Glucose dehydrogenase mutant, its preparation method, and its use in the synthesis of NMNH

By directionally mutating glucose dehydrogenase to form a highly efficient glucose dehydrogenase mutant, the problem of high synthesis cost of NMNH in existing technologies has been solved, realizing efficient, green and environmentally friendly NMNH preparation, and promoting its commercial application and health improvement.

CN119592531BActive Publication Date: 2026-05-26SHANGHAI YUSONG BIOTECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311131954.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-04
Publication Date
2026-05-26
Estimated Expiration
2043-09-04

AI Technical Summary

Technical Problem

Existing methods for synthesizing NMNH suffer from high raw material costs and high quality loss rates, which limit the commercial application of NMNH.

Method used

By performing targeted mutations on glucose dehydrogenase, particularly at specific sites in the amino acid sequence, glucose dehydrogenase mutants are created to catalyze the synthesis of NMNH from NMN, thereby improving the enzyme's catalytic activity and efficiency.

Benefits of technology

The efficient catalytic synthesis of NMNH from NMN was achieved, with a yield of 41.2 g/L. The biological method for preparing NMNH is green and environmentally friendly, which promotes the industrial application of NMNH and helps to increase NAD+ levels in organisms and improve health.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004430554910000131
    Figure BDA0004430554910000131
  • Figure BDA0004430554910000141
    Figure BDA0004430554910000141
  • Figure BDA0004430554910000151
    Figure BDA0004430554910000151
Patent Text Reader

Abstract

This invention relates to the fields of genetic engineering and enzyme engineering, and particularly to glucose dehydrogenase mutants, their preparation methods, and their use in the synthesis of NMNH. The glucose dehydrogenase mutants are obtained by mutation at one or more sites at positions 39, 51, 75, 93, 157, 195, 208, or 236 of the amino acid sequence of the wild-type glucose dehydrogenase. The glucose dehydrogenase mutants of this invention exhibit high catalytic activity and can efficiently catalyze the synthesis of NMNH from NMN. Using the constructed glucose dehydrogenase mutants to catalyze the synthesis of NMNH from NMN, the yield of NMNH can reach 41.2 g / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and enzyme engineering, and in particular to glucose dehydrogenase mutants, their preparation methods, and their use in the synthesis of NMNH. Background Technology

[0002] NAD+ (nicotinamide adenine dinucleotide) plays a vital role in human health. Boosting NAD+ levels in the body is crucial for maintaining overall health. Due to its relatively large molecular weight, NAD+ has difficulty entering cells. Appropriate supplementation with NAD+ precursors can help increase NAD+ levels in the body, thereby reducing the incidence of disease. Nicotinamide mononucleotide (NMN) and reduced nicotinamide mononucleotide (NMNH) are two NAD+ precursors, and supplementation with these precursors has been shown to effectively increase NAD+ levels. NMNH is the reduced form of NMN and is a more effective NAD+ enhancer than NMN.

[0003] Currently, there are relatively few technologies for synthesizing NMNH, with chemical synthesis and enzymatic catalysis being the two most reported methods. Compared to chemical methods, enzymatic catalysis offers the advantage of being environmentally friendly. The currently reported enzymatic synthesis of NMNH involves NADH pyrophosphatase catalyzing the production of NMNH and AMP from NADH (reduced nicotinamide adenine dinucleotide). This method uses NADH as a substrate, resulting in expensive raw materials and a mass loss rate of up to 50%. From an economic perspective, this technology has low commercial value. Current research on NMNH synthesis is severely limited, significantly restricting the commercialization of this important substance. Enzymatic catalysis relies primarily on highly efficient functional enzymes. Therefore, for this important substance NMNH, screening suitable dehydrogenases to catalyze the reduction of NMN to NMNH, and performing targeted mutations on the screened dehydrogenases to improve their activity, will enable the efficient synthesis of NMNH and promote its commercial application, playing a vital role in human health. Summary of the Invention

[0004] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a glucose dehydrogenase mutant, its preparation method and its use in the synthesis of NMNH, in order to solve the problems in the prior art.

[0005] To achieve the above and other related objectives, the present invention provides a glucose dehydrogenase mutant, which is obtained by mutation at one or more sites at positions 39, 51, 75, 93, 157, 195, 208, or 236 of the amino acid sequence of wild-type glucose dehydrogenase.

[0006] The amino acid sequence of the wild-type glucose dehydrogenase is shown in SEQ ID NO.1.

