Taq DNA polymerase recombinant antibody and application thereof

Abstract

The invention provides a Taq DNA polymerase recombinant antibody, mainly relates to recombinant antibodies with heavy chain sequences and light chain sequences from different species, and by using the recombinant antibody provided by the invention, non-specific amplification products in PCR and qPCR reactions are reduced, and the accuracy of the reactions and the stability of premixed reagents are improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology and medical technology, and in particular to a recombinant antibody against Taq DNA polymerase and an application thereof. Background Art

[0002] Real-time fluorescence quantitative PCR (Quantitative Real-time PCR) is a method that uses fluorescent chemicals to measure the total amount of products after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. It is a method for quantitatively analyzing specific DNA sequences in the sample to be tested using internal or external reference methods.

[0003] Taq DNA polymerase is a heat-stable DNA polymerase isolated from Thermus Aquaticus. It has 5'→3' polymerization and exo-cutting activity. The qPCR technology involved in it is widely used in biochemical tests and in vitro diagnostics. Since Taq DNA polymerase is a heat-stable enzyme, it still has a certain activity at room temperature, resulting in the degradation of primers, probes or templates before PCR pre-denaturation, and its polymerization activity can cause template or primer mismatches and produce non-specific amplification before PCR pre-denaturation; in the subsequent PCR cycle, non-specific products are further amplified, resulting in a decrease in the yield of the target product, or even the failure to amplify the target band. In addition, with the rapid development of qPCR technology in the nucleic acid detection industry, testers pay special attention to the stability of the detection reagents, whether it is long-term storage stability, short-term storage stability or reagent premix stability. These often determine the credibility and effectiveness of the test results.

[0004] The hot start method can solve the above problems.

[0005] At present, the commonly used hot start methods include antibody method, chemical modification method, aptamer method, etc. Among them, the chemical modification method is more commonly used, and the activity is more completely blocked and will not introduce exogenous contamination, but its activity is difficult to fully activate and requires high temperature incubation for a long time. The activity of the aptamer method is difficult to completely block, and the temperature can often be raised to above 45°C to restore the activity, and it is difficult to achieve a strict hot start. Compared with the above two methods, the antibody method has certain advantages: antibody-modified hot start enzymes require monoclonal antibodies to specific Taq enzymes. Taq DNA polymerase antibodies can completely inhibit Taq DNA polymerase activity at room temperature, so that it does not exert polymerase activity under low temperature conditions. As the temperature rises, the activity is slowly released above 60°C, and heat shock at 95°C for 3-5 minutes can completely release Taq enzyme activity.

[0006] Although a variety of antibody methods for blocking Taq DNA polymerase activity have been reported, these methods still have problems in practical applications: non-specific product amplification, low amplification curve platform, poor repeatability of multiple wells, and poor stability of reagent premixes. Summary of the invention

[0007] The first object of the present invention is to provide a recombinant antibody for blocking Taq DNA polymerase activity, wherein the recombinant antibody comprises a heavy chain and a light chain.

[0008] In some embodiments, the recombinant antibody is selected from any type of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD.

[0009] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 as shown in SEQ ID NO:56, or an amino acid sequence having at least 90%, at least 95%, at least 99% identity thereto, a light chain variable region CDR-L2 as shown in SEQ ID NO:57, or an amino acid sequence having at least 90%, at least 95%, at least 99% identity thereto, and a light chain variable region CDR-L3 as shown in SEQ ID NO:58, or an amino acid sequence having at least 90%, at least 95%, at least 99% identity thereto;

[0010] Alternatively, a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO:40 or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:40.

[0011] In some embodiments, the recombinant antibody comprises a heavy chain variable region CDR-H1 as shown in SEQ ID NO:41, or an amino acid sequence having at least 90%, at least 95%, at least 99% identity thereto, a heavy chain variable region CDR-H2 as shown in SEQ ID NO:42, or an amino acid sequence having at least 90%, at least 95%, at least 99% identity thereto, and a heavy chain variable region CDR-H3 as shown in SEQ ID NO:43, or an amino acid sequence having at least 90%, at least 95%, at least 99% identity thereto;

[0012] Alternatively, a heavy chain variable region CDR-H1 comprising an amino acid sequence as shown in SEQ ID NO:44, or having at least 90%, at least 95%, at least 99% identity thereto, a heavy chain variable region CDR-H2 comprising an amino acid sequence as shown in SEQ ID NO:45, or having at least 90%, at least 95%, at least 99% identity thereto, and a heavy chain variable region CDR-H3 comprising an amino acid sequence as shown in SEQ ID NO:46, or having at least 90%, at least 95%, at least 99% identity thereto;

[0013] Alternatively, a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:35, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:35;

[0014] Alternatively, a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO:36 or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:36.

