Use of pvals mutants in improving herbicide resistance of switchgrass

Abstract

This invention provides the application of the PvALS mutant in improving the herbicide resistance of switchgrass, relating to the field of genetic engineering technology. This invention establishes a single-base editing system for switchgrass by infecting callus tissue with Agrobacterium, providing a novel method for gene editing in switchgrass and laying the foundation for functional gene research and breeding work. The PvALS mutant plants obtained by this invention exhibit excellent herbicide resistance, providing a new herbicide-resistant resource for switchgrass, which can be widely planted as an energy crop in various environments.

Description

Technical Field

[0001] This application relates to the field of genetic engineering technology, and in particular to the application of PvALS mutants in improving the herbicide resistance of switchgrass. Background Technology

[0002] Renewable energy, especially energy crops, is a new hotspot in energy research. Switchgrass (Panicum virgatum) is a perennial, warm-season, tufted grass (C4) belonging to the genus Panicum in the family Gramineae, native to the North American prairie. Switchgrass has high biomass yield, strong adaptability, low requirements for water and nutrient input, and is environmentally friendly, making it an ideal energy crop.

[0003] However, there is currently limited research on single-base editing and herbicide resistance in switchgrass. Summary of the Invention

[0004] The technical problem this invention aims to solve is to provide the application of the PvALS mutant in improving the herbicide resistance of switchgrass. For the first time, a PvALS mutant and its encoding nucleic acid molecule were obtained by directed mutation of a specific PvALS site in switchgrass, revealing the herbicide resistance-related sites and beneficial mutation directions in switchgrass. This invention also provides a method for establishing a single-base editing system in switchgrass by infecting callus tissue with Agrobacterium. Using this method, switchgrass callus tissue can be efficiently transformed to obtain single-base-edited switchgrass plants.

[0005] On the one hand, this application provides the application of the PvALS mutant in improving the herbicide resistance of switchgrass, wherein the PvALS mutant is obtained by mutating the 163rd proline (Pro) residue of wild-type PvALS, and the amino acid sequence of wild-type PvALS includes the amino acid sequence shown in SEQ ID No.1 or having at least 98% identity with the sequence of SEQ ID No.1.

[0006] Furthermore, the mutation is a mutation of a proline (Pro, CCC) residue into a leucine (Leu, CTT) residue or a serine (Ser, TCC) residue.

[0007] Furthermore, the editing involves mutating the PvALS gene from CCC to CTT or TCC.

[0008] Further, the amino acid sequence of the PvALS mutant includes an amino acid sequence as shown in SEQ ID No. 3 or having at least 98% identity with the sequence of SEQ ID No. 3; preferably, the nucleotide sequence encoding the PvALS mutant includes a nucleotide sequence as shown in SEQ ID No. 4 or having at least 98% identity with the sequence of SEQ ID No. 4.

[0009] Further, the amino acid sequence of the PvALS mutant includes an amino acid sequence as shown in SEQ ID No. 5 or having at least 98% identity with the sequence of SEQ ID No. 5; preferably, the nucleotide sequence encoding the PvALS mutant includes a nucleotide sequence as shown in SEQ ID No. 6 or having at least 98% identity with the sequence of SEQ ID No. 6.

[0010] Furthermore, the herbicide is an acetolactate synthase inhibitor herbicide.

[0011] Furthermore, the acetolactate synthase inhibitor herbicides include one or more of the following: sulfonylurea herbicides, imidazolinone herbicides, triazole pyrimidine herbicides, pyrimidine oxy(thio)benzoic acid herbicides, and sulfonamide hydroxytriazolinone herbicides.

[0012] Further, the herbicide is bensulfuron-methyl herbicide; preferably, the concentration of the bensulfuron-methyl herbicide is 1-2000 mg / L; more preferably, 1000 mg / L.

[0013] On the other hand, this application also provides a nucleic acid molecule for improving the herbicide resistance of switchgrass, said nucleic acid molecule comprising a nucleotide sequence as shown in SEQ ID No. 4 or having at least 98% identity with the sequence of SEQ ID No. 4, or a nucleotide sequence as shown in SEQ ID No. 6 or having at least 98% identity with the sequence of SEQ ID No. 6.

[0014] On the other hand, this application also provides a method for single-base editing of switchgrass, the method comprising the following steps:

[0015] Step 1: Obtain the gene editing vector;

[0016] Step 2: Transfer the gene-editing vector into Agrobacterium to obtain Agrobacterium carrying the target gene;

[0017] Step 3: Infect switchgrass callus tissue with Agrobacterium carrying the target gene.

