A Taq DNA polymerase recombinant antibody and its application

By preparing and applying recombinant antibodies to block Taq DNA polymerase activity, the problems of non-specific amplification and reagent stability in the PCR process were solved, achieving a more efficient and stable PCR reaction.

CN119591718BActive Publication Date: 2025-09-12NANJING VAZYME BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311159433.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-08
Publication Date
2025-09-12
Estimated Expiration
2043-09-08

AI Technical Summary

Technical Problem

The existing Taq DNA polymerase has problems in the PCR process, such as non-specific amplification, low amplification curve platform, poor multiple well reproducibility and poor reagent premix stability. In particular, the activity cannot be completely inhibited under low temperature conditions and the activation is not thorough at high temperature.

Method used

Recombinant antibodies are used to block the activity of Taq DNA polymerase. The recombinant antibodies contain heavy and light chains, variable regions and constant regions with specific amino acid sequences. The antibodies are prepared and purified through gene cloning technology and separated and purified by affinity chromatography technology to prepare antibody-modified Taq DNA polymerase that can inhibit enzyme activity at room temperature and gradually activate at high temperature.

Benefits of technology

It significantly reduces nonspecific amplification during PCR, improves reaction efficiency and reagent stability, and enhances amplification accuracy and repeatability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004440072900000101
    Figure BDA0004440072900000101
  • Figure BDA0004440072900000111
    Figure BDA0004440072900000111
  • Figure BDA0004440072900000112
    Figure BDA0004440072900000112
Patent Text Reader

Abstract

The present invention provides a recombinant antibody for Taq DNA polymerase, mainly involving recombinant antibodies whose heavy chain sequences and light chain sequences are derived from different species. The recombinant antibody provided by the present invention reduces nonspecific amplification products in PCR and qPCR reactions, improves the reaction accuracy and the stability of premixed reagents.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology and medical technology, and in particular to a recombinant antibody against Taq DNA polymerase and an application thereof. Background Art

[0002] Real-time PCR (Quantitative Real-time PCR) is a method that uses fluorescent chemicals to measure the total amount of product after each polymerase chain reaction (PCR) cycle during a DNA amplification reaction. It allows for the quantitative analysis of specific DNA sequences in a sample using internal or external references.

[0003] Taq DNA polymerase, a thermostable DNA polymerase isolated from the bacterium Thermus aquaticus, exhibits 5'→3' polymerization and exosome activity. Its use in qPCR is widely used in biochemical testing and in vitro diagnostics. Because Taq DNA polymerase is thermostable, it maintains a certain level of activity at room temperature. This 5'→3' exosome activity can cause degradation of primers, probes, or templates before PCR denaturation. Furthermore, its polymerization activity can lead to template or primer mismatches, resulting in nonspecific amplification. During subsequent PCR cycles, nonspecific products are further amplified, reducing the yield of the target product or even preventing the amplification of the target band. Furthermore, with the rapid development of qPCR technology in the nucleic acid testing industry, testers are paying particular attention to the stability of test reagents, including both long-term and short-term storage stability and the stability of the reagent premix. These factors often determine the reliability and validity of test results.

[0004] The hot start method can solve the above problems.

[0005] Currently, commonly used hot start methods include antibody method, chemical modification method, aptamer method, etc. Among them, the chemical modification method is more commonly used, and its activity is more completely blocked and will not introduce exogenous contamination. However, its activity is difficult to fully activate and requires high-temperature incubation for a long time. The activity of the aptamer method is also difficult to completely block, and the temperature often needs to be raised to above 45°C to restore the activity, making it difficult to achieve a strict hot start. Compared with the above two methods, the antibody method has certain advantages: the antibody-modified hot start enzyme requires a monoclonal antibody specific to the Taq enzyme. The Taq DNA polymerase antibody can completely inhibit the activity of the Taq DNA polymerase at room temperature, so that it does not exert polymerase activity under low temperature conditions. As the temperature rises, the activity is slowly released above 60°C. Heat shock at 95°C for 3-5 minutes can completely release the Taq enzyme activity.

[0006] Although a variety of antibody methods for blocking Taq DNA polymerase activity have been reported, these methods still have problems in practical applications: non-specific product amplification, low amplification curve platform, poor repeatability of multiple wells, and poor stability of reagent premixes. Summary of the Invention

[0007] The first object of the present invention is to provide a recombinant antibody for blocking Taq DNA polymerase activity, wherein the recombinant antibody comprises a heavy chain and a light chain.