[0007] In some embodiments of the present invention, the glucose dehydrogenase mutant is obtained by a combined mutation at positions 39 and 93 of the wild-type glucose dehydrogenase amino acid sequence, or a combined mutation at positions 39 and 75, or a combined mutation at positions 39 and 157, or a combined mutation at positions 39, 93 and 157, or a combined mutation at positions 39, 93 and 75, or a combined mutation at positions 93 and 208, or a combined mutation at positions 51 and 157, or a combined mutation at positions 93 and 157.

[0008] In some embodiments of the present invention, the glucose dehydrogenase mutant is obtained by performing any of the following mutations on the amino acid sequence of the wild-type glucose dehydrogenase shown in SEQ ID NO.1: Y39Q single mutation, Y39N single mutation, Y39Q / A93K combined mutation, Y39Q / I75L combined mutation, Y39N / I75S combined mutation, Y39Q / A93K / H157R combined mutation, and Y39N / A93P / H157Q combined mutation.

[0009] The present invention also provides an isolated polynucleotide encoding the aforementioned glucose dehydrogenase mutant.

[0010] The present invention also provides a nucleic acid construct comprising the isolated polynucleotides described above.

[0011] The present invention also provides a cell containing the aforementioned nucleic acid construct or a genome integrated with an exogenous polynucleotide such as any one of SEQ ID No. 30 to 32.

[0012] The present invention also provides a method for preparing the glucose dehydrogenase mutant, comprising the following steps: culturing the cells, inducing the expression of the glucose dehydrogenase mutant, and collecting and separating the bacterial cells after induction to obtain the enzyme solution of the glucose dehydrogenase mutant.

[0013] The present invention also provides the use of the glucose dehydrogenase mutant, the isolated polynucleotide, the nucleic acid construct, and the cells in the preparation of NMNH.

[0014] The present invention also provides a method for preparing NMNH, the method comprising using the glucose dehydrogenase mutant to catalyze NMN, thereby obtaining NMNH.

[0015] As described above, the glucose dehydrogenase mutant of the present invention, its preparation method, and its use in the synthesis of NMNH have the following beneficial effects: high catalytic activity, capable of efficiently catalyzing the synthesis of NMNH from NMN, enabling the biological preparation of NMNH; using the constructed glucose dehydrogenase mutant to catalyze the synthesis of NMNH from NMN, the yield of NMNH can reach 41.2 g / L; the biological preparation technology of NMNH is green and environmentally friendly, without introducing toxic chemical reagents into the reaction system; it is conducive to the industrial development of NMNH; NMNH is an effective precursor of NAD+, and based on the reported efficacy of NAD+, the commercial application of NMNH can effectively improve human health and reduce the occurrence of diseases. Attached Figure Description

[0016] Figure 1 The image shown is a liquid chromatogram of the NMN to NMNH synthesis reaction catalyzed by the glucose dehydrogenase mutant of the present invention after 6 hours.

[0017] Figure 2 The image shown is a mass spectrum of NMNH synthesized by the glucose dehydrogenase mutant of the present invention. Detailed Implementation

[0018] The present invention provides a glucose dehydrogenase mutant, which is obtained by mutation at one or more sites at positions 39, 51, 75, 93, 157, 195, 208 or 236 of the amino acid sequence of wild-type glucose dehydrogenase.

[0019] In some preferred embodiments of the present invention, the mutation sites are selected from positions 39, 75, 93, 157, and 195. Mutations at these sites result in glucose dehydrogenase mutants that catalyze the synthesis of NMNH from NMN with a high conversion rate.

[0020] The wild-type glucose dehydrogenase is a microbial glucose dehydrogenase. The microorganisms are selected from Escherichia coli, Streptomyces, Bacillus subtilis, Salmonella typhi, mycobacteria, yeast, mold, etc.

[0021] In some embodiments of the present invention, the amino acid sequence of the wild-type glucose dehydrogenase is shown in SEQ ID NO. 1.

[0022] In some embodiments of the present invention, the glucose dehydrogenase mutant is obtained by a combined mutation at positions 39 and 93 of the wild-type glucose dehydrogenase amino acid sequence, or a combined mutation at positions 39 and 75, or a combined mutation at positions 39 and 157, or a combined mutation at positions 39, 93 and 157, or a combined mutation at positions 39, 93 and 75, or a combined mutation at positions 93 and 208, or a combined mutation at positions 51 and 157, or a combined mutation at positions 93 and 157.