[0018] Furthermore, the gene editing vector includes sgRNA, which includes sequences as shown in SEQ ID No. 7 and / or SEQ ID No. 8.

[0019] On the other hand, this application also provides a single-base editing method for improving the herbicide resistance of switchgrass.

[0020] Preferably, the target gene is the PvALS mutant gene.

[0021] It is understood that those skilled in the art can select appropriate gene editing systems and gene editing methods to complete the mutation modification based on the actual situation.

[0022] In a preferred embodiment, the gene editing vector may be a PH-A3A-PBE vector.

[0023] In a preferred embodiment, the Agrobacterium may be Agrobacterium tumefaciens EHA105.

[0024] The present invention has the following beneficial effects:

[0025] 1. This application is the first to obtain PvALS mutants and nucleic acid molecules encoding PvALS mutants by targeted mutation of specific sites in switchgrass, revealing the sites related to herbicide resistance in switchgrass and the direction of beneficial mutations, providing a new theoretical basis for gene editing and breeding research related to herbicide resistance in switchgrass.

[0026] 2. The PvALS mutant plants obtained in this application have excellent herbicide resistance, providing a new herbicide-resistant germplasm for switchgrass, which can be widely planted as an energy crop in a variety of environments.

[0027] 3. This application establishes a genetic transformation single-base editing system for switchgrass by infecting callus tissue with Agrobacterium tumefaciens, providing a new method for switchgrass gene editing and laying the foundation for switchgrass gene research and breeding work. Attached Figure Description

[0028] The accompanying drawings, which are included to provide a further understanding of this application and form part of this application, illustrate exemplary embodiments and are used to explain this application, but do not constitute an undue limitation of this application. In the drawings:

[0029] Figure 1Phylogenetic analysis of ALS in Arabidopsis thaliana, Brassica napus, peanut, rice, apple, citrus, tomato, and switchgrass. Among them, Pavir.1NG249295 and Pavir.1KG292200 are switchgrass ALS, BnALS1 and BnALS3 are Brassica napus ALS, AtALS1 is Arabidopsis thaliana ALS, CsALS is citrus ALS, AhALS2A and AhALS2B are peanut ALS, MdALS is apple ALS, SlALS is tomato ALS, and OsALS1 is rice ALS.

[0030] Figure 2 This study compares the base sequences of ALS in Arabidopsis thaliana, rapeseed, peanut, rice, apple, citrus, tomato, and switchgrass. Among them, Pavir.1NG249295 and Pavir.1KG292200 are switchgrass ALS, BnALS1 and BnALS3 are rapeseed ALS, AtALS1 is Arabidopsis ALS, CsALS is citrus ALS, AhALS2A and AhALS2B are peanut ALS, MdALS is apple ALS, SlALS is tomato ALS, and OsALS1 is rice ALS.

[0031] Figure 3 A schematic diagram of a single-base editing vector;

[0032] Figure 4 Image showing a positive result for genetically modified switchgrass;

[0033] Figure 5 A statistical graph showing the efficiency and methods of single-base editing in PvALS for switchgrass;

[0034] Figure 6 Figures showing the PCR stock solution and single-clone sequencing results for PvALS single-base editing of switchgrass;

[0035] Figure 7 The image shows the phenotypic results of switchgrass resistant to bensulfuron-methyl after PvALS editing. The right image is a magnified view of the treatment in the left image. From left to right in the left image, the diagrams are: ctrl_1, ctrl_2, ctrl_3, PvALS_12, PvALS_27, and PvALS_40. Specifically, ctrl_1 is the wild-type control group 1, ctrl_2 is the wild-type control group 2, ctrl_3 is the wild-type control group 3, PvALS_12 is the P163S experimental group, PvALS_27 is the P163L experimental group 1, and PvALS_40 is the P163L experimental group 2. Detailed Implementation

[0036] Technical terms:

[0037] Identity: refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or the amino acid sequences of two protein molecules in molecular evolution studies.

[0038] To more clearly illustrate the overall concept of this application, a detailed description is provided below with reference to the accompanying drawings and embodiments. Numerous specific details are set forth in the following description to provide a more thorough understanding of the invention. However, it will be apparent to those skilled in the art that the invention can be practiced without one or more of these details. In other instances, certain technical features well-known in the art have not been described to avoid confusion with the invention.

[0039] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0040] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0041] Unless otherwise specified, all reagents or instruments used in the following embodiments, unless otherwise indicated by the manufacturer, are commercially available products. The plasmids, restriction enzymes, PCR enzymes, column-based DNA extraction kits, and DNA gel recovery kits used in the following examples are commercially available products, and the specific operations were performed according to the kit instructions.

