide technical means support for large-scale breeding of seedlings. Description of the Drawings

[0023] Figure 1 It is a 1% agarose gel electrophoresis diagram of the full-length PCR product of the RhWOX11 gene;

[0024] Figure 2It is the 1% agarose gel electrophoresis diagram of the single colony PCR of Agrobacterium tumefaciens pBI121WOX;

[0025] Figure 3 It is the diagram of the constructed overexpression vector of RhWOX11;

[0026] Figure 4 It is the diagram of the PCR detection results of the overexpressed RhWOX11 transgenic tobacco positive plants;

[0027] Figure 5 It is the comparison phenotype diagram of the leaves of the overexpressed RhWOX11 transgenic tobacco WT and RhWOX11; Detailed implementation mode

[0028] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments:

[0029] The present invention discloses a gene RhWOX11 that promotes the division of Rhododendron callus, and its nucleic acid sequence is shown in SEQ ID NO.1.

[0030] Specifically as follows:

[0031] ATGGAAGATCATGGCGGCCAAGAAGATGCTGGTGGTAGTAGAGAGAGAAACAACGAGGGAGTTAGATCAAGGTGGACTCCCAAACCAGAGCAAATCCTCATACTGGAATCAATCTTCAACAGTGGGATGGTAAATCCCCCGAAAGATGAAACGGTGAGGATCAGAAAACTACTGGAGAAATTCGGTTCAGTCGGGGACGCAAATGTCTTTTACTGGTTCCAGAACCGGAGGTCCCGGTCCCGCCGCCGGCAGCGCCAGCAGATTCATGAGGCGGCGGCCACCACCACCAGCCATGCCACGGCCACCCAACAACAACAACAGCAGCATGGTTATTATCAGACCACCAACGAAAGCGGTGGCGGTGGTAGTGGTGGTGGTGGTGCAATTCATCAGTATGAGATGAGTGGTTCTTCTTCTTCCTCGGGCGGCGGTGGTGGCGGTGGTGATTTTGTGAATGAGCATCTCTGCTCTTTTTCGGGTGAAATTGGTTTTCCAGGGTACTTCAGTGAGCAGATTTCCTCCTCCCCTTCAGTTTCGGCCCCGTTAGATACTTCTTCAACTTCTTTGCCATACCAATCTCCAGGATTTATAACGGTGTTCATAAATGGGGTGTCAACAGAAGTAGGGAGGGGCCCGATAGACATGAAAGGAACGTTTGGTGAAGATTTGGTGTTAGTCCACTCTTCTGGAATGCCAGTTGTCCCTTTCAACGACTTCGGCTTTTCCCTTCACACTTTGCACCATGGAGAGAGCTATTTCCTGGTTCCAAGGCCTGGTTAA

[0032] The expressed protein of gene RhWOX11 has an amino acid sequence as shown in SEQ ID NO.2.

[0033] Specifically as follows:

[0034] MEDHGGQEDAGGSRERNNEGVRSRWTPKPEQILILESIFNSGMVNPPKDETVRIRKLLEKFGSVGDANVFYWFQNRRSRSRRRQRQQIHEAAATTTSHATATQQQQQQHGYYQTTNESGGGGSGGGGAIHQYEMSGSSSSSGGGGGGGDFVNEHLCSFSGEIGFPGYFSEQISSSPSVSAPLDTSSTSLPYQSPGFITVFINGVSTEVGRGPIDMKGTFGEDLVLVHSSGMPVVPFNDFGFSLHTLHHGESYFLVPRPG*

[0035] Application of a gene RhWOX11 promoting the division of Rhododendron callus in accelerating the division and development of callus, and the specific application is as follows:

[0036] 1) Construct a vector of the key gene RhWOX11 for Rhododendron callus division; as Figure 3 shown

[0037] 2) Transform the constructed vector of the key gene RhWOX11 for Rhododendron callus division into plant cells;

[0038] 3) Cultivate and screen to obtain transgenic callus with faster growth and division compared to untreated materials.

[0039] The vector is a plant expression vector.

[0040] In step 2), the plant cells are plant leaf cells, and the vector transformation method is the Agrobacterium-mediated method.

[0041] The plant is tobacco.

[0042] In the present invention, the total RNA extraction of Rhododendron callus is involved, and the specific steps are as follows: Using the callus induced from Rhododendron leaves as the experimental material, extract RNA, reverse transcribe cDNA, design corresponding primers for PCR, after agarose gel electrophoresis, recover the target band. Connect with pMD19-T as the vector, transfer into Agrobacterium, sequence and analyze.

[0043] Total RNA extraction: Using the callus induced from Rhododendron leaves as the experimental material, extract RNA according to the operation steps of the finished kit. The 1% agarose gel electrophoresis result of the total RNA of the callus induced from Rhododendron leaves is as Figure 1 shown

[0044] cDNA acquisition: Using the Invitrogen cDNA kit, reverse transcribe the obtained RNA as the template to obtain cDNA.

[0045] Homologous cloning of the target gene: degenerate primers were designed using oligo, gradient PCR was performed to obtain the target product, which was then transformed and sequenced, and finally alignment analysis was carried out.