[0023] In some embodiments of the present invention, the mutation at position 39 is selected from Y39Q or Y39N, that is, the tyrosine at position 39 is mutated to glutamine or asparagine.

[0024] In some embodiments of the present invention, the mutation at position 51 is selected from E51Q, that is, the glutamic acid at position 51 is mutated to glutamine.

[0025] In some embodiments of the present invention, the mutation at position 75 is selected from I75S or I75L, that is, the isoleucine at position 75 is mutated to serine or leucine.

[0026] In some embodiments of the present invention, the mutation at position 93 is selected from A93K or A93P, that is, the alanine at position 93 is mutated to lysine or proline.

[0027] In some embodiments of the present invention, the mutation at position 157 is selected from H157R or H157Q, that is, the histidine at position 157 is mutated to arginine or glutamine.

[0028] In some embodiments of the present invention, the mutation at position 195 is selected from I195E or I195L, that is, the isoleucine at position 195 is mutated to glutamic acid or leucine.

[0029] In some embodiments of the present invention, the mutation at position 208 is selected from D208N or D208Y, that is, the aspartic acid at position 208 is mutated to asparagine or tyrosine.

[0030] In some embodiments of the present invention, the mutation at position 236 is selected from A236V, that is, the alanine at position 236 is mutated to valine.

[0031] In some embodiments of the present invention, the glucose dehydrogenase mutant is obtained by performing any of the following mutations on the amino acid sequence of the wild-type glucose dehydrogenase shown in SEQ ID NO.1: Y39Q single mutation, Y39N single mutation, Y39Q / A93K combined mutation, Y39Q / I75L combined mutation, Y39N / I75S combined mutation, Y39Q / A93K / H157R combined mutation, and Y39N / A93P / H157Q combined mutation.

[0032] The present invention also provides an isolated polynucleotide encoding the aforementioned glucose dehydrogenase mutant.

[0033] In some embodiments of the present invention, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO.30: aactatcaaagtaat (SEQ ID NO.30).

[0034] In some embodiments of the present invention, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO.30-31: aataataagggtctt (SEQ ID NO.31).

[0035] In some embodiments of the present invention, the nucleotide sequence of the polynucleotide is shown in SEQ ID NO.32: (SEQ ID NO.32).

[0036] The present invention also provides a nucleic acid construct comprising the isolated polynucleotides described above.

[0037] The term "nucleic acid construct" refers to an artificially constructed nucleic acid segment that can be introduced into target cells or tissues. The nucleic acid construct can be various expression vectors, which include a vector backbone, i.e., an empty vector and an expression framework.

[0038] There is no specific limitation on the type of expression vector. An expression vector is a nucleic acid molecule that allows the insertion of foreign nucleotides without disrupting its ability to replicate and / or integrate into the host cell. Expression vectors may include nucleic acid sequences that allow them to replicate in the host cell, such as origins of replication. Expression vectors may also include one or more selective marker genes and other genetic factors. An expression vector is a vector containing the necessary regulatory sequences to enable the transcription and translation of one or more inserted genes. Expression vectors are selected from eukaryotic expression vectors or prokaryotic expression vectors.

[0039] The prokaryotic expression vector is selected from *Escherichia coli* expression vectors, *Bacillus subtilis* expression vectors, or *Streptomyces* expression vectors. In a preferred embodiment, the prokaryotic expression vector is selected from *E. coli* expression vectors. Compared with other expression systems, the *E. coli* expression system has a clear genetic background, a short culture period, high target gene expression level, and strong resistance to contamination. The *E. coli* expression vector is, for example, the pET expression vector, specifically pET28a or pET32a, which can be stably expressed in *E. coli*. The expression vector can also be the pCW expression vector, the pUC expression vector, or the pPIC9k expression vector.

[0040] The eukaryotic expression vector is selected from yeast expression vectors, insect expression vectors, or mammalian expression vectors. The mammalian expression vector is selected from retroviral expression vectors, lentiviral expression vectors, adenovirus expression vectors, and adeno-associated virus expression vectors. In a preferred embodiment, the eukaryotic expression vector is selected from retroviral expression vectors, which can be stably expressed in cell lines; for example, pMSCV is a retroviral vector.