[0015] In some embodiments, the recombinant antibody comprises a heavy chain constant region of an amino acid sequence as set forth in SEQ ID NO:30, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:30;

[0016] Alternatively, a heavy chain constant region as shown in SEQ ID NO:31, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:31.

[0017] In some embodiments, the recombinant antibody comprises a light chain constant region as shown in SEQ ID NO:34 or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34.

[0018] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as shown in SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:56 to SEQ ID NO:58; a heavy chain variable region CDR-H1 to CDR-H3 as shown in SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:41 to SEQ ID NO:43; or, a heavy chain variable region CDR-H1 to CDR-H3 as shown in SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:44 to SEQ ID NO:46; NO:46 has a heavy chain variable region CDR-H1 to CDR-H3 having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical.

[0019] In some embodiments, the recombinant antibody comprises a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO:35, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:35, or a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO:36, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:36; a light chain variable region of an amino acid sequence as set forth in SEQ ID NO:40, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:40.

[0020] In some embodiments, the recombinant antibody further comprises a heavy chain constant region of an amino acid sequence as shown in SEQ ID NO:30, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:30, or a heavy chain constant region of an amino acid sequence as shown in SEQ ID NO:31, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:31; and a light chain constant region of an amino acid sequence as shown in SEQ ID NO:34, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:34.

[0021] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as shown in SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:56 to SEQ ID NO:58; a heavy chain variable region CDR-H1 to CDR-H3 as shown in SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:41 to SEQ ID NO:43; or a heavy chain variable region CDR-H1 to CDR-H3 as shown in SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:44 to SEQ ID NO:46. NO:46 has a heavy chain variable region CDR-H1 to CDR-H3 having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:30; a heavy chain constant region comprising an amino acid sequence as shown in SEQ ID NO:30, or having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:30, or a heavy chain constant region as shown in SEQ ID NO:31, or having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:31; a light chain constant region comprising an amino acid sequence as shown in SEQ ID NO:34, or having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:34.

[0022] In some embodiments, the recombinant antibody comprises a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO:35, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:35, or a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO:36, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:36; a light chain variable region of an amino acid sequence as set forth in SEQ ID NO:40, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:40; a light chain variable region of an amino acid sequence as set forth in SEQ ID NO:30, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:31; NO:30 has a heavy chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical, or a heavy chain constant region comprising an amino acid sequence as shown in SEQ ID NO:31 or that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:31; a light chain constant region comprising an amino acid sequence as shown in SEQ ID NO:34 or that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:34.

[0023] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as shown in SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:56 to SEQ ID NO:58; a heavy chain variable region CDR-H1 to CDR-H3 as shown in SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:41 to SEQ ID NO:43; a heavy chain variable region CDR-H2 to CDR-H3 as shown in SEQ ID NO:30, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:31. NO:30 has a heavy chain constant region with an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical; a light chain constant region comprising an amino acid sequence as shown in SEQ ID NO:34 or that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:34.

[0024] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as shown in SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:56 to SEQ ID NO:58; a heavy chain variable region CDR-H1 to CDR-H3 as shown in SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:44 to SEQ ID NO:46; a heavy chain variable region CDR-H2 to CDR-H3 as shown in SEQ ID NO:31, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:32. NO:31 has a heavy chain constant region with an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical; a light chain constant region comprising an amino acid sequence as shown in SEQ ID NO:34 or that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34.

[0025] In some embodiments, the recombinant antibody comprises a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO:35, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:35; a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:40, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:40; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:30, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:30; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:34, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:35; NO:34 has a light chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical.

[0026] In some embodiments, the recombinant antibody comprises a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO:36, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:36; a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:40, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:40; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:31, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:31; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:34, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:35; NO:34 has a light chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical.