[0008] In some embodiments, the recombinant antibody is selected from any type of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD.

[0009] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 as set forth in SEQ ID NO:56, or an amino acid sequence at least 90%, at least 95%, or at least 99% identical thereto, a light chain variable region CDR-L2 as set forth in SEQ ID NO:57, or an amino acid sequence at least 90%, at least 95%, or at least 99% identical thereto, and a light chain variable region CDR-L3 as set forth in SEQ ID NO:58, or an amino acid sequence at least 90%, at least 95%, or at least 99% identical thereto;

[0010] Alternatively, a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:40, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:40.

[0011] In some embodiments, the recombinant antibody comprises a heavy chain variable region CDR-H1 as set forth in SEQ ID NO:41, or an amino acid sequence at least 90%, at least 95%, or at least 99% identical thereto, a heavy chain variable region CDR-H2 as set forth in SEQ ID NO:42, or an amino acid sequence at least 90%, at least 95%, or at least 99% identical thereto, and a heavy chain variable region CDR-H3 as set forth in SEQ ID NO:43, or an amino acid sequence at least 90%, at least 95%, or at least 99% identical thereto;

[0012] Alternatively, a heavy chain variable region CDR-H1 as set forth in SEQ ID NO:44, or an amino acid sequence at least 90%, at least 95%, or at least 99% identical thereto, a heavy chain variable region CDR-H2 as set forth in SEQ ID NO:45, or an amino acid sequence at least 90%, at least 95%, or at least 99% identical thereto, and a heavy chain variable region CDR-H3 as set forth in SEQ ID NO:46, or an amino acid sequence at least 90%, at least 95%, or at least 99% identical thereto;

[0013] or, a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 35, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 35;

[0014] Alternatively, a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:36, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:36.

[0015] In some embodiments, the recombinant antibody comprises a heavy chain constant region as set forth in SEQ ID NO:30, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:30;

[0016] Alternatively, the heavy chain constant region of SEQ ID NO:31 or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:31.

[0017] In some embodiments, the recombinant antibody comprises a light chain constant region as shown in SEQ ID NO:34 or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34.

[0018] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as set forth in SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:56 to SEQ ID NO:58; a heavy chain variable region CDR-H1 to CDR-H3 as set forth in SEQ ID NO:41, SEQ ID NO:42, and SEQ ID NO:43, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:41 to SEQ ID NO:43; or a heavy chain variable region CDR-H1 to CDR-H3 as set forth in SEQ ID NO:44, SEQ ID NO:45, and SEQ ID NO:46, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:44 to SEQ ID NO:46. NO:46 has a heavy chain variable region CDR-H1 to CDR-H3 with an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical.

[0019] In some embodiments, the recombinant antibody comprises a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:35, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:35, or a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:36, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:36; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:40, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:40.

[0020] In some embodiments, the recombinant antibody further comprises a heavy chain constant region as set forth in SEQ ID NO:30, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:30, or a heavy chain constant region as set forth in SEQ ID NO:31, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:31; and a light chain constant region as set forth in SEQ ID NO:34, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34.

[0021] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as set forth in SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:56 to SEQ ID NO:58; a heavy chain variable region CDR-H1 to CDR-H3 as set forth in SEQ ID NO:41, SEQ ID NO:42, and SEQ ID NO:43, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:41 to SEQ ID NO:43; or a heavy chain variable region CDR-H2 to CDR-H3 as set forth in SEQ ID NO:44, SEQ ID NO:45, and SEQ ID NO:46, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:44 to SEQ ID NO:46. NO:46 comprises a heavy chain variable region CDR-H1 to CDR-H3 having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:30; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:30, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:30, or a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:31, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:31; and a light chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:34, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34.

[0022] In some embodiments, the recombinant antibody comprises a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:35, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:35; or a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:36, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:36; a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:40, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:40; or a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:30, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:30. NO:30, or a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:31 or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:31; or a light chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:34 or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34.

[0023] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as shown in SEQ ID NO: 56, SEQ ID NO: 57 and SEQ ID NO: 58, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 56 to SEQ ID NO: 58; a heavy chain variable region CDR-H1 to CDR-H3 as shown in SEQ ID NO: 41, SEQ ID NO: 42 and SEQ ID NO: 43, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 41 to SEQ ID NO: 43; and a heavy chain variable region CDR-H2 to CDR-H3 as shown in SEQ ID NO: 30, or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 30. NO:30 has a heavy chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical; a light chain constant region comprising an amino acid sequence as shown in SEQ ID NO:34 or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34.