[0041] The host cells are selected from eukaryotic or prokaryotic host cells. Eukaryotic host cells are selected from fungi such as yeast, insects, birds, plants, *C. elegans* or nematodes, or mammalian host cells. Non-limiting examples of insect cells are *Spodoptera frugiperda* (Sf) cells. Examples of yeast host cells are *Saccharomyces cerevisiae*, *Kluyveromyces lactis* (K. lactis), *Yarrowia lipolytica*, and *Pichia pastoris*. Examples of mammalian cells are COS cells, juvenile hamster kidney cells, mouse L cells, LNCaP cells, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, African green monkey cells, CV1 cells, Vero or Hep-2 cells. Examples of prokaryotic host cells include bacterial cells such as Escherichia coli, Streptomyces, Bacillus subtilis, Salmonella typhi, or mycobacteria.

[0042] Those skilled in the art can transfect the expression vector into host cells using methods well known in the art to obtain cells containing the gene encoding the glucose dehydrogenase mutant. For example, the expression vector can be introduced into eukaryotic cells by calcium phosphate coprecipitation, electroporation, microinjection, liposome transfection, or transfection using polyamine transfection reagents.

[0043] The present invention also provides a cell containing the aforementioned nucleic acid construct or a genome integrated with an exogenous polynucleotide such as any one of SEQ ID No. 30 to 32.

[0044] The cells are bacteria or fungi.

[0045] The present invention also provides a method for preparing the glucose dehydrogenase mutant, comprising the following steps: culturing the cells, inducing the expression of the glucose dehydrogenase mutant, and collecting and separating the bacterial cells after induction to obtain the enzyme solution of the glucose dehydrogenase mutant.

[0046] In some embodiments of the present invention, the cell culture conditions include any of the following: a culture temperature of 25–32°C, a rotation speed of 150–250 rpm, and an LB medium.

[0047] In some embodiments of the present invention, when the OD600 of the culture system is 0.5-1.0, glucose dehydrogenase mutant expression is induced.

[0048] In some embodiments of the present invention, IPTG is used to induce the expression of glucose dehydrogenase mutants.

[0049] In some embodiments of the present invention, the final concentration of IPTG is 0.3–0.6 mM based on the total volume of the culture system. In some embodiments of the present invention, the induction time is 14–18 hours.

[0050] In some embodiments of the present invention, bacterial cells are collected by centrifugation.

[0051] In some embodiments of the present invention, the separation method is as follows: the collected bacterial cells are disrupted by ultrasound and centrifuged to obtain the enzyme solution of glucose dehydrogenase mutant.

[0052] The present invention also provides the use of the glucose dehydrogenase mutant, the isolated polynucleotide, the nucleic acid construct, and the cells in the preparation of NMNH.

[0053] The application is for use in the catalytic preparation of NMNH from NMN.

[0054] The present invention also provides a method for preparing NMNH, the method comprising using the glucose dehydrogenase mutant to catalyze NMN, thereby obtaining NMNH.

[0055] In some embodiments of the present invention, the temperature at which the glucose dehydrogenase mutant catalyzes NMN is 25°C-40°C. For example, temperatures of 25-30°C, 30-35°C, and 35-40°C.

[0056] In some embodiments of the present invention, the pH value of NMN catalyzed by the glucose dehydrogenase mutant is 6-10. For example, pH values ​​are 6-7, 7-7.5, 7.5-8, 8-8.5, 8.5-9, and 9-10.

[0057] When the glucose dehydrogenase mutant provided by this invention is used for enzyme-catalyzed reaction, the conversion rate of NMN is relatively high when the reaction temperature is controlled at 25-40℃ and the pH is controlled at 7.5-10.0.

[0058] In some embodiments of the present invention, when using a glucose dehydrogenase mutant to catalyze NMN, the final concentration of the glucose dehydrogenase mutant is from 0.5 mg / mL to 200.0 mg / mL, based on the total volume of the catalytic system. For example, the final concentration of the glucose dehydrogenase mutant in the catalytic system is 0.5–10 mg / mL, 2–30 mg / mL, 5–50 mg / mL, 10–100 mg / mL, or 10–200 mg / mL.

[0059] In some embodiments of the present invention, when using a glucose dehydrogenase mutant to catalyze NMN, the initial concentration of NMN is 6–60 mM, based on the total volume of the catalytic system. For example, the initial concentration of NMN is 6–10 mM, 10–20 mM, 20–30 mM, 30–35 mM, 35–40 mM, 40–50 mM, or 50–60 mM.