[0042] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention. Test methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the respective manufacturers.

[0043] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0044] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in the fields of botany, microbiology, biochemistry, analytical chemistry, cell culture, and related fields. Specifically, they can be performed according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0045] The switchgrass materials used in this patent are all derived from the embryogenic callus line of the lowland switchgrass variety Alamo established in our laboratory. This callus line originates from the same seed and has a single genotype.

[0046] In addition, the "water" mentioned in this invention includes any feasible water that can be used in the art, such as deionized water, distilled water, ion-exchanged water, double-distilled water, high-purity water, and purified water.

[0047] In this specification, the amino acids at the corresponding sites are represented by the recognized IUPAC single-letter abbreviations, where each amino acid and its abbreviation are as follows: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

[0048] In this specification, mutations in amino acids are indicated by "original amino acid, site, substituted amino acid". For example, the mutation of proline P at site 163 to serine S is represented as P163S.

[0049] In the following examples, unless otherwise specified, % means wt%, i.e., weight percentage.

[0050] The biosynthesis of branched-chain amino acids (valine, leucine, and isoleucine) in plants and microorganisms requires the catalytic action of four enzymes: acetolactate synthase (ALS), ketol reductase, dihydroxy acid dehydratase, and branched-chain amino acid transaminase. Among these, acetolactate synthase (ALS) is the key enzyme in the first stage of biosynthesis. ALS inhibitor herbicides work by inhibiting ALS enzyme activity in plants, thereby preventing the synthesis of branched-chain amino acids. This disrupts protein synthesis, preventing cell mitosis, ultimately causing plant cessation of growth and death. ALS-related genes have been identified in various plants, such as... Figure 1 and Figure 2 As shown. However, due to species differences, the ALS sequence is not entirely identical across species, and the efficiency and success rate of single-base editing at the same ALS site are impossible to estimate across different species. Even with the same ALS163 site, some species can perform single-base editing while others cannot. Furthermore, due to significant differences in the regulatory networks of each organism, the functions and effects also vary across species. Currently, there are no studies on genes related to herbicide resistance in switchgrass.

[0051] 1. Target gene cloning

[0052] 1.1 DNA extraction from switchgrass

[0053] a. Take fresh switchgrass leaves, cut them into small pieces, place them in a 2mL centrifuge tube, add 1mL of 2×CTAB extract, add 3-4 steel balls, crush them with a grinder and mix thoroughly, incubate in a 65℃ water bath for 15min, during which time reverse the centrifuge tube 2-3 times, and cool to room temperature after the water bath.

[0054] b. Add 200 μL of chloroform, shake vigorously and invert 7-8 times to mix thoroughly, and centrifuge at 12000 rpm for 10 min.

[0055] c. Gently aspirate the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol to the supernatant, invert the tube 5-8 times to mix, precipitate at -20℃ for 20 min, and then centrifuge at 12000 rpm for 10 min.

[0056] d. Discard the supernatant, add 1 mL of 70% ethanol to wash the precipitate, and centrifuge at 12000 rpm for 5 min.

[0057] e. Repeat step d above, and use a pipette to remove the supernatant solution.

[0058] f. Use a clean bench with circulating air to dry DNA deposits.

[0059] i. Add 30-50 μL of deionized water to dissolve the DNA, and use an ultra-micrometer to determine the DNA concentration to obtain total DNA from switchgrass.

[0060] 1.2 RNA extraction from switchgrass

[0061] In this embodiment, RNA was extracted from switchgrass leaves for gene amplification. The specific extraction steps are as follows (the entire extraction process strictly adheres to RNAase-free requirements):

[0062] a. Preparation: Sterilize the mortar with alcohol, and pre-cool the centrifuge tubes, tweezers, and scissors in liquid nitrogen.

[0063] b. Sampling: Select fresh, tender, and clean willow switchgrass leaves, cut them off with scissors and tweezers, wrap them tightly with aluminum foil, and quickly freeze them in liquid nitrogen for later use.

[0064] c. Grinding: Add liquid nitrogen to the mortar and grind the leaves into powder quickly.

[0065] d. Take an appropriate amount of powder and put it into a 1.5 mL centrifuge tube. Add 1 mL of trizol extract, mix and shake well, and let stand at room temperature for 5 min.

[0066] e. Add 200 μL of chloroform, invert and shake vigorously for 15 seconds, centrifuge at 12000 r / min for 15 minutes at 4℃.

[0067] f. Transfer the supernatant to a new centrifuge tube and repeat step e above.

[0068] g. Transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol (pre-cooled), and precipitate at -20°C for 20 min.