[0024] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as set forth in SEQ ID NO:56, SEQ ID NO:57, and SEQ ID NO:58, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:56 to SEQ ID NO:58; a heavy chain variable region CDR-H1 to CDR-H3 as set forth in SEQ ID NO:44, SEQ ID NO:45, and SEQ ID NO:46, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:44 to SEQ ID NO:46; and a heavy chain variable region CDR-H2 to CDR-H3 as set forth in SEQ ID NO:31 or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:31. NO:31 has a heavy chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical; a light chain constant region comprising an amino acid sequence as shown in SEQ ID NO:34 or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34.

[0025] In some embodiments, the recombinant antibody comprises a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:35, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:35; a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:40, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:40; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:30, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:30; and a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:34, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34. NO:34 has a light chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical.

[0026] In some embodiments, the recombinant antibody comprises a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:36, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:36; a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO:40, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:40; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:31, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:31; and a light chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:34, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:34. NO:34 has a light chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical.

[0027] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 comprising an amino acid sequence as set forth in SEQ ID NO:50 to SEQ ID NO:52, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:50 to SEQ ID NO:52; a heavy chain variable region CDR-H1 to CDR-H3 comprising an amino acid sequence as set forth in SEQ ID NO:47 to SEQ ID NO:49, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:47 to SEQ ID NO:49; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:32, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:32; and a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO:33, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:33. NO:33 or a light chain constant region of an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:33.

[0028] In some embodiments, the recombinant antibody comprises a light chain variable region CDR-L1 to CDR-L3 as set forth in SEQ ID NO:53, SEQ ID NO:54, and SEQ ID NO:55, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:53 to SEQ ID NO:55; a heavy chain variable region CDR-H1 to CDR-H3 as set forth in SEQ ID NO:47, SEQ ID NO:48, and SEQ ID NO:49, or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:47 to SEQ ID NO:49; and a heavy chain variable region CDR-H2 to CDR-H3 as set forth in SEQ ID NO:32 or an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:32. NO:32 has a heavy chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical; a light chain constant region comprising an amino acid sequence as shown in SEQ ID NO:33 or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO:33.

[0029] In some embodiments, the recombinant antibody comprises a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 37, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 37; a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 38, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 38; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO: 32, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 32; and a light chain constant region comprising an amino acid sequence as set forth in SEQ ID NO: 33, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 33. NO:33 has a light chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical.

[0030] In some embodiments, the recombinant antibody comprises a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 37, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 37; a light chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 39, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 39; a heavy chain constant region comprising an amino acid sequence as set forth in SEQ ID NO: 32, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 32; and a light chain constant region comprising an amino acid sequence as set forth in SEQ ID NO: 33, or at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to SEQ ID NO: 33. NO:33 has a light chain constant region having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical.

[0031] The present invention also provides a method for preparing an antibody, comprising: cDNA preparation—PCR—enzyme digestion and ligation—expression vector transformation and amplification—sequencing and identification—large-scale expression vector preparation—and transformation. Specifically, this involves ligating the target gene to a prokaryotic or eukaryotic target expression vector through gene cloning techniques, transforming the target expression vector into host cells, and achieving soluble expression. This further involves isolating and purifying the target protein through affinity chromatography.

[0032] In some embodiments, the host cell is Escherichia coli, yeast, or CHO cell, preferably CHO cell. The affinity protein chromatography is selected from nickel affinity chromatography, GST-tag affinity chromatography, MBP-tag affinity chromatography, Protein A affinity chromatography, FLAG-tag affinity chromatography, Strep-tag affinity chromatography, heparin affinity chromatography, preferably Protein A affinity chromatography. The expression vector contains multiple cloning restriction sites, including HindIII, BamHI, and EcoRI.

[0033] A second object of the present invention is to provide an antibody-modified Taq DNA polymerase, specifically a Taq enzyme modified with the antibody of the present invention. This Taq enzyme can reduce nonspecific amplification caused by template or primer mismatches during PCR and qPCR, significantly improving reaction efficiency.