[0027] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 comprising an amino acid sequence as shown in SEQ ID NO:50 to SEQ ID NO:52, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:50 to SEQ ID NO:52; a heavy chain variable region CDR-H1 to CDR-H3 comprising an amino acid sequence as shown in SEQ ID NO:47 to SEQ ID NO:49, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:47 to SEQ ID NO:49; a heavy chain constant region comprising an amino acid sequence as shown in SEQ ID NO:32, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:32; NO:33 or a light chain constant region of an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:33.

[0028] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as shown in SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:53 to SEQ ID NO:55; a heavy chain variable region CDR-H1 to CDR-H3 as shown in SEQ ID NO:47, SEQ ID NO:48 and SEQ ID NO:49, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:47 to SEQ ID NO:49; a heavy chain variable region CDR-H2 to CDR-H3 as shown in SEQ ID NO:32, or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO:33. NO:32 has a heavy chain constant region with an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical; a light chain constant region comprising an amino acid sequence as shown in SEQ ID NO:33 or that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to SEQ ID NO:33.

[0029] In some embodiments, the recombinant antibody comprises a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO:37, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:37; a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:38, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:38; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:32, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:32; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:33, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:34; NO:33 has a light chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical.

[0030] In some embodiments, the recombinant antibody comprises a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO:37, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:37; a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:39, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:39; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:32, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:32; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:33, or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity to SEQ ID NO:34; NO:33 has a light chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical.

[0031] The present invention also provides a method for preparing an antibody, comprising: cDNA preparation—PCR—enzyme cleavage and ligation—expression vector transformation and amplification—sequencing and identification—mass preparation of expression vectors—transformation. Specifically, the method comprises connecting the target gene to a prokaryotic or eukaryotic target expression vector through gene cloning technology, transforming the target expression vector into a host cell, and performing soluble expression. The method further comprises separating and purifying the target protein through affinity chromatography technology.

[0032] In some embodiments, the host cell is Escherichia coli, yeast or CHO cell, preferably CHO cell. The affinity protein chromatography is selected from nickel affinity chromatography, GST-tag affinity chromatography, MBP-tag affinity chromatography, Protein A affinity chromatography, FLAG-tag affinity chromatography, Strep-tag affinity chromatography, heparin affinity chromatography, preferably Protein A affinity chromatography. The expression vector comprises multiple cloning restriction sites, including HindIII, BamHI, EcoRI.

[0033] The second object of the present invention is to provide an antibody-modified Taq DNA polymerase, specifically a Taq enzyme modified by the antibody of the present invention. The Taq enzyme can reduce non-specific amplification caused by template or primer mismatch in PCR and qPCR processes, and significantly improve reaction efficiency.

[0034] In some embodiments, when preparing antibody-modified Taq DNA polymerase, the concentration ratio of Taq DNA polymerase to recombinant antibody is 1:5 to 1:15, preferably 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14 and 1:15, and more preferably 1: 10. The recombinant antibody binds to Taq DNA polymerase, thereby inhibiting the activity of Taq DNA polymerase or Taq DNA polymerase mutant.

[0035] The third object of the present invention is to provide a method for reducing non-specific amplification products in PCR or qPCR reactions, specifically involving the use of the first purpose DNA polymerase recombinant antibody and DNA polymerase or the use of the second purpose antibody-modified Taq DNA polymerase.

[0036] The present invention provides a method for reducing non-specific products of PCR or qPCR reaction, comprising mixing a recombinant antibody for DNA polymerase, Taq DNA polymerase, DNA template, upstream and downstream primers and buffer of the first purpose or a Taq DNA polymerase modified with the antibody of the second purpose, DNA template, upstream and downstream primers and buffer, reacting the mixed solution and amplifying the DNA template.

[0037] In some embodiments, the DNA template is selected from gDNA, cDNA, and plasmid DNA.

[0038] In some embodiments, the PCR or qPCR amplification reaction includes pre-denaturation and cycling reaction, the pre-denaturation temperature is 90-98°C, such as 92-96°C, such as 95°C, incubated for 20s-60s, such as 25s-40s, such as 30s; the cycling reaction includes denaturation at 95°C for 8-12s, annealing and extension at 55-65°C for 10-30s, for a total of 40-50 cycles.

[0039] The fourth object of the present invention is to provide the use of the recombinant antibody of the first object or the antibody-modified TaqDNA polymerase of the second object in improving the accuracy of PCR or qPCR reactions and / or the stability of PCR or qPCR premix reagents.