[0069] Centrifuge at 12000 r / min at 4℃ for 10 min, then discard the supernatant and retain the precipitate.

[0070] j. Add 1 mL of 70% ethanol to wash the precipitate, centrifuge at 7500 r / min at 4°C for 5 min and discard the supernatant.

[0071] g. Repeat step j above.

[0072] k. Centrifuge in an empty tube at 4℃ for 12000 r / min for 2 min.

[0073] 1. Use the circulating air in the clean bench to dry the RNA precipitate.

[0074] m. Add 20 μL of RNAase-free water to dissolve the RNA, pipette and mix well to obtain total RNA from switchgrass.

[0075] 1.3 RNA reverse transcription

[0076] Total RNA from switchgrass was reverse transcribed into cDNA using the ThransScipt One-Step RT-PCR SuperMix Reverse Transcription Kit, which was purchased from TransGen Biotech. The reaction system is shown in Table 1 below (the entire extraction process strictly adhered to RNAase-free requirements).

[0077] Table 1

[0078]

[0079] The above reaction reagents were added to the PCR tubes according to the corresponding reaction amounts and mixed thoroughly. The reaction was carried out at 42℃ for 30 min and then at 85℃ for 5 s. The temperature was controlled by a PCR instrument, and the reaction products were stored at -80℃ to obtain total cDNA from switchgrass.

[0080] 1.4 PCR amplification

[0081] To accurately obtain the PvALS gene sequence of switchgrass, this embodiment uses the aforementioned switchgrass total DNA and cDNA as templates for amplification. The primer sequences involved are shown in Table 2, the amplification reaction system in Table 3, and the amplification procedure in Table 4.

[0082] Table 2 Primers involved in PCR amplification

[0083]

[0084] Table 3 PCR reaction system

[0085]

[0086] Table 4 PCR reaction procedures:

[0087]

[0088] 1.5PvALS gene target fragment recovery

[0089] The PCR products were detected by electrophoresis on a 1% agarose gel at 130V for 20 min. After electrophoresis, the gel was recovered to obtain the full-length fragment of the PvALS gene. The specific procedure was as follows: Under UV light, a bright, single full-length DNA / cDNA band of the switchgrass PvALS gene was rapidly excised from the agarose gel. The amplified product was recovered using the Novizan Gel DNA Extraction Mini Kit. The specific steps are as follows:

[0090] a. Place the cut gel containing the full-length DNA / cDNA fragment of the switchgrass PvALS gene into a 2mL centrifuge tube, weigh the gel (remove the weight of the empty tube), and add an equal volume of Buffer GDP sol (0.10g gel to 300μL sol).

[0091] b. Dissolve the gel in a 56℃ water bath for 5-10 minutes, inverting and mixing twice during the water bath to accelerate dissolution.

[0092] c. Briefly centrifuge to collect the droplets on the tube wall, place the adsorption column into the collection tube, transfer the sol solution into the adsorption column, centrifuge at 12000 rpm for 1 min, discard the filtrate and reuse the collection tube.

[0093] d. Repeat step c until all the sol solution is transferred to the adsorption column.

[0094] e. Add 700 μL of Buffer GW to the adsorption column. Centrifuge at 12000 rpm for 1 min, discard the filtrate, and reuse the collection tube.

[0095] f. Repeat step e.

[0096] Centrifuge at 12000 rpm for 2 min to dry the adsorption column.

[0097] h. Discard the collection tube, place the adsorption column on the clean bench and blow it for 2 minutes, then insert the adsorption column into a new 1.5 mL centrifuge tube.

[0098] i. Add 30 μL of preheated ddH2O accurately to the center of the adsorption column membrane, incubate at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, and elute the DNA.

[0099] j. Measure the gel recovery concentration using an ultra-micro spectrophotometer and store at -20℃.

[0100] Connect the Spark Zero Background Ptopo-Blunt Simple cloning Kit and construct the system as shown in Table 5. The reaction procedure includes: using a PCR instrument to control the temperature, reacting at 37℃ for 5 min, and then transforming E. coli.

[0101] Table 5

[0102]

[0103]

[0104] 1.6 Transformation of Escherichia coli

[0105] The specific steps for transfecting the above ligation product (full-length PvALS gene fragment) into E. coli are as follows:

[0106] 1) Take a tube of DH5α competent cells out of the -80℃ freezer and immediately place it on ice to thaw.

[0107] 2) After slight dissolution, add the above ligation product to E. coli, gently mix with a pipette, and place in an ice box for 30 minutes.