[0034] In some embodiments, when preparing the antibody-modified Taq DNA polymerase, the concentration ratio of Taq DNA polymerase to recombinant antibody is 1:5 to 1:15, preferably 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, and 1:15, and more preferably 1: 10. The recombinant antibody binds to Taq DNA polymerase, thereby inhibiting the activity of Taq DNA polymerase or a Taq DNA polymerase mutant.

[0035] The third object of the present invention is to provide a method for reducing non-specific amplification products in PCR or qPCR reactions, specifically involving the use of the first purpose DNA polymerase recombinant antibody and DNA polymerase or the use of the second purpose antibody-modified Taq DNA polymerase.

[0036] The present invention provides a method for reducing non-specific products in a PCR or qPCR reaction, comprising mixing a recombinant DNA polymerase antibody, Taq DNA polymerase, a DNA template, upstream and downstream primers, and a buffer according to the first purpose, or a Taq DNA polymerase modified with the antibody according to the second purpose, a DNA template, upstream and downstream primers, and a buffer, reacting the mixture to amplify the DNA template.

[0037] In some embodiments, the DNA template is selected from gDNA, cDNA, and plasmid DNA.

[0038] In some embodiments, the PCR or qPCR amplification reaction includes pre-denaturation and cycling reaction, the pre-denaturation temperature is 90-98°C, for example, 92-96°C, for example, 95°C, and incubation is 20s-60s, for example, 25s-40s, for example, 30s; the cycling reaction includes denaturation at 95°C for 8-12s, annealing and extension at 55-65°C for 10-30s, for a total of 40-50 cycles.

[0039] A fourth object of the present invention is to provide use of the recombinant antibody of the first object or the antibody-modified TaqDNA polymerase of the second object in improving the accuracy of PCR or qPCR reactions and / or the stability of PCR or qPCR premix reagents.

[0040] In some embodiments, the reaction precision is manifested in replicate well reproducibility.

[0041] In some embodiments, the PCR premix reagent includes a buffer substance, upstream and downstream primers, a DNA template, and a DNA polymerase, wherein the DNA template is selected from gDNA, cDNA, and plasmid DNA.

[0042] In some embodiments, the qPCR premix reagent includes a buffer substance, upstream and downstream primers, a DNA template, a DNA polymerase, and a probe primer, wherein the DNA template is selected from gDNA, cDNA, and plasmid DNA.

[0043] The sixth object of the present invention is to provide a composition or kit comprising the first object Taq enzyme recombinant antibody or the second object antibody-modified Taq DNA polymerase.

[0044] In some embodiments, the composition or kit further comprises a buffer substance, a metal salt, and dNTPs.

[0045] Beneficial effects of the present invention

[0046] The Taq enzyme recombinant antibody provided by the present invention can effectively block the activity of Taq DNA polymerase at room temperature, thereby reducing nonspecific amplification caused by template or primer mismatch during amplification, significantly improving reaction efficiency, and at the same time improving the stability of detection reagents. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 : Amplification curves showing the effect of hot-start Taq DNA polymerase on the stability of reagent premixes for recombinant antibody preparation; DETAILED DESCRIPTION

[0048] The present disclosure is described in detail below with reference to examples, but the embodiments of the present disclosure are not limited thereto. Obviously, the examples described below are only some examples of the present disclosure. For those skilled in the art, other similar examples obtained without creative work fall within the scope of protection of the present disclosure.

[0049] Unless otherwise defined, all terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure pertains. All patents, patent applications, and publications cited throughout the disclosure are incorporated herein by reference in their entirety. If multiple definitions exist for a term herein, those definitions in this section shall prevail.

[0050] The technical solutions provided by the present disclosure are described in detail below in conjunction with the embodiments, but they should not be understood as limiting the scope of protection of the present disclosure.

[0051] Example 1: Exemplary method for preparing antibodies against Taq DNA polymerase

[0052] 1. Exemplary Method for Preparing Taq DNA Polymerase-Resistant Hybridoma Cells

[0053] The female Balb / c mice (6 to 10 weeks old) used in this example were purchased from Yangzhou University, and SP2 / 0 myeloma cells were from Vazyme.

[0054] 1.1. Immunization of mice

[0055] Six six-week-old Balb / c mice were immunized with purified Taq enzyme (Vazyme#P101) as antigen by subcutaneous multi-point injection. The immunization dose for each mouse was 100 μg protein. The mice were immunized once a week for two consecutive months. After the third immunization and before each subsequent immunization, orbital blood was collected and the serum titer was detected by enzyme-linked immunosorbent assay (ELISA).