[0040] In some embodiments, the reaction precision is manifested in replicate well reproducibility.

[0041] In some embodiments, the PCR premix reagent includes a buffer substance, upstream and downstream primers, a DNA template, and a DNA polymerase, and the DNA template is selected from gDNA, cDNA, and plasmid DNA.

[0042] In some embodiments, the qPCR premix reagent includes a buffer substance, upstream and downstream primers, a DNA template, a DNA polymerase, and a probe primer, and the DNA template is selected from gDNA, cDNA, and plasmid DNA.

[0043] The sixth object of the present invention is to provide a composition or a kit, comprising the first object Taq enzyme recombinant antibody or the second object antibody-modified Taq DNA polymerase.

[0044] In some embodiments, the composition or kit further comprises a buffer substance, a metal salt, and dNTPs.

[0045] Beneficial effects of the present invention

[0046] The Taq enzyme recombinant antibody provided by the present invention can effectively block the activity of Taq DNA polymerase at room temperature, thereby reducing nonspecific amplification caused by template or primer mismatch during amplification, significantly improving reaction efficiency, and at the same time improving the stability of the detection reagent. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 :The amplification curve of the effect of hot-start Taq DNA polymerase on the stability of reagent premix for recombinant antibody preparation; DETAILED DESCRIPTION

[0048] The present disclosure is described in detail below in conjunction with examples, but the implementation scheme of the present disclosure is not limited thereto. Obviously, the examples described below are only some examples of the present disclosure. For those skilled in the art, other similar examples obtained without creative work all fall within the protection scope of the present disclosure.

[0049] Unless otherwise defined, all terms used herein have the same meaning as those generally understood by those skilled in the art to which the present disclosure belongs. All patents, patent applications and publications cited throughout the disclosure are incorporated herein by reference in their entirety. If there are multiple definitions for a term herein, those definitions in this section shall prevail.

[0050] The technical solutions provided by the present disclosure are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present disclosure.

[0051] Example 1: Exemplary method for preparing antibodies against Taq DNA polymerase

[0052] 1. Exemplary method for preparing Taq DNA polymerase-resistant hybridoma cells

[0053] The female Balb / c mice (6 to 10 weeks old) used in this example were purchased from Yangzhou University, and SP2 / 0 myeloma cells were from Vazyme.

[0054] 1.1. Immunization of mice

[0055] Using purified Taq enzyme (Vazyme#P101) as antigen, 6 six-week-old Balb / c mice were immunized by subcutaneous multiple injection. The immunization dose of each mouse was 100 μg protein. The mice were immunized once a week for two months. After the third immunization and before each immunization, orbital blood was collected and the serum titer was detected by enzyme-linked immunosorbent assay (ELISA).

[0056] 1.2. Serum titer detection

[0057] The purified Taq enzyme was used as the antigen, and the antigen was diluted to 1 μg / mL with the coating buffer PBS, and 100 μl / well was added to the ELISA plate, covered and sealed, and coated overnight at 4°C; the next day, the liquid in the plate was shaken off, the plate was patted dry, and 150 μl of 5% skimmed milk powder was added to each well for blocking, and the blocking was carried out at room temperature for more than 2 hours; the plate was washed 3 times with the washing buffer PBST [PBS (pH7.4) containing 0.05% Tween-20], and 100 μl of serum after gradient dilution was added, and 37°C was 1-2h; patted dry, the plate was washed 3 times with PBST, and 100 μl of secondary antibody working solution was added to each well (HRP-labeled goat anti-mouse IgG was diluted 1:3000 with antibody diluent, incubated at 37°C for 1h, removed and patted dry, and the plate was washed 3 times with PBST, and 100 μl of single-component TMB substrate was added to each well, and incubated at room temperature for 5-20min. 50 μl of stop solution (0.5MH 2 SO 4 ), and read the absorbance at 450 nm / 630 nm on a microplate reader.