[0108] 3) Place in a 42℃ water bath for 1 minute and 30 seconds, then return to the ice box and place in an ice bath for 2 minutes.

[0109] 4) Add 400-600 μL of empty LB culture medium to the tube in a clean bench, and then incubate at 37°C on a shaker at 200 r / min for 40-60 min.

[0110] 5) Take out the bacterial culture, and when the bacteria become obviously turbid, centrifuge at 12000 rpm for 1 min. In a clean bench, discard the excess supernatant, keep 100 μL of supernatant and mix it thoroughly with the precipitate by pipetting. Then spread it on an LB agar plate containing carbenicillin antibiotic, invert the plate, and incubate at 37°C overnight for about 12-16 h. When single colonies grow on the plate, remove it from the incubator and send it for sequencing.

[0111] The sequenced PvALS sequence was compared and confirmed with the PvALS sequence (NC_053136) in the switchgrass genome. Based on the confirmed PvALS sequence, single-base editing target sites were selected and vectors were constructed.

[0112] 2. Construction of single-base editing vectors for switchgrass

[0113] In this embodiment, a single-base editing vector for switchgrass was constructed based on the reference "Efficient C-to-T base editing in plants using afusion of nCas9 and human APOBEC3A".

[0114] 2.1 The PH-A3A-PBE vector was selected as the backbone, and the PH-A3A-PBE vector was digested with Hind III restriction endonuclease, named PH-A3A-PBE / hindIII.

[0115] The enzyme digestion system is shown in Table 6 below.

[0116] Table 6

[0117]

[0118]

[0119] After 1 hour at 37°C, the PCR products were detected by electrophoresis on a 1% agarose gel at 130V for 20 minutes. After electrophoresis, the gel was recovered. The specific procedure is as follows: Under UV light, the bright, single target band was quickly cut from the agarose gel, and the amplified product was recovered using the Novizan Gel DNA Extraction Mini Kit, following the same steps as in 1.5.

[0120] 2.2 Using PH-A3A-PBE as a template, the product was amplified with primers OsU3-HindIII-F and OsU3-target-R. The reaction system is shown in Table 7, and the reaction procedure is shown in Table 8. Amplified product 1 was obtained.

[0121] OsU3-HindIII-F:acgacggccagtgccaagcttagtaattcatccaggtctc

[0122] OsU3-target-R:ATCATGCGGCGGGGCACCTGtgccacggatcatctgcacaa

[0123] Table 7. Amplification Products and PCR Reaction System

[0124]

[0125] Table 8. PCR reaction procedure for amplification products.

[0126]

[0127] 2.3 Using PH-A3A-PBE as a template, the product was amplified with primers Target-sgRNA-F and Target-sgRNA-R. The reaction system is shown in Table 9, and the reaction procedure is shown in Table 10. Amplified product 2 was obtained.

[0128] Target-sgRNA-F: ACAGGTGCCCCGCCGCATGATGTTTTAGAGCTAGAAATAGCAA(SEQIDNo.7)

[0129] Target-sgRNA-R: gcactgcaggcatgcaagcttagcagcaagcagtatcga (SEQ ID No. 8) Table 9 Amplification Products 2 PCR Reaction System

[0130]

[0131] Table 10. Amplification Products and PCR Reaction Procedure

[0132]

[0133] 2.4 Using amplification product 1 and amplification product 2 diluted 10-fold each as templates, an overlap extension PCR reaction was performed. OsU3-HindIII-F and Target-sgRNA-R were used as primers to amplify the fragment, yielding amplification product 3. The reaction system for amplification product 3 is shown in Table 11, and the reaction procedure is shown in Table 12.

[0134] Table 11 Amplification Products and PCR Reaction System

[0135]

[0136] Table 12 Amplification Products and PCR Reaction Procedure

[0137]

[0138] Amplification product 3 was recovered from the gel. The PCR product was detected by electrophoresis on a 1% agarose gel at 130V for 20 minutes. After electrophoresis, it was recovered from the gel. The specific procedure is as follows: Under UV light, a bright, single band was cut from the agarose gel, and the amplification product was recovered using the Novizan Gel DNA Extraction Mini Kit, following the same steps as in 1.5.

[0139] 2.5 The linearized vector PH-A3A-PE-Hind III obtained in 2.1 and the gel-recovered fragment obtained in 2.4 (i.e., amplification product 3) were infused together. The infusion reaction system is shown in Table 13. The infusion reaction procedure was as follows: reaction at 37℃ for 1 h. The transformation steps for E. coli were the same as in 1.6. When single colonies grew on the plate, it was taken out of the incubator and sent for sequencing. The sequencing results were compared to obtain the PvALS-A3A positive E. coli bacterial culture with the correct target site constructed on the single-base editing vector.