[0060] In some embodiments of the present invention, the catalytic system using a glucose dehydrogenase mutant to catalyze NMN includes: a glucose dehydrogenase mutant, NMN, glucose, NaCl, and a pH buffer.

[0061] In some embodiments of the present invention, the concentration of glucose in the catalytic system is 0.05–2.0 mol / L, based on the total volume of the catalytic system. For example, the concentration of glucose in the catalytic system is 0.05–0.1 mol / L, 0.1–0.2 mol / L, 0.2–0.3 mol / L, 0.3–0.4 mol / L, 0.4–0.5 mol / L, 0.5–1.0 mol / L, 1.0–1.5 mol / L, or 1.5–2.0 mol / L.

[0062] In some embodiments of the present invention, the concentration of NaCl in the catalytic system is 0.1–4.0 mol / L, based on the total volume of the catalytic system. For example, the concentration of NaCl in the catalytic system is 0.1–0.5 mol / L, 0.5–1 mol / L, 1–1.5 mol / L, 1.5–2 mol / L, 2–2.5 mol / L, 2.5–3 mol / L, 3–3.5 mol / L, or 3.5–4 mol / L.

[0063] In some embodiments of the present invention, the pH buffer is, for example, a Tris-HCl buffer.

[0064] In some embodiments of the present invention, the method specifically involves using the enzyme solution of the glucose dehydrogenase mutant to catalyze NMN to obtain NMNH.

[0065] In some embodiments of the present invention, NMN and / or glucose are added during the catalytic process.

[0066] In some embodiments of the present invention, when the concentration of NMN in the reaction system is below 3 mM, NMN and / or glucose are added once. The number of times NMN and / or glucose is added is 1 to 10.

[0067] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0068] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0069] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0070] Example 1: Screening for efficient synthesis of NMNH glucose dehydrogenase mutants

[0071] Construction of glucose dehydrogenase and mutants:

[0072] Using glucose dehydrogenase (amino acid sequence as shown in SEQ ID NO.1, GenBank: WP_003246720.1; denoted as BsuGDH) as the starting protein, mutations of BsuGDH were designed through computer simulation. Eight potentially significant mutation sites were predicted: single-point mutations or pairwise combinations of mutations at Y39, E51, I75, A93, H157, I195, D208, and A236. Using the constructed recombinant plasmid pET28-BsuGDH (nucleotide sequence as shown in SEQ ID NO.34) as a template, the DNA sequence encoding the glucose dehydrogenase mutation was amplified by PCR using corresponding synthetic primers (synthesized by Jiangsu Saisofe Biotechnology Co., Ltd.). After gel purification of the PCR product, fusion ligation was performed using a seamless cloning kit (Shanghai Beyotime Biotechnology Co., Ltd., CatNo. D7010M) to construct the mutant expression plasmid. If it is a single-site mutation, PCR amplification is performed using the appropriate primers with the recombinant plasmid pET28-BsuGDH as a template, followed by fusion to construct the expression plasmid for that site mutation. If it is a two-site mutation, a second round of PCR and ligation is performed using primers for the second site mutation, based on the constructed plasmid for the first site mutation, to construct a double-mutant expression plasmid. If it is a three-site mutation, a third round of PCR and ligation is performed using primers for the third site mutation, based on the constructed plasmids for the two site mutations, to construct a three-site mutation expression plasmid.

[0073] in:

[0074] 39-site mutation primer (Y39Q)

[0075] Forward primer (SEQ ID NO.2): 5'-atcaactatcaaagtaataaac-3'

[0076] Reverse primer (SEQ ID NO.3): 5'-actttgatagttgataaccacttttg-3'

[0077] 39-site mutation primer (Y39N)

[0078] Forward primer (SEQ ID NO.4): 5'-gtggttatcaactataatagtaataaac-3'

[0079] Reverse primer (SEQ ID NO.5): 5'-ttatagttgataaccacttttgcctg-3'

[0080] 51-site mutation primer (E51Q)

[0081] Forward primer (SEQ ID NO.6): 5'-gtaaaagaacaggtcatcaaggc-3'

[0082] Reverse primer (SEQ ID NO.7): 5'-gacctgttcttttacctcgttcgga-3'

[0083] 75-site mutation primer (I75S)

[0084] Forward primer (SEQ ID NO.8): 5'-atgtaaaaaattccgtgcaaacggcaat-3'