[0058] 1.3 Cell fusion and screening

[0059] Three days before cell fusion, 100 μg Taq enzyme (dissolved in PBS) was injected into the mouse peritoneal cavity again. After 3-5 days of immunization, the mouse was dissected and spleen cells were taken to prepare a cell suspension of appropriate concentration. SP2 / 0 myeloma cells and spleen cells were then placed in a centrifuge tube at a ratio of 1:4, mixed thoroughly, centrifuged, and the supernatant was removed and PEG solution was added for cell fusion. After obtaining hybridoma cells, the obtained hybridoma cells were suspended in HAT medium containing feeder cells for screening, and then added to 96-well plates for culture to obtain hybridoma master clones. All fused cells were inoculated in 96-well plates for cell culture. The indirect ELISA experiment was used to detect the supernatant of the master clone cells, select positive clones, and give priority to selecting hybridoma master clones with higher affinity for freezing or further expansion of culture.

[0060] 2. Expression plasmid construction

[0061] The restriction endonucleases in this example were purchased from NEB; RNA extraction kit, reverse transcription kit, plasmid extraction, gel recovery kit, and pUC19-T vector were from Vazyme.

[0062] Primer synthesis and gene sequencing were completed by Sangon Biotechnology Co., Ltd.

[0063] 2.1. Anti-Taq1 antibody gene preparation

[0064] Sufficient hybridoma cells were obtained for total RNA extraction. For the specific operation steps when using the kit for determination, please refer to the instructions of the corresponding kit. The specific operation is as follows: 1) Extract total RNA of hybridoma cells (kit: FastPure Cell / Tissue Total RNA Isolation Kit); 2) Synthesize cDNA by RT-PCR (kit: HiScript II 1stStrand cDNA Synthesis Kit (+gDNA wiper)); 3) Use heavy chain primers and light chain primers to amplify heavy and light chains by PCR with cDNA as template; 4) Perform nucleic acid electrophoresis and gel recovery (FastPure Gel DNA Extraction MiniKit) to obtain light and heavy chain fragments; 5) Construct heavy and light chains into plasmid vectors (ClonExpress Ultra One Step Cloning Kit V2), transform into Escherichia coli DH5α, and send samples for sequencing.

[0065] 2.2 Sequence analysis of Anti-Taq1 antibody variable region genes

[0066] The gene sequences obtained by the above sequencing were placed in the Kabat antibody database for analysis, and analyzed using VNTI11.5 software to confirm that the genes amplified by the heavy chain and light chain primer pairs were correct.

[0067] 2.3. Construction of antibody expression plasmid

[0068] According to the sequencing results of the antibody gene in the above pUC19-T, the heavy chain and light chain gene-specific primers of the Anti-Taq1 antibody were designed, with HindIII and EcoRI restriction sites at both ends, and the 0.705KB light chain gene fragment and the 0.834kb heavy chain gene fragment were amplified by PCR amplification. The pcDNA 3.1 vector was used as the recombinant antibody eukaryotic expression vector constructed, and the eukaryotic expression vector was double-digested with HindIII and EcoRI. After the digestion, the linearized vector was purified, and the heavy chain and light chain gene fragments were connected to the purified linearized vector to obtain the expression plasmids of the heavy chain and light chain, respectively.

[0069] 3. CHO cell transfection

[0070] The plasmid was diluted to 30ug / 100ul with sterile water, and the heavy chain and light chain were mixed at a mass ratio of 1:1. 100ul of mixed plasmid was mixed with 800ul of 1×10 7cells / ml of CHO cells were mixed, and after being evenly mixed, they were transferred to an electroporation cup for electrotransfection. Samples were taken and counted on the 3rd, 5th and 7th days. Samples were collected on the 7th day, and the culture medium after transfection was centrifuged and affinity purified using a protein A affinity chromatography column to obtain the antibody protein.

[0071] The preparation methods of other antibodies Anti-Taq 2, Anti-Taq 3, Anti-Taq4 and Anti-Taq5 are similar to Anti-Taq1. The sequences of taq enzyme antibodies are shown in Table 1.

[0072] Table 1: Sequences of Taq enzyme antibodies

[0073]

[0074]

[0075] Example 2: Specificity test of hot-start TaqDNA polymerase prepared with different antibodies on qPCR reaction

[0076] (1) Preparation of antibody solution: Prepare the antibody solution according to the grouping in Table 4.

[0077] (2) Preparation of 2 U / μL hot-start enzyme: Mix the enzyme and antibody at a ratio of 1:10. After standing at room temperature for 10 min, add Taq storage buffer (containing 50% sterile glycerol) to make the concentration of the hot-start enzyme 2 U / μL.

