A method for creating watermelon male sterile germplasm by gene editing ClMS1L1

The ClMS1L1 gene of watermelon was edited through CRISPR/Cas9 technology, which solved the problem of unsolved watermelon male sterility regulation mechanism, and achieved efficient production of watermelon hybrid seeds, reducing costs and improving purity.

CN119570840BActive Publication Date: 2025-06-13NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411775242.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-05
Publication Date
2025-06-13
Estimated Expiration
2044-12-05

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively solve the regulatory mechanism of watermelon male sterility, resulting in high cost of watermelon hybrid seed production and difficult to guarantee purity.

Method used

The ClMS1L1 gene in watermelon was gene edited through CRISPR/Cas9 technology, and the target was designed on the third exon, and a dual-target knockout vector was constructed to achieve the creation of male sterility in watermelon.

Benefits of technology

The successful creation of the watermelon germplasm with a male sterile phenotype in the recessive nucleus reduced the cost of hybrid seed production, improved the seed production efficiency, and did not affect the phenotype of other tissues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570840B_ABST
    Figure CN119570840B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for creating watermelon male sterile germplasm by gene editing ClMS1L1, belonging to the technical field of plant genetic engineering. The method for creating watermelon male sterile germplasm by gene editing ClMS1L1 disclosed by the present invention performs gene editing on watermelon ClMSL1 through the CRISPR / Cas9 gene editing technology, causing the loss of function of this gene, thereby generating a phenotype of recessive genic male sterility. Compared with normal materials, the watermelon male sterile line created by the method of the present invention has no visible phenotypic changes in other tissues such as roots, stems, leaves, tendrils, female flowers, fruits, seeds, growth vigor, etc., except for the change in male flower fertility. If the newly created male sterile germplasm is used for hybrid seed production, it will greatly reduce the labor cost and improve the seed production efficiency, having important potential for production application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and more specifically, to a method for creating watermelon male sterile germplasm by gene editing ClMS1L1. Background Art

[0002] Watermelon (Citrullus lanatus), a crop of the genus Citrullus in the family Cucurbitaceae, accounts for 7% of the world's vegetable crop planting area, and the global annual output exceeds 100 million tons. According to the statistics of the Food and Agriculture Organization of the United Nations (FAO), the watermelon output in China in 2019 was 60.8612 million tons, accounting for 60.61% of the global watermelon output. China is the largest watermelon producer and consumer in the world.

[0003] In production, watermelon has obvious heterosis. At present, in the traditional watermelon hybrid seed production process, manual emasculation and pollination are mainly used, resulting in high seed production costs and difficulty in ensuring the purity of seeds. At present, male sterile lines have been widely used in hybrid seed production of crops such as rice and rapeseed. Therefore, developing new male sterile lines in other crops has important application value.

[0004] Plant male sterility refers to the physiological phenomenon that flowering plants are unable to produce dehiscent anthers, functional pollen, or viable male gametes during development. Plant male sterile lines are not only important tools for studying the utilization of crop heterosis but also ideal materials for studying the function of plant flower development. At present, 7 watermelon male sterile mutants have been reported, including 6 recessive nuclear male steriles and 1 dominant male sterile mutant. The recessive nuclear male steriles are named as follows: glabrous male sterile mutant (gms), male sterile dwarf plant (ms-dw), male sterile line ms-1, ms-2, ms-3, male sterile dual-purpose line Se18, etc. The cloning and functional verification of the male sterility gene ClATM1 have been completed in the Se18 mutant material, and no relevant research has been carried out on the male sterility genes in other mutants, and the regulatory mechanism of watermelon male sterility has not been fully analyzed. The dominant male sterile mutant is named ClMS1. Further research found that the phenotype of this mutant is caused by a non-synonymous mutation in the ClHSP70 sequence, and the specific cytological and molecular mechanisms have not been revealed.

