A molecular marker linked to female fertility of cucumber and application thereof
By developing molecular markers linked to cucumber female fertility regulatory genes and using KASP typing and PCR amplification technology, rapid identification and screening of cucumber female fertility was achieved, solving the problem of reduced fertility and improving breeding efficiency.
Patent Information
- Application Number
- CN202411792799.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-07
- Publication Date
- 2025-10-14
- Estimated Expiration
- 2044-12-07
AI Technical Summary
Existing technologies are unable to effectively solve the problem of female sterility in cucumbers, resulting in reduced fertility and poor seed quality, and there is a lack of efficient molecular marker-assisted breeding methods.
Molecular markers linked to cucumber female fertility regulatory genes were developed, the KASP typing method was used to locate the loci controlling female fertility, and primer sets were designed for PCR amplification and fluorescence detection to achieve rapid identification and screening of female fertility.
Through early molecular marker screening, the breeding scale and the workload of later identification are reduced, the selection efficiency is improved, and the accuracy and efficiency of the breeding process are ensured.
Smart Images

Figure CN119570970B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of cucumber breeding molecular biology, and in particular relates to a molecular marker linked to cucumber female fertility and its application. Background Art
[0002] Sexual reproduction is the primary mode of reproduction in higher plants and a key topic in botanical research. Parents typically produce reproductive cells, which then fuse to form a fertilized egg, which then develops into a seed and, in turn, a new individual. In nature, abnormal development of female organs (such as ovules, embryo sacs, and egg cells) often results in the inability of plants to pollinate and set seeds. This phenomenon is known as female sterility. Examples of female sterility have been found in plants such as Arabidopsis thaliana (Balasubramanian and Schneitz, 2002; Pagnussat et al., 2005), rice (Ling Dinghou et al., 1991), wheat (Xu Haifeng, 2009), and rapeseed (Chen Xinjun et al., 2003). Cucumber is an important vegetable, and researchers have discovered several plants with abnormal female fertility. Zhang et al. (1980) reported a cucumber material (ap) with malformed flower development. This material lacked stamens and pistils in its corolla, and its anthers and sepals were florets. This is an early report on cucumber fertility. Additionally, researchers have reported female sterility or low fertility in tissue culture and chromosome doubling, which was attributed to abnormal chromosome ploidy or chromosome number (Zhang Xiaoqing, 2007; Diao Weiping et al., 2008; Guan Wei, 2014). Chen Jianjun (2004) studied seed abortion in white cucumbers and demonstrated that abnormal pollen and embryo sac development were the cause of seed abortion in white cucumbers. Recently, researchers discovered a "mangofruit" cucumber mutant with reduced fertility as a test material. The flower organs of this material were abnormal, with fewer and less plump seeds. Map-based cloning and gene function studies showed that the CsWOX1 gene can affect the expression of the CsSPL gene, thereby reducing the fertility of cucumber. Further research on the function of the CsSPL gene showed that it plays an important role in maintaining cucumber fertility and seed quality (Liu et al., 2018; Niu et al., 2018).
[0003] The present invention uses the discovered female sterile mutant material as the test material, and through population construction, gene positioning and other research, it precisely locates the female sterility candidate gene, and develops molecular markers closely linked to female fertility, laying an important foundation for the cloning of female sterility genes and the application of molecular marker-assisted female fertility breeding, and has important theoretical and application value. Summary of the Invention
[0004] In view of this, the present invention aims to overcome the defects in the prior art and propose a molecular marker linked to female fertility of cucumber and its application, providing a new approach for the prediction, identification and auxiliary screening of female fertile cucumber materials, as well as breeding.
[0005] To achieve the above object, the technical solution of the present invention is achieved as follows:
[0006] In a first aspect, the present invention provides a molecular marker linked to a cucumber female fertility regulating gene, which is a T to C mutation occurring at position 23568336bp on chromosome 6 of the cucumber genome.
[0007] Preferably, the genotypes corresponding to the molecular markers are: T:T is a wild genotype with female fertility, T:C is a wild genotype with female fertility, and C:C is a mutant genotype with female sterility.