[0056] 1.2. Serum titer detection

[0057] The purified Taq enzyme was used as the antigen, and the antigen was diluted to 1 μg / mL with coating buffer PBS. 100 μl / well was added to the ELISA plate, sealed with film, and coated overnight at 4°C. The next day, the liquid in the plate was discarded, the plate was patted dry, and 150 μl of 5% skim milk powder was added to each well for blocking at room temperature for more than 2 hours. The plate was washed three times with washing buffer PBST [PBS (pH 7.4) containing 0.05% Tween-20], and 100 μl of serially diluted serum was added. , 37℃ for 1-2h; pat dry, wash the plate three times with PBST, add 100μl of secondary antibody working solution to each well (HRP-labeled goat anti-mouse IgG diluted 1:3000 with antibody diluent, incubate at 37℃ for 1h, take out and pat dry, wash the plate three times with PBST, add 100μl of single-component TMB substrate to each well, incubate at room temperature for 5-20min. Add 50μl of stop solution (0.5MH2SO4) to each well, and read the absorbance at 450nm / 630nm on a microplate reader.

[0058] 1.3 Cell fusion and screening

[0059] Three days before cell fusion, 100 μg of Taq enzyme (dissolved in PBS) was injected into the mouse peritoneal cavity again. Three to five days after immunization, the mice were dissected and spleen cells were collected to prepare a cell suspension of appropriate concentration. SP2 / 0 myeloma cells and spleen cells were then placed in a centrifuge tube at a ratio of 1:4, mixed thoroughly, and centrifuged before the supernatant was removed and added to the PEG solution for cell fusion. After obtaining hybridoma cells, the obtained hybridoma cells were suspended in HAT medium containing feeder cells for screening and then cultured in 96-well plates to obtain hybridoma master clones. All fused cells were plated in 96-well plates for cell culture. The supernatant of the master clone cells was tested by indirect ELISA, and positive clones were selected. Hybridoma master clones with higher affinity were prioritized for cryopreservation or further expansion.

[0060] 2. Expression Plasmid Construction

[0061] In this example, restriction endonucleases were purchased from NEB; RNA extraction kit, reverse transcription kit, plasmid extraction and gel recovery kit, and pUC19-T vector were from Vazyme.

[0062] Primer synthesis and gene sequencing were completed by Sangon Biotechnology Co., Ltd.

[0063] 2.1. Anti-Taq1 Antibody Gene Preparation

[0064] Obtain sufficient hybridoma cells for total RNA extraction. For specific assay steps, refer to the corresponding kit instructions. The specific procedures are as follows: 1) Extract total RNA from hybridoma cells (FastPure Cell / Tissue Total RNA Isolation Kit); 2) Synthesize cDNA by RT-PCR (HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper)); 3) Amplify the heavy and light chains by PCR using heavy and light chain primers, respectively, with the cDNA as template; 4) Electrophorese and gel extraction (FastPure Gel DNA Extraction MiniKit) to obtain heavy and light chain fragments; 5) Transform the heavy and light chains into plasmid vectors (ClonExpress Ultra One Step Cloning Kit V2), transform into E. coli DH5α, and submit for sequencing.

[0065] 2.2 Sequence Analysis of Anti-Taq1 Antibody Variable Region Genes

[0066] The gene sequences obtained by the above sequencing were analyzed in the Kabat antibody database and analyzed using VNTI11.5 software to confirm that the genes amplified by the heavy chain and light chain primer pairs were correct.

[0067] 2.3 Construction of Antibody Expression Plasmid

[0068] Based on the antibody gene sequencing results from pUC19-T, primers specific for the heavy and light chain genes of the Anti-Taq1 antibody were designed, each with a HindIII and EcoRI restriction site at each end. PCR amplification was used to amplify a 0.705KB light chain gene fragment and a 0.834kb heavy chain gene fragment. The pcDNA 3.1 vector was used as the recombinant antibody eukaryotic expression vector. The eukaryotic expression vector was double-digested with HindIII and EcoRI. The linearized vector was purified, and the heavy and light chain gene fragments were ligated into the purified linearized vector to generate the heavy and light chain expression plasmids, respectively.