[0005] MS1 (MALE STERILE 1) is a member of the PHD-Finger protein family. Studies in Arabidopsis thaliana have shown that MS1 is a key gene for the development of anther tapetum and microspore maturation. In the ms1 mutant background, the early stage of pollen mother cell meiosis and the microspore release stage are normal, but the pollen wall formation is abnormal in the later stage, and the intine and exine depositions are incomplete, resulting in the complete degeneration of microspores, and then the anther locules cavitate, thus producing a male-sterile phenotype. The molecular mechanism of MS1 gene regulating tapetum development is limited to the model plant Arabidopsis thaliana and has not been reported in watermelon. It is of great significance to fully understand the molecular mechanism regulating male flower development, compare the functional conservation of MS1 in different species, and mutate ClMS1L1 (ClMS1Like1) in watermelon by combining gene editing technology.

[0006] Therefore, it is an urgent problem for those skilled in the art to provide a method for creating watermelon male-sterile germplasm by gene editing ClMS1L1. Summary of the Invention

[0007] In view of this, the present invention provides a method for creating watermelon male-sterile germplasm by gene editing ClMS1L1.

[0008] In order to achieve the above object, the present invention adopts the following technical scheme:

[0009] By homologous sequence alignment, the homologous gene ClMS1L1 of Arabidopsis thaliana MS1 gene in watermelon was found. Based on this gene, the present invention uses CRISPR / Cas9 technology to create watermelon male-sterile materials, and then applies them to the production process of watermelon hybrids, which will improve the seed production efficiency, the purity of hybrids, and reduce the production cost.

[0010] A method for creating watermelon male-sterile germplasm by gene editing ClMSL1, the specific steps are as follows:

[0011] (1) Design 2 target sites on the third exon of ClMS1L1 according to the genomic DNA sequence of ClMS1L1, named Target1 and Target2;

[0012] The genomic DNA sequence of ClMS1L1 is shown in SEQ ID NO.1;

[0013] The sequences of the target sites Target1 and Target2 are as follows:

[0014] Target1 sequence: 5’-GTTGAGCATGAAATGGAGG-3’; SEQ ID NO.2;

[0015] Target2 sequence: 5’-TATTTATATCGGCGATACA-3’; SEQ ID NO.3

[0016] (2) Construct a CRISPR / Cas9 double-target knockout vector;

[0017] ① Digest the CRISPR / Cas9 vector pBSE402 with the restriction endonuclease BsaI-HF, and recover the digested vector pBSE402;

[0018] ② Use the intermediate vector pCBC-DT1T2 as a template, and perform PCR amplification with primers Target1-F / Target2-R to recover the target fragment;

[0019] ③ Perform homologous recombination between the vector pBSE402 digested in step ① and the target fragment recovered in step ②, and transform the DH5α competent cells;

[0020] ④ Identify the colonies obtained in step ③, inoculate the colonies with correct band sizes, shake the bacteria, extract the recombinant plasmid for sequencing, and transform the correctly sequenced recombinant plasmid into the competent cells of Agrobacterium tumefaciens EHA105;

[0021] (3) Genetic transformation of watermelon;

[0022] Gene-edited plants are obtained through the stages of infection, co-culture, recovery culture, selection culture, bud elongation culture and rooting culture, and phenotypic observation is carried out.

[0023] Furthermore, the sequences of the primers Target1-F / Target2-R are as follows:

[0024] Target1-F:

[0025] 5’-TCGAAGTAGTGATTG GTTGAGCATGAAATGGAGG GTTTTAGAGC TAGAAATAGC-3’; SEQ IDNO.4;

[0026] Target2-R:

[0027] 5’-TTCTAGCTCTAAAAC TGTATCGCCGATATAAATA CAATCTCTTA GTCGA-3’; SEQ ID NO.5.

[0028] Furthermore, the application of the method for creating watermelon male sterile germplasm by gene editing ClMS1L1 in creating male sterile watermelons.

[0029] Furthermore, the application of the watermelon male sterile material created by the method in hybrid seed production.

[0030] The material selected for the genetic transformation of watermelon in the present invention is the wild variety 'YL'.