[0078] (3) Amplification reaction: Prepare the amplification reaction system according to Table 2, with three replicates for each system, and perform amplification according to the procedure in Table 3. By comparing the number of nonspecific peaks in the melting curves of the experimental group (hot-start enzymes blocked with different antibodies) and the control group (Taq enzymes without antibody blocking), the effect of hot-start enzymes blocked with different types of antibodies on the specificity of qPCR can be determined.

[0079] Table 2: Amplification reaction system

[0080]

[0081]

[0082] a, b, c: Vazyme#P101; d: Vazyme#QN213; e: Vazyme#JC2002

[0083] Prepare the qPCR amplification system according to Table 1 and mix evenly after preparation. The primer and probe sequences are as follows:

[0084] System 1-F: (SEQ ID NO: 59): TTTTAACTCCTTTGCCCAATAAGG;

[0085] System 1-R: (SEQ ID NO: 60): TTAGCAACAGAAACCGTGGAAA;

[0086] System 1-P: (SEQ ID NO: 61): 5'FAM-CTGCCTGGAGCCCGTAGCCA-3'BHQ1;

[0087] System 2-F: (SEQ ID NO: 62): CAAGACAGGACACTGCGGAAA;

[0088] System 2-R: (SEQ ID NO: 63): TTACTACGGCCGGAGCAGAT;

[0089] System 2-P: (SEQ ID NO: 64): 5'FAM-TGCCGCCGCACACTGTCTGA-3'BHQ1;

[0090] System 3-F: (SEQ ID NO: 65): TGCTGAAATCTGCAACACTGTGTA;

[0091] System 3-R: (SEQ ID NO: 66): AATAGGAGTGGCTTCGAAGTTGA;

[0092] System 3-P: (SEQ ID NO: 67): 5'FAM-CCTGCCATCCTGCCCACCATTTATACC-3'BHQ1;

[0093] System 4-F: (SEQ ID NO: 68): GAGACATTCTCCTCAATCATTTAACATT;

[0094] System 4-R: (SEQ ID NO: 69): AAGGAATAAAAGGAGAGTAATAGAAAAGTGTGT;

[0095] System 4-P: (SEQ ID NO: 70): 5'FAM-TGCTGTAGCCACCCAGAACAGGTTATGT-3'BHQ1;

[0096] The templates of system 1, system 2, and system 3 are cDNA of HELA cells diluted 10 times, and the template of system 4 is 1ng / μL 293 genomic DNA.

[0097] Table 3: Amplification Procedure

[0098]

[0099]

[0100] After amplification, the effect of hot-start enzymes blocked by different antibodies on the specificity of qPCR was determined based on the number of nonspecific peaks in the melting curve of each system. The results are shown in Table 4.

[0101] Table 4: Number of non-specific peaks of hot-start Taq enzyme blocked by different antibodies

[0102] System 1 System 2 System 3 System 4 total Taq 2 3 3 3 11 Taq+Anti-Taq 1 2 0 2 3 5 Taq+Anti-Taq 2 2 1 2 3 8 Taq+Anti-Taq 3 2 2 1 3 8 Taq+Anti-Taq4 0 0 1 0 1 Taq+Anti-Taq5 0 0 0 1 1

[0103] Result analysis: As shown in Table 4, the addition of different antibodies can block Taq enzyme activity at room temperature. The two recombinant antibodies Taq+Anti-Taq4 and Taq+Anti-Taq5 have one non-specific peak each, while the specificity of other antibodies is poor when blocked.

[0104] Example 3: Testing of hot-start Taq DNA polymerase prepared with different antibodies to improve the repeatability of qPCR reactions

[0105] The group setting was the same as in Example 2, and the amplification reaction system was shown in Table 2. Ten replicate wells were prepared for each system, and amplification was performed according to the procedure in Table 3. The effect of the hot-start enzyme blocked by the recombinant antibody on the repeatability of the qPCR replicate wells was determined by comparing the CV values ​​between the 10 replicate wells of the experimental group (hot-start enzyme blocked by the recombinant antibody) and the control group (Taq enzyme without antibody blocking).