[0069] 3. CHO cell transfection

[0070] The plasmid was diluted to 30ug / 100ul with sterile water, and the heavy chain and light chain were mixed at a mass ratio of 1:1. 100ul of mixed plasmid was mixed with 800ul of 1×10 7cells / ml of CHO cells were mixed and transferred to an electroporation cup after even mixing. Samples were taken and counted on the 3rd, 5th and 7th days. Samples were collected on the 7th day, and the culture medium after transfection was centrifuged and affinity purified using a protein A affinity chromatography column to obtain the antibody protein.

[0071] The preparation methods of other antibodies Anti-Taq 2, Anti-Taq 3, Anti-Taq 4 and Anti-Taq 5 are similar to Anti-Taq 1. The sequences of Taq enzyme antibodies are shown in Table 1.

[0072] Table 1: Sequences of Taq enzyme antibodies

[0073]

[0074]

[0075] Example 2: Specificity test of hot-start TaqDNA polymerase prepared with different antibodies for qPCR reaction

[0076] (1) Preparation of antibody solution: Prepare the antibody solution according to the grouping in Table 4.

[0077] (2) Preparation of 2 U / μL hot-start enzyme: Mix the enzyme and antibody at a ratio of 1:10. After standing at room temperature for 10 min, add Taq storage buffer (containing 50% sterile glycerol) to make the concentration of the hot-start enzyme 2 U / μL.

[0078] (3) Amplification reaction: Prepare the amplification reaction system according to Table 2, with three replicates for each system, and perform amplification according to the procedure in Table 3. The effect of hot-start enzymes blocked with different antibodies on the specificity of qPCR was determined by comparing the number of nonspecific peaks in the melting curves of the experimental group (hot-start enzymes blocked with different antibodies) and the control group (Taq enzymes without antibody blocking).

[0079] Table 2: Amplification reaction system

[0080]

[0081]

[0082] a, b, c: Vazyme#P101; d: Vazyme#QN213; e: Vazyme#JC2002

[0083] Prepare the qPCR amplification system according to Table 1 and mix well. The primer and probe sequences are as follows:

[0084] System 1-F: (SEQ ID NO: 59): TTTTAACTCCTTTGCCCAATAAGG;

[0085] System 1-R: (SEQ ID NO: 60): TTAGCAACAGAAACCGTGGAAA;

[0086] System 1-P: (SEQ ID NO: 61): 5'FAM-CTGCCTGGAGCCCGTAGCCA-3'BHQ1;

[0087] System 2-F: (SEQ ID NO: 62): CAAGACAGGACACTGCGGAAA;

[0088] System 2-R: (SEQ ID NO: 63): TTACTACGGCCGGAGCAGAT;

[0089] System 2-P: (SEQ ID NO: 64): 5'FAM-TGCCGCCGCACACTGTCTGA-3'BHQ1;

[0090] System 3-F: (SEQ ID NO: 65): TGCTGAAATCTGCAACACTGTGTA;

[0091] System 3-R: (SEQ ID NO: 66): AATAGGAGTGGCTTCGAAGTTGA;

[0092] System 3-P: (SEQ ID NO: 67): 5'FAM-CCTGCCATCCTGCCCACCATTTATACC-3'BHQ1;

[0093] System 4-F: (SEQ ID NO: 68): GAGACATTCTCCTCAATCATTTAACATT;

[0094] System 4-R: (SEQ ID NO: 69): AAGGAATAAAAGGAGAGTAATAGAAAAGTGTGT;

[0095] System 4-P: (SEQ ID NO: 70): 5'FAM-TGCTGTAGCCACCCAGAACAGGTTATGT-3'BHQ1;

[0096] The templates for systems 1, 2, and 3 were all cDNA diluted 10-fold from HELA cells, and the template for system 4 was 1 ng / μL 293 genomic DNA.

[0097] Table 3: Amplification Procedure

[0098]

[0099]

[0100] After amplification, the effect of hot-start enzymes blocked with different antibodies on qPCR specificity was determined based on the number of nonspecific peaks in the melting curve of each system. The results are shown in Table 4.

[0101] Table 4: Number of non-specific peaks of hot-start Taq enzyme blocked with different antibodies

[0102] System 1 System 2 System 3 System 4 total Taq 2 3 3 3 11 Taq+Anti-Taq 1 2 0 2 3 5 Taq+Anti-Taq 2 2 1 2 3 8 Taq+Anti-Taq 3 2 2 1 3 8 Taq+Anti-Taq4 0 0 1 0 1 Taq+Anti-Taq5 0 0 0 1 1

[0103] Result analysis: As shown in Table 4, the addition of different antibodies can block Taq enzyme activity at room temperature. The two recombinant antibodies Taq+Anti-Taq4 and Taq+Anti-Taq5 have one non-specific peak each, while the specificity of other antibodies is poor when blocked.