[0031] The present invention uses the CRISPR / Cas9 technology to create new germplasms of watermelon male sterility. By gene editing the ClMS1L1 gene, mutations are induced in this gene, resulting in the loss of protein function and the production of a sterile phenotype with pollenless male flowers. The application of the male sterile material created by the method of the present invention in production can reduce the production cost of watermelon hybrids and improve the seed production efficiency.

[0032] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses a method for creating watermelon male sterile germplasms by gene editing ClMS1L1. This method uses the CRISPR / Cas9 technology for the first time to gene edit the ClMS1L1 sequence, inducing mutations in this gene, thereby producing a recessive genic male sterile phenotype. Compared with normal materials, the male sterile lines created by the method of the present invention show no visible phenotypic changes in other tissues such as roots, stems, leaves, tendrils, female flowers, fruit size, and growth vigor, except for the change in male flower fertility. If the newly created male sterile germplasms are used for hybrid seed production, it will greatly reduce the labor cost and improve the seed production efficiency, showing important potential for production applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on the provided drawings without creative efforts.

[0034] Figure 1 The drawings are schematic diagrams of the gene structure and target positions of ClMS1L1 in the present invention;

[0035] The gene structure of ClMS1L1 includes 4 exons and 3 introns. Both Target1 and Target2 are designed on the third exon (marked by red arrows); the arrow direction is the target direction;

[0036] Figure 2 The drawings are the vector maps of pBSE402 in the present invention;

[0037] Figure 3 The drawings are the expression elements of the recombinant plasmid in the present invention;

[0038] Among them, U6-26p and U6-29p are promoters, U6-26t and U6-29t are terminators, and gRNA-Sc is the gRNA backbone, which is an element in the intermediate vector pCBC-DT1T2; Target1 and Target2 are target sites.

[0039] Figure 4 The accompanying drawings show the comparison results of YL(WT), clms1l1-1, and clms1l1-2 of the present invention at two target sites.

[0040] Among them, "-" indicates deletion; the target sequence of the Target and the PAM sequence (including the PAM complementary sequence) are respectively identified by an underline and bold letters.

[0041] Figure 5 The accompanying drawings show the observation of the pollen viability of clms1l1-1 of the present invention.

[0042] Among them, a: male flower of wild type WT; b: male flower of clms1l1-1; c: pollen viability of wild type WT; d: pollen viability of clms1l1-1. Detailed implementation manners

[0043] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

[0044] Example 1

[0045] Design of the editing sites of ClMS1L1 (Cla97C11G207480)

[0046] According to the genomic DNA sequence of ClMS1L1 (SEQ ID NO.1) and the online design website for target sites CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2), the target sites for gene editing were designed. A total of two sets of editing sites, Target1 (SEQ ID NO.2) and Target2 (SEQ ID NO.3), were designed. The schematic diagram of the ClMS1L1 gene structure is shown in Figure 1 . Both target sites Target1 and Target2 are designed in the third exon. Exons are represented by capital letters, and introns are represented by lowercase letters.

[0047] Genomic DNA sequence of watermelon ClMS1L1 (97103-YL sequence):

[0048] CCTCCATTTC ATGCTCAAC CTCAAATCCCCTCTCAACACACAACACAACTCCATGGAATACTCCCACAGCTTGGACGCATTCTTGCTCGAAACCTCTTGTCGATGGTCCCCAAAGCGTGTCGAGATGGCAGTTCGAGTCGTTGTTGAGGCATTGAAGCGAGCAGAGTTTCGATGGGTTTCAAGGCAGGAGGTCCGCGATGCAGCCCG TATTTATATCGGCGATACA

[0049] Target1 sequence: 5’-GTTGAGCATGAAATGGAGG-3’; SEQ ID NO.2;

[0050] Target2 sequence: 5’-TATTTATATCGGCGATACA-3’; SEQ ID NO.3.