[0106] Table 5: CV values ​​of replicate wells

[0107]

[0108]

[0109] Result analysis: It can be seen from Table 5 that compared with the unblocked Taq enzyme, the reproducibility between the amplification replicates of all hot start enzymes prepared with different antibodies has been improved to varying degrees. When the recombinant antibodies anti-Taq4 and anti-taq5 are used to block the Taq DNA polymerase, the reproducibility between the 10 replicates of each system is the best; when the other antibodies are used to block the Taq DNA polymerase, the reproducibility between the replicates is poor.

[0110] Example 4: Test on improving the qPCR reaction platform value by hot-start Taq DNA polymerase prepared with different antibodies

[0111] The group setting was the same as in Example 2, and the amplification reaction system was shown in Table 2. Three replicate wells were prepared for each system, and amplification was performed according to the procedure in Table 3. The average platform value of the three replicate wells of each system was calculated, and the platform value difference rate of the experimental group (hot start enzyme blocked with different antibodies) and the control group (Taq enzyme without antibody blocking) under the same system was compared (△Rn=Rn experimental group-Rn control group) / Rn control group) to determine the effect of hot start enzymes blocked with different types of antibodies on the platform value of qPCR reaction.

[0112] Table 6: qPCR reaction plateau values

[0113] Platform Value System 1 System 2 System 3 System 4 Taq 0.0％ 0.0％ 0.0％ 0.0％ Taq+Anti-Taq 1 10.3％ 15.9％ 15.6％ 14.9％ Taq+Anti-Taq 2 11.2％ 13.5％ 10.3％ 16.4％ Taq+Anti-Taq 3 14.3％ 12.6％ 16.4％ 17.6％ Taq+Anti-Taq4 27.4％ 29.6％ 30.1％ 25.6％ Taq+Anti-Taq5 29.6％ 31.5％ 25.8％ 30.4％

[0114] Result analysis: It can be seen from Table 6 that compared with the unblocked Taq enzyme, the platforms of the hot-start enzymes prepared by all different antibodies were improved to varying degrees. When the Taq DNA polymerase was blocked with recombinant antibodies anti-Taq4 and anti-taq5, the qPCR amplification reaction platform was significantly improved. When the Taq DNA polymerase was blocked with other antibodies, although the platform value was improved, the effect was weaker than that of the hot-start Taq DNA polymerase prepared with recombinant antibodies.

[0115] Example 5: Stability test of hot-start Taq DNA polymerase premixes prepared with different antibodies

[0116] The group setting was the same as that in Specific Example 2. The hot start enzymes prepared with different antibodies were used to prepare complete premixes containing primers and probes, which were placed at 37°C for 7 days. The control group was a -20°C sample.

[0117] Table 7: Preparation of premix

[0118]

[0119]

[0120] a, b, c: Vazyme#P101; d: Vazyme#QN213;

[0121] Three replicate wells were prepared for each system, and amplification was performed according to the procedure in Table 3. The sensitivity and platform value of the experimental group (treated at 37°C for 7 days) and the control group (Taq enzyme without antibody blocking) under the same system were compared through amplification curves to determine the effect of hot start enzymes blocked by different types of antibodies on the stability of the qPCR reaction reagent premix.

[0122] Result analysis: Figure 1It can be seen that compared with the unblocked Taq enzyme, the premix stability of the hot-start enzymes prepared with all different antibodies was improved to varying degrees. When the TaqDNA polymerase was blocked with recombinant antibodies anti-Taq4 and anti-taq5, the premix stability of the qPCR reaction reagent was the best, which was specifically manifested in that the sensitivity and platform value of the premixed reagent did not change significantly before and after being treated at 37°C for 7 days; while when anti-Taq1, anti-Taq2 and anti-Taq3 were used to block the Taq DNA polymerase respectively, the stability of the premixed reagent became worse after being treated at 37°C for 7 days, and the platform value showed a significant decrease compared with the unpressurized control.

Claims

1. A Taq DNA polymerase recombinant antibody, comprising a light chain variable region CDR-L1 as shown in SEQ ID NO:56 or an amino acid sequence having at least 90%, at least 95%, or at least 99% identity thereto, a light chain variable region CDR-L2 as shown in SEQ ID NO:57 or an amino acid sequence having at least 90%, at least 95%, or at least 99% identity thereto, and a light chain variable region CDR-L3 as shown in SEQ ID NO:58 or an amino acid sequence having at least 90%, at least 95%, or at least 99% identity thereto.