[0008] In a second aspect, the present invention further provides a primer set for regulating mutation of female fertility in cucumber, the sequence of the primer set is:
[0009] The forward primers are shown in SEQ ID No.1 and SEQ ID No.2, and the reverse primer is shown in SEQ ID No.3:
[0010] SEQ ID No. 1:
[0011] K23568336F-1: GAAGGTGACCAAGTTCATGCTTTCAAACAT ATTTGAAATTGTAAAATTGAATAC;
[0012] SEQ ID No. 2:
[0013] K23568336F-2: GAAGGTCGGAGTCAACGGATTTCAAACATA TTTGAAATTGTAAAATTGAATAT;
[0014] SEQ ID No.3:
[0015] K23568336C: AAATATGGCAGCTCATAATGCTTTTGAAATT AAT.
[0016] Preferably, the 5' ends of primers K23568336F-1 and K23568336F-2 are connected to different fluorescent linker sequences. Further preferably, the fluorescent linker is a FAM linker or a HEX linker, wherein the sequence of the FAM linker is: GAAGGTGACCAAGTTCAT GCT; and the sequence of the HEX linker is: GAAGGTCGGAGTCAACGGATT.
[0017] In a third aspect, the present invention also provides the use of the above-mentioned molecular markers linked to cucumber female fertility regulating genes for identifying and / or assisting in screening cucumber female fertility.
[0018] In a fourth aspect, the present invention also provides the use of the above-mentioned molecular markers linked to the cucumber female fertility regulating gene in cucumber female fertility breeding.
[0019] In a fifth aspect, the present invention also provides a method for detecting female fertility of cucumber using the above-mentioned molecular markers, comprising the following steps:
[0020] (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using molecularly labeled amplification primers to obtain an amplified product;
[0021] (2) Detect and analyze the amplified products.
[0022] Preferably, when the amplified product is subjected to fluorescence detection, if it is a T:T genotype, it is determined to be a female fertile wild plant; if it is a homozygous C:C genotype, it is determined to be a female sterile mutant plant; if it is a heterozygous T:C genotype, it is determined to be a female fertile wild plant.
[0023] Preferably, touchdown PCR is used in step (1); the touchdown PCR amplification program is: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.
[0024] Compared with the prior art, the present invention has the following advantages:
[0025] The present invention utilizes BSA mapping and KASP typing methods to locate a regulatory locus controlling female fertility in cucumbers. Based on this mutation, a KASP molecular marker associated with the cucumber female fertility regulatory gene was developed. This marker can be directly used to identify female fertility and corresponding genotypes in cucumbers, and then used to assist in breeding. Early use of this marker allows for rapid screening of target plants, effectively reducing the scale of planting, reducing the workload of later identification, and improving selection efficiency. Therefore, the present invention is of great significance in the study of female fertility gene cloning and its application in breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1Phenotypic comparison between the wild type 10Y and the mutant 10ym. (a, b) TTC staining was used to detect pollen viability of the wild type 10Y and the mutant 10ym, and the pollen tube germination experiment (c, d) was used to detect the pollen tube elongation ability of the wild type 10Y and the mutant 10ym. The scale bar is 100 μm; (e, f) fruits after mutual hybridization or self-pollination between the wild type 10Y and the mutant 10ym. The scale bar is 5 cm; (g) longitudinal section of the fruit 40 days after pollination. The red dotted line represents seeds. The scale bar is 5 cm.
[0027] Figure 2 This is the location map of the female sterility gene in cucumber, where A: BSA pool sequencing SNP polymorphism analysis; B: KASP marker screening and location analysis (K1 to K10 are KASP markers). DETAILED DESCRIPTION
[0028] Unless otherwise defined, the technical terms used in the following examples have the same meanings as commonly understood by those skilled in the art to which this invention belongs. The experimental reagents used in the following examples, unless otherwise specified, are conventional biochemical reagents; the experimental methods described, unless otherwise specified, are conventional methods.