[0051] Example 2 Construction of CRISPR / Cas9 Editing Vector

[0052] The CRISPR / Cas9 vector pBSE402 (vector map shown in Figure 2 ) was digested with the restriction endonuclease BsaI-HF (NEW ENGLAND BioLabs) for 2 h, and then the digested vector was recovered. Digestion system (20 μL): 10x CutSmart buffer 2 μL, pBSE402 (1 μg / μl) 2 μL, BsaI-HF 1 μL, ddH 2 O 15 μL.

[0053] Using the intermediate vector pCBC-DT1T2 as a template and Target1-F / Target2-R (containing Target1 and Target1 respectively) as primers, PCR amplification was performed using Vazyme P505 high-fidelity enzyme (Phanta Max Super-Fidelity DNA Polymerase).

[0054] The primer sequences of Target1-F / Target2-R are as follows:

[0055] Target1-F:

[0056] 5’-TCGAAGTAGTGATTG GTTGAGCATGAAATGGAGG GTTTTAGAGC TAGAAATAGC-3’; SEQ ID NO.4;

[0057] Target2-R:

[0058] 5’-TTCTAGCTCTAAAAC TGTATCGCCGATATAAATA CAATCTCTTA GTCGA-3’; SEQ ID NO.5.

[0059] Amplification system (50 μL): 25 μL of 2x PhantaMax Buffer, 1 μL of dNTP Mix (10 mM), 2 μL each of forward and reverse primers (10 μM), 1 μL of PhantaMax Super-Fidelity DNA Polymerase, 2 μL of template DNA, 17 μL of ddH 2 O. PCR reaction program: Pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, extension at 72 °C for 30 s, 35 cycles; final extension at 72 °C for 5 min. The target fragment was recovered by 1% agarose gel electrophoresis.

[0060] The digested pBSE402 vector and the recovered target fragment were ligated using the Vazyme C112 ClonExpress II One Step Cloning Kit homologous recombinase. Ligation reaction system (10 μL): 2 μL of linearized vector, 2 μL of target fragment, 2 μL of 5x CE II Buffer, 1 μL of Exnase II, 3 μL of ddH 2 O, reacted at 37 °C for 30 min, and transformed into DH5α competent cells.

[0061] Colony PCR detection of the transformed Escherichia coli was performed using the identification primers U626-F and U629-R. The primer sequences are as follows:

[0062] U626-F: 5’-TGTCCCAGGATTAGAATGATTAGGC-3’; SEQ ID NO.6;

[0063] U629-R: 5’-AGCCCTCTTCTTTCGATCCATCAAC-3’; SEQ ID NO.7.

[0064] After the correct size of the identification band was obtained, the bacteria were inoculated, shaken, and the recombinant plasmid was extracted (for the expression elements of the recombinant plasmid, see Figure 3 ). After sequencing, sequence alignment was performed, and the correctly sequenced recombinant plasmid was transformed into Agrobacterium tumefaciens EHA105 competent cells.

[0065] PCR detection of Agrobacterium tumefaciens was performed using the primers U626-F and U629-R.

[0066] Example 3 Watermelon genetic transformation

[0067] Sowing: Take 50 seeds of the laboratory watermelon germplasm material 'YL'. After soaking them in a water bath at 55°C for 30 min, remove the seed coats. In a laminar flow hood, disinfect the kernels with 75% alcohol for 1 min, soak them in 3% sodium hypochlorite for 15 min, and then wash them 5 times with sterile water. Spread the kernels evenly on the sowing medium (BM, breeding medium; H 2 O, Agar 6 g / L), and place them in the dark at 28°C for about 40 h.

[0068] Inoculation: Pick a single colony of Agrobacterium that has been verified correctly by colony PCR into an LB liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. When the bacterial liquid concentration reaches OD 600 0.6 - 0.8, centrifuge at 5000 rpm for 5 min to collect the bacteria. After pouring off the supernatant, resuspend the bacteria with MS liquid medium (M519 4.43 g / L, sucrose 30 g / L, 6-BA 1.5 mg / L) to make the final concentration OD 600 = 0.4.