[0140] Table 13

[0141]

[0142] Plasmid extraction was performed using the above-mentioned PvALS-A3A positive Escherichia coli as a sample, and the steps are as follows:

[0143] Take 100 μL of the positive E. coli bacterial culture from the sequencing return sample and add it to 10 mL of LB liquid containing KAN antibiotic. Shake overnight until the bacterial culture becomes viscous. Extract the plasmid as follows:

[0144] 1) Pour the shaken bacterial culture into a centrifuge tube, centrifuge at 1000 rpm for 1 min, discard the supernatant, and invert the centrifuge tube onto filter paper to absorb excess liquid.

[0145] 2) Add 250 μL Buffer P1 to the centrifuge tube, and continuously aspirate with a pipette to resuspend the bacteria. Transfer the resuspended bacteria to a 1.5 mL centrifuge tube.

[0146] 3) Add 250 μL of Buffer P2 to a 1.5 mL centrifuge tube and mix by inverting the tube.

[0147] 4) Add 350 μL Buffer P3, quickly invert the mixture to mix, and centrifuge at 12000 rpm for 10 min.

[0148] 5) Place the adsorption column from the kit into the collection tube, and transfer the supernatant obtained from centrifugation into the adsorption column, ensuring no precipitate is aspirated. Centrifuge at 12000 rpm for 1 min, discard the filtrate, and reuse the collection tube.

[0149] 6) Add 600 μL of Buffer PW2 (dilute with anhydrous ethanol before use) to the adsorption column, centrifuge at 12000 rpm for 1 min, discard the filtrate and reuse the collection tube.

[0150] 7) Repeat step 5).

[0151] 8) Centrifuge at 12000 rpm for 2 min and dry the adsorption column.

[0152] 9) Discard the collection tube, place the adsorption column in a clean bench for 5 minutes, and then insert the adsorption column into a new 1.5mL centrifuge tube.

[0153] 10) Accurately add 65 μL of preheated ddH2O to the center of the adsorption column membrane, incubate at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, and elute the DNA.

[0154] 11) The concentration of the recovered plasmid was measured using an ultra-micro spectrophotometer and stored at -20℃.

[0155] In summary, we obtained a single-base editing vector for switchgrass, such as... Figure 3 As shown.

[0156] 3 Agrobacterium-mediated transformation

[0157] Freeze-thaw transformation of Agrobacterium tumefaciens competent cells: Thaw Agrobacterium tumefaciens EHA105 competent cells on ice. After thawing, add 3 μL of PvALS-A3A plasmid DNA, incubate on ice for 30 minutes, and then freeze in liquid nitrogen for 1 minute. Next, incubate at 37°C for 3 minutes, add 600 μL of antibiotic-free LB medium, and incubate at 28°C, 200 rpm with shaking for 3 hours. Centrifuge to concentrate the bacterial culture, rehydrate the cells with 100 μL of LB medium, and then plate the rehydrated cells onto a plate containing 50 mg·L⁻¹ of LB medium. -1 Kanamycin plus 25 mg / L -1On rifampicin solid LB medium, the culture was inverted at 28°C. After single colonies grew, they were picked for PCR identification. Positive bacteria were selected and cultured by shaking (LB + 50 mg / L). -1 Kan+25mg·L -1 Rif, 28℃, 200rpm, when Agrobacterium OD 600 When the concentration reaches 0.6-0.8, 1 mL of bacterial culture is added to 1 mL of 50% sterile glycerol, and the mixture is rapidly frozen in liquid nitrogen and stored at -80°C. It is then used for switchgrass transformation.

[0158] Genetic transformation of switchgrass mainly utilizes PvALS-A3A-positive Agrobacterium tumefaciens EHA105 to infect switchgrass embryonic callus. The specific process is as follows:

[0159] (1) Callus induction and propagation of switchgrass

[0160] Callus was induced using young spikelets of wild-type switchgrass plants. The young spikelets were cut and disinfected. First, the surface of the spikelets was wiped with paper towels moistened with 75% ethanol to remove bacteria. Then, the spikelets were immersed in 75% ethanol for 30 minutes in a laminar flow hood, shaking 5-10 times every 10 minutes. After that, they were placed on sterile filter paper to air dry. Finally, the spikelets were cut with a sterile blade and stored in MS + 30 g·L⁻¹. -1 Sucrose + 5 mg·L -1 2,4-D + 0.15 mg·L -1 6-BA+Agar 7.6-7.8g L -1 Callus induction and subculture were performed on a medium with a pH of 5.8-6.0, and the resulting callus line was named K1.