[0029] The present invention will be described in detail below with reference to the embodiments.
[0030] Example: Acquisition of molecular markers linked to cucumber female fertility regulating genes
[0031] 1. Phenotype and inheritance of female sterile mutant materials
[0032] 1. Phenotype of Cucumber Female Sterility Mutant
[0033] Cucumber is a typical unisexual plant. After pollination, female flowers produce seeds, and females are fertile. The project team discovered a natural female-sterile mutant material, named 10ym, in the high-generation inbred line 10Y, which has normal female fertility. TTC was used to test the pollen viability and pollen tube germination of the wild type and mutant, and no significant difference was found between the two materials ( Figure 1 a- Figure 1 d). When wild-type 10Y and mutant 10ym were cross-pollinated, it was found that when mutant 10ym was the male parent and wild-type 10Y was the female parent, that is, when mutant 10ym male pollen was pollinated on wild-type 10Y female flowers, fruits swelled and seeds were successfully obtained, which was similar to the results of self-pollination of wild-type 10Y. However, when wild-type 10Y male pollen was used to pollinate mutant 10ym female flowers or 10ym was self-pollinated, fruits swelled but could not form seeds ( Figure 1 e- Figure 1 g). Therefore, compared with the wild type 10Y, the mutant 10ym has a female sterile phenotype.
[0034] 2. Genetic laws of female infertility
[0035] The mutant 10ym served as the male parent and the distantly related female-fertile wild type 1-5 (distantly related to 10ym) served as the female parent. Six generations of segregating populations were constructed, and phenotypic investigations were performed. Phenotypic investigations revealed that the F1 plants were female-fertile. Of the 116 individual plants in the F2 segregating population, 86 were female-fertile and 30 were female-sterile. In the population where the female-fertile material was the backcross parent, all were female-fertile. In the population where the female-sterile material was the backcross parent, 46 were female-fertile and 42 were female-sterile. This suggests that the female sterility of the mutant is a recessive trait controlled by a single gene.
[0036] Table 1 Statistics of genetic patterns of female infertility
[0037]
[0038] 2. Localization of Female Infertility Genes
[0039] 1. Group Construction
[0040] The female sterile mutant 10ym was used as the male parent, and the female fertile wild type 1-5 (distantly related to 10Y) was used as the female parent. The mutant 10ym was hybridized with the wild type 1-5 to obtain F1, and the F1 was self-pollinated to obtain the F2 segregating population.
[0041] 2. BSA-seq preliminary positioning of female infertility genes
[0042] 20 female fertile (dominant) and 20 female sterile (recessive) plants were randomly selected from the F2 population to extract their genomic DNA, and equal amounts of DNA were mixed to construct dominant and recessive pools respectively. Whole-genome resequencing was performed on the dominant and recessive pools, as well as the mutant 10ym and wild type 1-5, using the Illumina Hiseq2500 sequencing platform. The reads were aligned to the cucumber reference genome using the bwa software, and the SNP sites of the whole genome were found using the bcftools software. Then, the SNP sites that were homozygous and different from the parents of the offspring were screened out, and the SNP-index values of the dominant pool and the recessive pool were calculated. The SNP-index values of the recessive pool and the dominant pool were subtracted to obtain the △SNP-index value. We found that the 5Mb region on chromosome 6 was significantly higher than the domain value and was a candidate region for the female sterility gene ( Figure 2 A).
[0043] 3. Fine Mapping of Female Sterility Regulatory Genes and Development of Molecular Markers
[0044] Based on the variation information of the candidate region, 10 pairs of KASP markers were developed (primer sequences are shown in Table 2). The positioning interval of the female sterility gene was further narrowed by the KASP markers (primer sequences are shown in Table 2). The KASP markers were applied to individual plants in the F2 population. Different primers were labeled with different fluorescent markers, and different fluorescence was emitted after PCR extension. The genotype was determined based on the fluorescence value. Using 200 recessive individual plants in the F2 population, combined with the KASP genotyping results, the female sterility candidate gene was located in the 378.6kb region between molecular markers K4 and K6. The base genotype at position 23568336 in this region was 100% consistent with the female fertility phenotype ( Figure 2 B). When the base pair at position 23568336 is T:T, it indicates female fertility; when it is T:C, it indicates female fertility; and when it is C:C, it indicates female sterility. Based on these results, SNP marker K5 was developed at this position for testing female fertility in F2 plants, and the genotype and phenotype were completely consistent (primer sequences are shown in Table 2).