[0069] Infection: When the radicles of the kernels grow to about 1 cm, cut off both ends of the cotyledons, and cut the explants into 8 pieces on average for infection. Mix the cut cotyledons evenly in a 20 mL syringe containing 10 mL of the resuspended bacterial liquid, and then infect them under negative pressure for 15 min. Take out the explants and let them dry on sterile filter paper, and transfer them to the co-culture medium (CM, co-culture medium; M519 4.43 g / L, sucrose 30 g / L, G3251 3 g / L, 6-BA 1.5 mg / L) lined with filter paper for co-culture, and culture them in the dark at 28°C for 3 d; among them, M519 and G3251 are purchased from Phytotech Company, and 6-BA is purchased from Yuanye Company.

[0070] Recovery culture: After 3 d of co-culture, transfer the cotyledon pieces to the recovery medium (RM, recovery medium; M519 4.43 g / L, sucrose 30 g / L, G3251 3 g / L, 6-BA 1.5 mg / L, 200 mg / L Timentin), and culture them at 28°C under the conditions of a light intensity of 20000 lux and a light duration of 16 h / d for 7 d.

[0071] Selection culture: After the recovery culture is completed, transfer the explants to the selective medium (SM, selective medium; M519 4.43 g / L, sucrose 30 g / L, Agar 6.4 g / L, 6-BA 1.5 mg / L, 1.4 mg / L Basta and 200 mg / L Timentin) for selection culture, and subculture them at 28°C for 3 - 4 weeks, with subculture once every 12 d.

[0072] Shoot elongation culture: The GFP-tagged explants with obvious buds were transferred to seedling elongation medium (SE; M519 4.43 g / L, sucrose 30 g / L, Agar 6.4 g / L, 6-BA 0.5 mg / L and Timentin 200 mg / L) for culture.

[0073] Rooting culture: The selected buds were transferred to MS medium containing 0.5 mg / L IAA and 200 mg / L Timentin for rooting culture and cultured at 28°C until roots formed.

[0074] Transplanting: When the regenerated seedlings take root and grow 4-5 true leaves, take them out of the culture bottle, carefully remove the culture medium at the roots, and transplant them into a flowerpot with a substrate: vermiculite ratio of 1:3. Water thoroughly to keep warm and moisturize, and manage normally after cultivation.

[0075] Example 4 Editing detection of ClMS1L1 transgenic plants

[0076] Pick out the GFP fluorescent watermelon regenerated seedlings transformed with the pBSE402 vector, and extract genomic DNA using the CTAB method. Specific steps: Take a small part of the young leaves and quickly grind them into powder in liquid nitrogen, and put them in a 1.5ml centrifuge tube; add preheated 800μL CTAB extraction buffer, and place in a 65℃ water bath for 30min; add an equal volume of chloroform isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1), mix well, and centrifuge at 8000r / min for 10min; transfer the supernatant to a new 1.5mL centrifuge tube, add 2 / 3 volume of isopropanol, mix gently by turning upside down, and place in a -20℃ refrigerator for precipitation for 1h; centrifuge at 10000r / min for 10min; discard the supernatant, rinse the precipitate twice with 75% volume ethanol, pour it out, absorb the remaining liquid, dry it at room temperature, and use 100μL ddH 2 O (containing 0.1% RNase) and stored at 4°C for later use.

[0077] Using the extracted genomic DNA as a template, the primers ClMS1L1-JC-F and ClMS1L1-JC-R were used to perform PCR amplification on the sequences of the two target sites. The positive control was the recombinant plasmid, and the negative control was the non-transgenic plant DNA. The specific primer sequences of ClMS1L1-JC-F and ClMS1L1-JC-R are as follows:

[0078] ClMS1L1-JC-F: 5'-GGAAGGTGAGTTTGAAGGACA-3'; SEQ ID NO.8;

[0079] ClMS1L1-JC-R: 5'-GAGTAAGTGGCTTTTCAAG-3'; SEQ ID NO.9.