[0161] (2) Agrobacterium infection of embryonic callus of *Salix tabulaezei*

[0162] 1) Take 100 μL of the carrier bacterial culture containing PvALS-A3A stored at -80℃ and add 50 mg·L⁻¹ -1 Kanamycin plus 25 mg / L -1 In LB liquid medium containing rifampicin, incubate overnight at 28°C and 200 rpm with shaking.

[0163] 2) When OD 600 When the concentration is 0.4-0.6, add AS to a final concentration of 100 μM;

[0164] 3) Continue incubation at 28℃ and 200 rpm with shaking until OD reaches its maximum. 600 When the concentration is 0.6-0.8, it is used to prepare callus infection solution (MS + 30 g·L⁻¹). -1 Sucrose + 3 mg·L -1 2,4-D + 0.15 mg·L -16-BA (pH 5.8-6.0);

[0165] 4) Transfer the bacterial culture to a 50mL sterile centrifuge tube and centrifuge at 20℃ and 3500rpm for 15min.

[0166] 5) Discard the supernatant, resuspend the precipitate in 40 mL of infection solution, transfer the resuspended solution to a 200 mL tissue culture flask, and then dilute with infection solution to achieve a final OD concentration of the bacterial culture. 600 The concentration was 0.3-0.4, and AS was finally added to a final concentration of 100 μM.

[0167] 6) Take 50-80 pieces of callus and put them into the diluted Agrobacterium resuspension, then gently shake to mix.

[0168] 7) Vacuum for 10 minutes, ultrasonication at 28℃ for 5 minutes, vacuum for 10 minutes;

[0169] 8) Pour out the bacterial solution and place the callus on sterile filter paper to stand for 30 minutes;

[0170] 9) After the wound has dried, transfer it to a new sterile filter paper culture dish;

[0171] 10) Incubate in the dark for 3 days at a temperature of 23℃-25℃;

[0172] 11) Transfer the callus to selection medium (MS + 30 g·L⁻¹). -1 Sucrose + 3 mg·L -1 2,4-D + 0.15 mg·L -1 6-BA + 300mg L -1 Tim+30mg·L -1 Hyg+7.6-7.8g L -1 Agar (pH 5.8-6.0), cultured for 3-4 weeks;

[0173] 12) Transfer the resistant callus to differentiation medium (MS + 30 g·L⁻¹). -1 Sucrose + 0.5 mg / L -1

[0174] 6-BA + 2 mg·L -1 KT+300mg·L -1 Tim+30mg·L -1 Hyg+Agar 7.6-7.8g, pH 5.8-6.0), replace with fresh differentiation medium every three weeks until seedlings emerge;

[0175] 13) Transfer the seedlings to rooting medium MS + 400 mg / L Tim + 15 g / L -1 sucrose + 7g·L -1Agar, pH 5.95, until roots emerge, approximately four weeks later.

[0176] 4. PCR identification of transgenic positive seedlings

[0177] 1) DNA was extracted from transgenic regenerated switchgrass plants using the 2×CTAB method;

[0178] 2) Take fresh leaves from transgenic regenerated switchgrass plants, cut them into small pieces, place them in a 2mL centrifuge tube, add 1mL of 2×CTAB extraction solution, add 3-4 steel balls, crush them with a grinder and mix thoroughly, incubate in a 65℃ water bath for 15min, during which time the centrifuge tube is reversed 2-3 times, and after the water bath, cool to room temperature.

[0179] 3) Add 200 μL of chloroform, shake vigorously and invert 7-8 times to mix thoroughly, and centrifuge at 12000 rpm for 10 min.

[0180] 4) Gently aspirate the supernatant into a new 1.5mL centrifuge tube, being careful not to aspirate the precipitate. Add an equal volume of isopropanol to the supernatant, invert the tube 5-8 times to mix, precipitate at -20℃ for 20 minutes, and then centrifuge at 12000rpm for 10 minutes.

[0181] 5) Discard the supernatant, add 1 mL of 70% ethanol to wash the precipitate, and centrifuge at 12000 rpm for 5 min.

[0182] 6) Repeat step 5) above, and use a pipette to remove the supernatant solution.

[0183] 7) Circulate the air in the clean bench to dry the DNA precipitate. When the precipitate changes from white to transparent and there is no liquid on the tube wall, you can proceed to the next step.

[0184] 8) Add 30-50 μL of deionized water to dissolve the DNA, measure the DNA concentration using an ultra-micrometer, and mark the concentration and time on the tube wall.