[0085] Reverse primer (SEQ ID NO.9): 5'-cggaattttttacatcttcctctttcg-3'

[0086] 75-site mutation primer (I75L)

[0087] Forward primer (SEQ ID NO.10): 5'-tctcgtgcaaacggcaattaaggag-3'

[0088] Reverse primer (SEQ ID NO.11): 5'-tgcacgacattttttacatcttcctc-3'

[0089] 93-site mutation primer (A93K)

[0090] Forward primer (SEQ ID NO.12): 5'-gattaataataagggtcttgaaaatcc-3'

[0091] Reverse primer (SEQ ID NO.13): 5'-cccttattattaatcataatatcgag-3'

[0092] 93-site mutation primer (A93P)

[0093] Forward primer (SEQ ID NO.14): 5'-gattaataatcccggtcttgaaaatcctg-3'

[0094] Reverse primer (SEQ ID NO.15): 5'-gaccgggattattaatcataatatcg-3'

[0095] 157-site mutation primer (H157R)

[0096] Forward primer (SEQ ID NO.16): 5'-gtccgctatgcggcaagtaaaggc-3'

[0097] Reverse primer (SEQ ID NO.17): 5'-tgccgcatagcggacaaataacggc-3'

[0098] 157-site mutation primer (H157Q)

[0099] Forward primer (SEQ ID NO.18): 5'-gtccaatatgcggcaagtaaaggcgg-3'

[0100] Reverse primer (SEQ ID NO.19): 5'-tgccgcatattggacaaataacggc-3'

[0101] Primer for the 195-position mutation (I195E)

[0102] Forward primer (SEQ ID NO.20): 5'-cgccagagaatgctgaaaaattcgc-3'

[0103] Reverse primer (SEQ ID NO.21): 5'-cagcattctctggcgtgttgatcgc-3'

[0104] 195-site mutation primer (I195L)

[0105] Forward primer (SEQ ID NO.22): 5'-gatcaacacgccactcaatgctg-3'

[0106] Reverse primer (SEQ ID NO.23): 5'-agtggcgtgttgatcgcacctg-3'

[0107] 208-site mutation primer (D208N)

[0108] Forward primer (SEQ ID NO.24): 5'-cagaaagctaatgtagaaagcatgattc-3'

[0109] Reverse primer (SEQ ID NO.25): 5'-tacattagctttctgtttagggtcag-3'

[0110] 208-site mutation primer (D208Y)

[0111] Forward primer (SEQ ID NO.26): 5’-cagaaagcttatgtagaaagcatgattc-3’

[0112] Reverse primer (SEQ ID NO.27): 5’-ttctacataagctttctgtttagggtc-3’

[0113] Primer for mutation at site 236 (A236V)

[0114] Forward primer (SEQ ID NO.28): 5’-gaaggaagtcagctacgtcacaggcatc-3’

[0115] Reverse primer (SEQ ID NO.29): 5’-tagctgacttccttcgaagcaagccag-3’

[0116] Nucleotide sequence of pET28-BsuGDH:

[0117] tggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctag

[0118] cgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttag

[0119] tgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttg

[0120] gagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcg

[0121] gcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcaggtggcacttttcggggaaatg

[0122] tgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgaattaattcttagaaaaactcatcgagcatcaaatgaaactg

[0123] caatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaa

[0124] gatcctggtatcggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcacca

[0125] tgagtgacgactgaatccggtgagaatggcaaaagtttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcact

[0126] cgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaat

[0127] gcaaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgttttcccggggatcg

[0128] cagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagccagtttagtctgaccatct

[0129] catctgtaacatcattggcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcgatagattgtcgcacctgat

[0130] tgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggcctagagcaagacgtttcccgttgaatatg

[0131] gctcataacaccccttgtattactgtttatgtaagcagacagttttattgttcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac

[0132] cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttg

[0133] tttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagtta

[0134] ggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtctta

[0135] ccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaac

[0136] gacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagc

[0137] ggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgactt

[0138] gagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggcct

[0139] tttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgacc

[0140] gagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatg

[0141] gtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacac

[0142] ccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgt

[0143] cagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgtt

[0144] catccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactg

[0145] atgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacat

[0146] gcccggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgctt

[0147] cgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgttt

[0148] ccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgta

[0149] tcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggggcc

[0150] gccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaat

[0151] accgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacga

[0152] gttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaag

[0153] ggcatcggtcgagatcccggtgcctaatgagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgc

[0154] cagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaac

[0155] agctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggt

[0156] taacggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccgagatatccgcaccaacgcgcagcccggactcggtaatggcg

[0157] cgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccgga

[0158] catggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccgaga

[0159] cagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaa

[0160] aataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcat

[0161] ccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatc

[0162] gacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtgg

[0163] caacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccg

[0164] cgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactg

[0165] gtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtccgggatctcgac

[0166] gctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaagg

[0167] agatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgat

[0168] cttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatc

[0169] gagatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaag

[0170] gagatataccatgtatccggatttaaaaggaaaagtcgtcgctattacaggagctgcttcagggctcggaaaggcgatggccattcgcttcggca

[0171] aggagcaggcaaaagtggttatcaactattatagtaataaacaagatccgaacgaggtaaaagaagaggtcatcaaggcgggcggtgaagct

[0172] gttgtcgtccaaggagatgtcacgaaagaggaagatgtaaaaaatatcgtgcaaacggcaattaaggagttcggcacactcgatattatgattaat

[0173] aatgccggtcttgaaaatcctgtgccatctcacgaaatgccgctcaaggattgggataaagtcatcggcacgaacttaacgggtgcctttttagga

[0174] agccgtgaagcgattaaatatttcgtagaaaacgatatcaagggaaatgtcattaacatgtccagtgtgcacgaagtgattccttggccgttatttgt

[0175] ccactatgcggcaagtaaaggcgggataaagctgatgacagaaacattagcgttggaatacgcgccgaagggcattcgcgtcaataatattgg

[0176] gccaggtgcgatcaacacgccaatcaatgctgaaaaattcgctgaccctaaacagaaagctgatgtagaaagcatgattccaatgggatatatc

[0177] ggcgaaccggaggagatcgccgcagtagcagcctggcttgcttcgaaggaagccagctacgtcacaggcatcacgttattcgcggacggcg

[0178] gtatgacacaatatccttcattccaggcaggccgcggttaagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat (SEQ ID NO. 33)

[0179] The plasmid encoding the glucose dehydrogenase mutant constructed above was transformed into the BL21(DE3) host to obtain the corresponding engineered strain.

[0180] Induction of glucose dehydrogenase and mutant expression:

[0181] The engineered strains carrying the glucose dehydrogenase BsuGDH and mutant encoding genes were inoculated into 3 mL LB broth tubes and cultured at 30°C and 200 rpm for 16 hours, yielding the seed culture. The seed culture was then inoculated into 50 mL shake flasks of LB broth under the same conditions as the seed culture, maintaining a temperature of 30°C and a rotation speed of 200 rpm. OD600 values ​​were monitored during the culture process. When OD600 was in the range of 0.5-1.0, IPTG (final concentration 0.5 mM) was added to induce glucose dehydrogenase mutant expression for approximately 16 hours. After induction, the bacterial cells were collected by centrifugation at 12000 g. Simultaneously, the collected bacterial cells were washed twice with Tris-HCl buffer (pH 7.5, concentration 50 mM) and stored at -20°C.

[0182] Preparation of glucose dehydrogenase and mutants:

[0183] The frozen bacterial cells were resuspended in 1 mL of Tris-HCl buffer (pH 7.5, 50 mM). The suspended cells were then disrupted using an ultrasonic disruptor (SCIENTZ-IID, Ningbo Xinzhi Biotechnology Co., Ltd.). The disruption conditions were: 3 seconds of sonication followed by a 6-second pause, for a total of 5 minutes. The disrupted enzyme solution was centrifuged at 12000g and 4℃ for 10 minutes. The supernatant obtained was the enzyme solution containing glucose dehydrogenase and the mutant, which was used for subsequent enzyme catalysis experiments.

[0184] Performance of glucose dehydrogenase and its mutants:

[0185] The glucose dehydrogenase and mutant obtained above were subjected to enzyme catalysis experiments. The enzyme catalysis system consisted of: 800 μL of 50 mM pH 7.5 Tris-HCl buffer, 100 μL of 60 mM NMN solution, 50 μL of 2 M glucose solution, 50 μL of 20 M NaCl solution, and 1 mg / mL glucose dehydrogenase (calculated based on the total volume of the enzyme catalysis system). The enzyme catalysis reaction conditions were: temperature 30℃, shaker speed 50 rpm. The enzyme catalysis reaction was started with the addition of the substrate NMN. After the addition of NMN, a 1 mL sample was taken from the reaction flask, and the initial NMN concentration was detected by HPLC (recorded as 0h). After 6 hours of reaction, another 1 mL sample was taken. HPLC was used to detect the residual amount of NMN and the amount of NMNH generated in the reaction solution at the end of 6 hours. The conversion rate was calculated based on the initial NMN concentration, the residual amount of NMN, and the amount of NMNH generated at the end of the reaction.