[0104] Example 3: Testing of hot-start Taq DNA polymerase prepared with different antibodies to improve the reproducibility of qPCR reactions

[0105] The group settings were the same as in Example 2. The amplification reaction systems are shown in Table 2. Ten replicate wells were prepared for each system, and amplification was performed according to the procedures in Table 3. The effect of the hot-start enzyme blocked with the recombinant antibody on the reproducibility of qPCR replicates was determined by comparing the CV values ​​of the ten replicate wells in the experimental group (hot-start enzyme blocked with the recombinant antibody) and the control group (Taq enzyme without antibody blocking).

[0106] Table 5: CV values ​​of replicate wells

[0107]

[0108]

[0109] Result analysis: As shown in Table 5, compared with the unblocked Taq enzyme, the reproducibility between the amplification replicates of all hot-start enzymes prepared with different antibodies was improved to varying degrees. When the recombinant antibodies anti-Taq4 and anti-taq5 were used to block the Taq DNA polymerase, the reproducibility between the 10 replicates of each system was the best; when the other antibodies were used to block the Taq DNA polymerase, the reproducibility between the replicates was poor.

[0110] Example 4: Testing of improving the qPCR reaction platform value by hot-start Taq DNA polymerase prepared with different antibodies

[0111] The group settings were the same as in Example 2. The amplification reaction systems are shown in Table 2. Three replicate wells were prepared for each system, and amplification was performed according to the procedures in Table 3. The average plateau value of the three replicate wells for each system was calculated. The difference in plateau values ​​between the experimental group (hot-start enzymes blocked with different antibodies) and the control group (Taq enzyme without antibody blocking) under the same system was compared (ΔRn = Rn experimental group - Rn control group) / Rn control group) to determine the effect of hot-start enzymes blocked with different antibodies on the qPCR reaction plateau value.

[0112] Table 6: qPCR reaction plateau values

[0113] Platform Value System 1 System 2 System 3 System 4 Taq 0.0% 0.0% 0.0% 0.0% Taq+Anti-Taq 1 10.3% 15.9% 15.6% 14.9% Taq+Anti-Taq 2 11.2% 13.5% 10.3% 16.4% Taq+Anti-Taq 3 14.3% 12.6% 16.4% 17.6% Taq+Anti-Taq4 27.4% 29.6% 30.1% 25.6% Taq+Anti-Taq5 29.6% 31.5% 25.8% 30.4%

[0114] Result analysis: As shown in Table 6, compared with the unblocked Taq enzyme, the platform of the hot-start enzymes prepared with all different antibodies was improved to varying degrees. Among them, when the recombinant antibodies anti-Taq4 and anti-Taq5 were used to block the Taq DNA polymerase, the qPCR amplification reaction platform was significantly improved. When the other antibodies were used to block the Taq DNA polymerase, although the platform value was improved, the effect was weaker than that of the hot-start Taq DNA polymerase prepared with the recombinant antibodies.

[0115] Example 5: Stability test of hot-start Taq DNA polymerase premixes prepared with different antibodies

[0116] The group setting was the same as that in Specific Example 2. Hot start enzymes prepared with different antibodies were used to prepare complete premixes containing primers and probes, which were placed at 37°C for 7 days. The control group was a -20°C sample.

[0117] Table 7: Preparation of premix

[0118]

[0119]

[0120] a, b, c: Vazyme#P101; d: Vazyme#QN213;

[0121] Three replicate wells were prepared for each system, and amplification was performed according to the protocol in Table 3. Amplification curves were used to compare the sensitivity and plateau values ​​of the experimental group (treated at 37°C for 7 days) and the control group (Taq enzyme without antibody blocking) under the same system to determine the effect of hot-start enzymes blocked with different types of antibodies on the stability of the qPCR reagent premix.