[0046] Among them, the amplification primer sequences are:

[0047] ·RD024593-f: ATGGAAGATCATGGCGGCCAAG

[0048] ·RD024593-r: TTAACCAGGCCTTGGAACCAGG

[0049] PCR reaction conditions: 94°C, 4 min, 94°C, 30 s, 54°C, 30 s, 72°C, 45 s, 36 Cycles, 72°C, 10 min; hold at 4°C. Take the PCR product, the result of 1% agarose gel electrophoresis, and recover the target band.

[0050] In the present invention Figure 1 — Figure 4 Obtaining of the RhWOX11 gene and performing functional verification in tobacco;

[0051] As Figure 1 , it is the 1% agarose gel electrophoresis map of the full-length PCR product of the RhWOX11 gene; in the figure, a, b: the full length of the RhWOX11 gene obtained by PCR using cDNA as a template; M: 2000bp Marker;

[0052] DNA molecular weight standard M: 2000bp Marker, used to estimate the size of DNA fragments in the sample.

[0053] Lanes a and b show the full length of the RhWOX11 gene obtained by PCR using cDNA as a template. It can be seen that there are obvious DNA bands in lanes a and b.

[0054] Figure 2 is the 1% agarose gel electrophoresis map of the single colony PCR of Agrobacterium tumefaciens pBI121WOX; in the figure, a f: Agrobacterium tumefaciens transformed with the RhWOX11 gene; g: ddH2O; M: 2000bp Marker;

[0055] Among them, the primers for detecting Agrobacterium tumefaciens transformed colonies are:

[0056] RD024593-f: ATGGAAGATCATGGCGGCCAAG

[0057] NOS-r: accggcaacaggattcaatc

[0058] After introducing the RhWOX11 gene into Agrobacterium by genetic engineering methods, through single colony PCR and electrophoresis detection, as Figure 2 shown, it can be confirmed that Agrobacterium has successfully carried the RhWOX11 gene.

[0059] Figure 4 In [relevant context], it is used to detect the DNA of overexpressed transgenic positive seedlings. Specifically, it is to detect whether the RhWOX11 gene has been successfully transferred into tobacco plants.

[0060] 1 - 20: DNA of tobacco plants transformed with RhWOX11 gene;

[0061] H2O: ddH2O, used for negative control;

[0062] P: Plasmid DNA, used for positive control;

[0063] M: Used to determine the size of DNA fragments;

[0064] Figure 4 In [relevant context], detection of DNA of overexpressed transgenic positive seedlings

[0065] M = D2000, P = plasmid control

[0066] Detection primers:

[0067] RD024593 - f: ATGGAAGATCATGGCGGCCAAG

[0068] NOS - r: accggcaacaggattcaatc

[0069] Among them, Marker (M): Used to determine the size of DNA fragments. Figure 4 In [relevant context], M: 2000bp Marker, which can be used to judge the size of DNA fragments in other samples.

[0070] Positive control (P): Plasmid DNA shows the expected bands, indicating the effectiveness of the primers and detection methods.

[0071] Negative control (H2O): Deionized water has no bands, indicating no contamination.

[0072] Tobacco plants transformed with RhWOX11 gene (1 - 20): Bands appear in samples 1, 2, 3, 4, 5, 6, 7, 8, 9, 13, 15, 16, 17, 18, 19, 20, proving that the RhWOX11 gene has been successfully transferred into tobacco plants. Bands do not appear in samples 11, 12, 14, indicating that the RhWOX11 gene has not been successfully transferred into tobacco plants.

[0073] As Figure 5, indicating the comparison of the growth and phenotypic differences between wild-type (WT) and transgenic (RhWOX11) tobacco leaves under specific conditions. It can be seen that overexpression of RhWOX11 increases the callus division efficiency induced by tobacco, among which Figure 5 The left side is the record of 18 days of culture, and the right side is the record of 23 days of culture. On the left side of the blue line in the figure is the transgenic (RhWOX11) tobacco leaf, and on the right side is the wild-type (WT). It is not difficult to see that the incidence of callus division in the tobacco leaves treated with transgenic (RhWOX11) is significantly higher than that of the untreated wild-type (WT) tobacco leaves on the right side. Moreover, the synchronization rate of the tobacco leaves treated with transgenic (RhWOX11) is higher, and the growth and division of callus are more orderly. It can be applied to the rapid propagation of excellent plants, providing technical means support for the large-scale propagation of seedlings.

Claims

1. A gene promoting the division of callus cells of Rhododendron RhWOX11 , characterized in that: The gene RhWOX11 has a nucleic acid sequence as shown in SEQ ID NO.

1.

2. Use of the gene for promoting the division of callus cells of rhododendron according to claim 1 RhWOX11 in accelerating the growth and development of callus, characterized in that: The specific application is as follows: 1) Construct a vector containing the key gene for callus cell division in Rhododendron RhWOX11 gene; 2) Transform the vector of the key gene for the division of Rhododendron callus cells constructed RhWOX11 into plant cells; 3) Cultivate and screen transgenic callus cells with a faster growth rate compared to the untreated materials; In step 2), the plant cells are plant leaf cells, and the vector transformation method is the Agrobacterium-mediated method; The plant is tobacco.

3. The application according to claim 2, characterized in that: The vector is a plant expression vector.

Images