[0185] PCR reaction: Qingdao Qingke Zixi Biotechnology Co., Ltd. synthesized PCR primers for the HYG gene: HYG-F: 5'-AAGGAATCGGTCAATACACTACATGG-3', HYG-R: 5'-AAGACCAATGCGGAGCATATACG-3'. The HYG gene was amplified by PCR. The reaction system is shown in Table 14, and the reaction procedure is shown in Table 15.

[0186] Table 14 PCR Reaction System

[0187]

[0188] Table 15 PCR reaction procedure

[0189]

[0190] Take 7 μL of PCR amplification product of HYG gene from each sample, perform agarose gel electrophoresis (1.0%) and take a picture. 4 μL of 2000bp LadderMaker was used as the molecular weight standard when spotting the sample.

[0191] Gel imaging of regenerated plants revealed that the PCR products of the HYG and Cas9 genes were both approximately 500 bp in size. Figure 4 The results were as expected. A total of 94 plants were tested, of which 82 were positive for hygromycin and 64 were positive for Cas9.

[0192] Positive DNA was amplified by PCR. The detection primers were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd., namely, ALS163-F: CGCGACGTCTTCGCCTACCC, ALS163-R: CGGCCATCTGCTGCTGGATG.

[0193] The reaction system is shown in Table 16, and the reaction procedure is shown in Table 17.

[0194] Table 16 PCR Reaction System

[0195]

[0196] Table 17 PCR Reaction Procedure

[0197]

[0198] The amplified PCR products were sent for sequencing, and the types and methods of editing were statistically analyzed as follows: Figure 5 The positive conversion rate reached 88.8%. In positive switchgrass, substitution occurred in 55.6%, but insertion and deletion byproducts were also present. Specific single-base editing methods are as follows... Figure 6 The results show that single clones with bimodal peaks near the target site (P163C, P163F, P163L, and P163S mutations obtained from the PvALS sequence in this editing) were returned to the T vector and ligated.

[0199] The sequencing samples were reconnected to the SparkZero Background Ptopo-Blunt Simple Cloning Kit, and the reaction system is shown in Table 18.

[0200] Table 18 PCR Reaction System

[0201]

[0202] Reaction procedure: The temperature was controlled using a PCR instrument. After reacting at 37℃ for 5 min, E. coli was transformed. The transformation steps were the same as in 1.6. Based on the known PvALS sequence, a total of P163C, P163F, P163L, and P163S single-base edited effective plants were obtained through sequence alignment.

[0203] 5 Herbicide Resistance Experiment

[0204] The obtained switchgrass mutants with effective editing at the PvALS163 position were subjected to a bensulfuron-methyl herbicide application experiment. The specific experimental method is as follows:

[0205] Benzyl sulfide at concentrations of 0, 500, 1000, and 2000 mg / L was applied to the middle part of the leaves of switchgrass mutants with uniform growth and development, with unedited switchgrass plants (i.e., wild-type switchgrass) serving as controls.

[0206] The optimal concentration of bensulfuron-methyl was determined to be 1000 mg / L. At this concentration, unedited switchgrass plants treated with bensulfuron-methyl all wilted and died, while plants with effective single-base editing (P163L and P163S) continued to grow normally after treatment with bensulfuron-methyl. Specific experimental results are as follows: Figure 6 As shown in the figure. The final results showed that at a treatment concentration of 1000 mg / L bensulfuron-methyl, the switchgrass plants P163L and P163S, which were effectively edited by PvALS163, showed significantly higher resistance to bensulfuron-methyl herbicide than the wild type.

[0207] The above description is merely an embodiment of this application and is not intended to limit the scope of this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the scope of the claims of this application.

Claims

1. The application of the PvALS mutant in improving the herbicide resistance of switchgrass, characterized in that, The amino acid sequence of the PvALS mutant is shown in SEQ ID No. 3 or SEQ ID No. 5, and the herbicide is bensulfuron-methyl herbicide.

2. The application according to claim 1, characterized in that, The nucleotide sequence encoding the PvALS mutant is shown in SEQ ID No.

4.

3. The application according to claim 1, characterized in that, The nucleotide sequence encoding the PvALS mutant is shown in SEQ ID No.

6.

4. The application according to claim 1, characterized in that, The concentration of the bensulfuron-methyl herbicide is 1-2000 mg / L.

5. The application according to claim 4, characterized in that, The concentration of the bensulfuron-methyl herbicide is 1000 mg / L.

6. A nucleic acid molecule for enhancing the herbicide resistance of switchgrass, characterized in that, The nucleic acid molecule is shown as SEQ ID No. 4 or as SEQ ID No. 6.

Images