2. The recombinant antibody according to claim 1, wherein the antibody comprises a heavy chain variable region CDR-H1 as shown in SEQ ID NO: 41, or an amino acid sequence having at least 90%, at least 95%, at least 99% identity thereto, the antibody comprises a heavy chain variable region CDR-H2 as shown in SEQ ID NO: 42, or an amino acid sequence having at least 90%, at least 95%, at least 99% identity thereto, and the antibody comprises a heavy chain variable region CDR-H3 as shown in SEQ ID NO: 43, or an amino acid sequence having at least 90%, at least 95%, at least 99% identity thereto; Alternatively, the antibody comprises a heavy chain variable region CDR-H1 as shown in SEQ ID NO:44, or an amino acid sequence at least 90%, at least 95%, at least 99% identical thereto, the antibody comprises a heavy chain variable region CDR-H2 as shown in SEQ ID NO:45, or an amino acid sequence at least 90%, at least 95%, at least 99% identical thereto, and the antibody comprises a heavy chain variable region CDR-H3 as shown in SEQ ID NO:46, or an amino acid sequence at least 90%, at least 95%, at least 99% identical thereto.

3. The recombinant antibody according to claim 1 or 2, further comprising a light chain constant region having an amino acid sequence as shown in SEQ ID NO: 34 or having at least 90%, at least 95%, or at least 99% identity with SEQ ID NO:

34.

4. The recombinant antibody according to claim 2, further comprising a heavy chain constant region of an amino acid sequence as shown in SEQ ID NO: 30 or having at least 90%, at least 95%, or at least 99% identity with SEQ ID NO: 30, or a heavy chain constant region of an amino acid sequence as shown in SEQ ID NO: 31 or having at least 90%, at least 95%, or at least 99% identity with SEQ ID NO:

31.

5. A Taq DNA polymerase recombinant antibody, comprising an amino acid sequence selected from the group consisting of: (1) Light chain variable region CDR: SEQ ID NO: 56 to SEQ ID NO: 58; heavy chain variable region CDR: SEQ ID NO: 41 to SEQ ID NO: 43; heavy chain constant region: SEQ ID NO: 30; light chain constant region: SEQ ID NO: 34; (2) Light chain variable region CDR: SEQ ID NO: 56 to SEQ ID NO: 58; heavy chain variable region CDR: SEQ ID NO: 44 to SEQ ID NO: 46; heavy chain constant region: SEQ ID NO: 31; light chain constant region: SEQ ID NO: 34; (3) Light chain variable region CDR: SEQ ID NO: 50 to SEQ ID NO: 52; heavy chain variable region CDR: SEQ ID NO: 47 to SEQ ID NO: 49; heavy chain constant region: SEQ ID NO: 32; light chain constant region: SEQ ID NO: 33; (4) Light chain variable region CDR: SEQ ID NO: 53 to SEQ ID NO: 55; heavy chain variable region CDR: SEQ ID NO: 47 to SEQ ID NO: 49; heavy chain constant region: SEQ ID NO: 32; light chain constant region: SEQ ID NO:

33.

6. An antibody-modified Taq enzyme, wherein the Taq enzyme is modified by the recombinant antibody according to any one of claims 1 to 5.

7. In the preparation process of the antibody-modified Taq enzyme according to claim 6, the concentration ratio of the Taq enzyme to the antibody is 1:5 to 1:15, preferably 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14 and 1:15, and more preferably 1:

10.

8. A method for reducing nonspecific amplification products of PCR and qPCR reactions, comprising mixing the recombinant antibody, DNA polymerase, DNA template, upstream and downstream primers and buffer according to claims 1-5 or mixing the antibody-modified Taq enzyme, DNA template, upstream and downstream primers and buffer according to claims 6-7, and subjecting the mixture to an amplification reaction to amplify the DNA template.

9. The method according to claim 8, wherein the buffer substance comprises Tris, a metal salt and dNTP.

10. Use of the recombinant antibody according to claims 1-5 or the antibody-modified Taq enzyme according to claims 6-7 in improving the accuracy of PCR or qPCR reactions and / or the stability of premixed reagents.

11. A kit comprising the recombinant antibody according to claims 1-5 or the antibody-modified Taq enzyme according to claims 6-7.

Images