[0045] Table 2 KASP detection marker primer sequences
[0046]
[0047]
[0048] When molecular markers are used, the following steps are specifically included: (1) using the genomic DNA of the sample to be tested as a template, using the amplification primers of the molecular marker to perform touchdown PCR amplification to obtain the amplified product; (2) detecting and analyzing the amplified product.
[0049]
[0050]
[0051] When performing fluorescence detection on the amplified product, if only the fluorescence signal corresponding to primer K23568336F-1 is detected in the sample PCR product, the detection site is the T:T genotype, and it is determined to be a cucumber plant with a female fertile phenotype; if only the fluorescence signal corresponding to primer K23568336F-2 is detected in the sample PCR product, the detection site is the C:C genotype, and it is determined to be a cucumber plant with a female sterile phenotype; if both fluorescence signals are detected at the same time, the detection site is the T:C genotype, and it is determined to be a cucumber plant with a female fertile phenotype.
[0052] When molecular markers were applied, Touchdown PCR was used, and the amplification program was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, for 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, for 26 cycles.
[0053] The sample to be tested is a leaf.
[0054] Table 3 Female fertility phenotypes and genotypes of some individual plants in the 1-5, 10 μm, F1 and constructed F2 populations of the parents with the K5 marker
[0055]
[0056]
[0057]
[0058] These identification results demonstrate that by using molecular marker identification and screening during breeding, retaining material with a C:C fluorescent signal corresponding to primer K5 can produce female-sterile cucumbers. Retaining material with a T:T fluorescent signal corresponding to primer K5 can produce homozygous female-fertile material. Retaining material with a T:C fluorescent signal can produce heterozygous female-fertile material. Early molecular marker screening can reduce the workload of later screening and identification, accelerating the breeding process.
[0059] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A primer set for regulating female fertility mutation in cucumber, characterized by: The primer set sequences are as follows: the forward primers are shown in SEQ ID No. 1 and SEQ ID No. 2, and the reverse primer is shown in SEQ ID No. 3: SEQ ID No. 1: K23568336F-1: GAAGGTGACCAAGTTCATGCTTTCAAACATATTTGAAATTGTAAAATTGAATAC; SEQ ID No. 2: K23568336F-2: GAAGGTCGGAGTCAACGGATTTCAAACATATTTGAAATTGTAAAATTGAATAT; SEQ ID No.3: K23568336C: AAATATGGCAGCTCATAATGCTTTTGAAATTAAT.
2. Use of the cucumber female fertility regulating mutation primer set according to claim 1 for identifying and / or assisting in screening cucumber female fertility.
3. Use of the cucumber female fertility regulating mutation primer set according to claim 1 in cucumber female fertility breeding.
4. A method for detecting female fertility of cucumber using the primer set of claim 1, characterized in that: The steps include: (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using a primer set to obtain an amplified product; (2) Fluorescence detection and analysis of the amplified products; When the amplified product is subjected to fluorescence detection, if it is a T:T genotype, it is determined to be a female fertile wild plant; if it is a homozygous C:C genotype, it is determined to be a female sterile mutant plant; if it is a heterozygous T:C genotype, it is determined to be a female fertile wild plant.
5. The detection method according to claim 4, wherein: Touchdown PCR was used in step (1); the touchdown PCR amplification program was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.
Citation Information
Patent Citations
Cucumber female character related SNP (single nucleotide polymorphism) marker and InDel marker and application thereof
CN105255873A
Female SNP molecular marker in cucumber and application thereof
CN109234446A