[0122] Result analysis: Figure 1It can be seen that compared with the unblocked Taq enzyme, the premix stability of the hot-start enzymes prepared with all different antibodies was improved to varying degrees. Among them, when the recombinant antibodies anti-Taq4 and anti-taq5 were used to block the Taq DNA polymerase, the premix stability of the qPCR reaction reagent was the best, specifically, the sensitivity and platform value of the premixed reagent did not change significantly before and after being treated at 37°C for 7 days; while when anti-Taq1, anti-Taq2 and anti-Taq3 were used to block the Taq DNA polymerase respectively, the stability of the premixed reagent became worse after being treated at 37°C for 7 days, and the platform value showed a significant decrease compared with the unpressurized control.

Claims

1. A recombinant antibody to Taq DNA polymerase, comprising a light chain variable region CDR-L1 as set forth in SEQ ID NO: 56, a light chain variable region CDR-L2 as set forth in SEQ ID NO: 57, and a light chain variable region CDR-L3 as set forth in SEQ ID NO: 58, and a heavy chain variable region CDR-H1 as set forth in SEQ ID NO: 41, a heavy chain variable region CDR-H2 as set forth in SEQ ID NO: 42, and a heavy chain variable region CDR-H3 as set forth in SEQ ID NO: 43; Or, the antibody comprises a light chain variable region CDR-L1 as shown in SEQ ID NO:56, a light chain variable region CDR-L2 as shown in SEQ ID NO:57, and a light chain variable region CDR-L3 as shown in SEQ ID NO:58, and a heavy chain variable region CDR-H1 as shown in SEQ ID NO:44, a heavy chain variable region CDR-H2 as shown in SEQ ID NO:45, and a heavy chain variable region CDR-H3 as shown in SEQ ID NO:

46.

2. The recombinant antibody according to claim 1, further comprising a light chain constant region as shown in SEQ ID NO: 34 and a heavy chain constant region as shown in SEQ ID NO: 30, or a light chain constant region as shown in SEQ ID NO: 34 and a heavy chain constant region as shown in SEQ ID NO:

31.

3. The recombinant antibody according to any one of claims 1 or 2, comprising an amino acid sequence selected from the group consisting of: (1) The light chain variable regions CDRL1-L3 are SEQ ID NO:56 to SEQ ID NO:58; the heavy chain variable regions CDRH1-H3 are SEQ ID NO:41 to SEQ ID NO:43; the heavy chain constant region is SEQ ID NO:30; the light chain constant region is SEQ ID NO:34; (2) The light chain variable regions CDRL1-L3 are SEQ ID NO:56 to SEQ ID NO:58, respectively; the heavy chain variable regions CDRH1-H3 are SEQ ID NO:44 to SEQ ID NO:46, respectively; the heavy chain constant region is SEQ ID NO:31; and the light chain constant region is SEQ ID NO:

34. 4 . An antibody-modified Taq enzyme, wherein the Taq enzyme is modified with the recombinant antibody according to claim 1 . 5 . The Taq enzyme according to claim 4 , wherein during the preparation process, the concentration ratio of the Taq enzyme to the antibody is 1:5 to 1:

15.

6. The Taq enzyme according to claim 5, wherein the concentration ratio of Taq enzyme to antibody during the preparation of the Taq enzyme is selected from 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14 or 1:

15. The Taq enzyme according to claim 5 , wherein the concentration ratio of Taq enzyme to antibody during the preparation of the Taq enzyme is 1:

10.

8. A method for reducing nonspecific amplification products in PCR and qPCR reactions, comprising mixing the recombinant antibody according to any one of claims 1 to 3, Taq DNA polymerase, a DNA template, upstream and downstream primers, and a buffer, or mixing the antibody-modified Taq enzyme according to any one of claims 4 to 7, a DNA template, upstream and downstream primers, and a buffer, and subjecting the mixture to an amplification reaction to amplify the DNA template, wherein the method is for non-diagnostic purposes.

9. The method according to claim 8, wherein the buffer comprises Tris, a metal salt and dNTPs.

10. Use of the recombinant antibody according to any one of claims 1 to 3 or the antibody-modified Taq enzyme according to claims 4 to 7 to improve the accuracy of PCR or qPCR reactions and / or the stability of premix reagents.

11. A kit comprising the recombinant antibody according to any one of claims 1 to 3 or the antibody-modified Taq enzyme according to any one of claims 4 to 7.

Citation Information

Patent Citations

  • Polymerase-resistant monoclonal antibody and application thereof

    CN114787193A

  • Monoclonal antibody for neutralizing Taq DNA polymerase polymerization activity and application thereof

    CN115536748A