[0080] Amplification system (25 μL) and reaction procedure: 12.5 μL of 2x T5 SuperMIX, 1 μL each of primers (10 μM), 1 μL of template DNA, 9.5 μL of ddH 2 O. PCR reaction procedure: Pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 58°C for 10 s, extension at 72°C for 15 s, 35 cycles; final extension at 72°C for 5 min. The size of the bands was detected by 1% agarose gel electrophoresis.

[0081] The results of target editing comparison of the clms1l1 mutant are shown in Figure 4 , in which clms1l1-1 has a 218-bp deletion at the Target1 site and clms1l1-2 has a 4-bp deletion at the Target2 site.

[0082] Example 5 Phenotypic observation of ClMS1L1 gene-edited plants

[0083] The phenotypic observation is illustrated by taking clms1l1-1 as an example.

[0084] The edited plants clms1l1-1 and clms1l1-2 were planted in a solar greenhouse and normally managed. After the male flowers opened, their phenotypes were observed. Compared with the wild type, there were no obvious differences in the plant morphology and female flower development of clms1l1-1. The female flowers of the mutant could be normally pollinated and set fruits, and fertile seeds were produced. During the reproductive growth stage, most of the male flower buds of the mutant did not open, only a small part of the buds opened, and the anthers were smaller. Later, the anthers did not dehisce and no pollen was produced. Further staining with Alexander stain revealed that the male flowers of the mutant had no pollen ( Figure 5 ).

[0085] The phenotypes of the edited plants clms1l1-1 and clms1l1-2 were the same and will not be elaborated here.

[0086] In summary, the present invention provides a method for creating new watermelon male sterile germplasm through gene editing technology. By editing the male sterility regulatory gene ClMS1L1, a recessive nuclear male complete sterile line can be rapidly obtained, which has important application potential in the utilization of watermelon heterosis and population improvement.

[0087] The foregoing description of the disclosed embodiments enables those skilled in the art to practice or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method of gene editing ClMS1L1 A method for creating watermelon male sterile germplasm, characterized in that: The specific steps are as follows: (1) Based on ClMS1L1 The genomic DNA sequence of ClMS1L1 Two targets were designed on the third exon of , named Target1 and Target 2; Said ClMS1L1 The genomic DNA sequence is shown in SEQ ID NO.1; The target Target1 and Target2 sequences are as follows: Target1 sequence: 5′-GTTGAGCATGAAATGGAGG-3′; Target2 sequence: 5′-TATTTATATCGGCGATACA-3′; (2) Construction of CRISPR / Cas9 dual-target knockout vector; ① Use restriction endonuclease BsaI-HF to digest the CRISPR / Cas9 vector pBSE402, and recover the digested vector pBSE402; ②Using the intermediate vector pCBC-DT1T2 as a template, PCR amplification was performed using primers Target1-F / Target2-R to recover the target fragment; ③ Perform homologous recombination between the vector pBSE402 digested in step ① and the target fragment recovered in step ② to transform DH5α competent cells; ④ Identify the colonies obtained in step ③ and inoculate the colonies with the correct band size, shake the bacteria, extract the recombinant plasmid for sequencing, and transform the recombinant plasmid with the correct sequencing into Agrobacterium EHA105 competent cells; (3) Genetic transformation of watermelon; After the stages of immersion, co-cultivation, recovery culture, selection culture, bud elongation culture and rooting culture, gene-edited plants were obtained and phenotypes were observed; The sequences of the primers Target1-F / Target2-R are as follows: Target1-F: 5'-TCGAAGTAGTGATTG GTTGAGCATGAAATGGAGG GTTTTAGAGCTAGAAATAGC-3'; Target2-R: 5'-TTCTAGCTCTAAAAC TGTATCGCCGATATAAATA CAATCTCTTAGTCGA-3'.

2. The method of claim 1 through gene editing ClMS1L1 The application of the method for creating male sterile watermelon germplasm in creating male sterile watermelon.

Citation Information

Patent Citations

  • Method for creating watermelon male sterile new germplasm through gene editing technology

    CN112921051A

  • KR20220086791A