[0186] The NMNH conversion rate is calculated using formula ①:

[0187] B(6) / [A(0)–A(6)]×100%①

[0188] Where A(0) is the initial concentration of NMN in the reaction; A(6) is the concentration of NMN in the reaction flask after 6 hours of reaction; and B(6) is the concentration of NMNH in the reaction flask after 6 hours of reaction.

[0189] The detection method for NMN and NMNH was as follows: A BioCore SAX 5um 4.6*250mm column was used, with an injection volume of 5μL, a mobile phase of 50mM disodium hydrogen phosphate, a flow rate of 0.5mL / min, a column oven temperature of 25℃, and a detection wavelength of 225nm for NMN and NMNH.

[0190] The results of the reaction for 6 hours, including the concentration and conversion rate of glucose dehydrogenase and mutant-catalyzed NMN to NMNH, are shown in Table 1.

[0191] Table 1. Concentration and conversion rate of glucose dehydrogenase and mutants synthesizing NMNH

[0192]

[0193] Based on the conversion rates of different glucose dehydrogenase mutants in Table 1, Y39 (Y39Q, Y39N, Y39Q / A93K, Y39Q / I75L, Y39N / I75S, Y39Q / A93K / H157R, Y39N / A93P / H157Q), I75 (I75S, I75L, Y39Q / I75L, Y39N / I75S), A93 (A93K, A93P, Y39Q / Mutations at sites such as A93K, Y39Q / A93K / H157R, Y39N / A93P / H157Q), H157 (H157R, H157Q, Y39Q / A93K / H157R, Y39N / A93P / H157Q), and I195 (I195E) all resulted in high conversion rates of NMN to NMNH catalyzed by glucose dehydrogenase, indicating commercial potential for the catalytic synthesis of NMNH from NMN.

[0194] Among them, glucose dehydrogenase mutant (BsuGDH) Y39Q / A93K / H157R The liquid chromatogram of the NMN-NMNH synthesis reaction after 6 hours is shown in the figure. Figure 1 .

[0195] Simultaneously, mass spectrometry analysis was performed on the NMNH detected in the liquid chromatography (LC) chromatogram. During LC detection, the sample was added to the injection volume (e.g., 50 μL). After detecting the NMNH peak in the LC chromatogram, the separated NMNH sample was collected in a 1.5 mL centrifuge tube in the subsequent eluent. The collected NMNH sample was then subjected to mass spectrometry analysis to determine the molecular weight of the synthesized NMNH. Glucose dehydrogenase mutant (BsuGDH) Y39Q / A93K / H157R The mass spectrum of the catalytically synthesized NMNH is shown in the figure. Figure 2 The mass spectrum shows that the molecular weight of the synthesized NMNH is consistent with the expected value.

[0196] Example 2: Optimization of reaction conditions catalyzed by glucose dehydrogenase mutant enzyme

[0197] For several mutation sites that efficiently synthesize NMNH, such as Y39, I75, A93, H157, and I195, one combination of these sites was randomly selected to optimize the enzyme-catalyzed synthesis of NMNH.

[0198] With strain BL21-BsuGDH Y39Q / A93K / H157R Using this strain (carrying a glucose dehydrogenase mutant with mutations at the Y39Q, A93K, and H157R sites) as the starting strain, glucose dehydrogenase mutant enzyme solutions were prepared after induction expression and cell disruption. The prepared enzyme solutions were used to subsequently investigate the enzyme catalytic performance of the glucose dehydrogenase mutant under different temperatures, pH values, and initial NMN concentrations.

[0199] (1) Catalytic performance of glucose dehydrogenase mutant at different temperatures

[0200] The performance of the prepared glucose dehydrogenase mutant in catalyzing the synthesis of NMNH from NMN at different temperatures was investigated. The enzyme catalytic system consisted of: 800 μL of 50 mM pH 7.5 Tris-HCl buffer, 100 μL of 60 mM NMN, 50 μL of 2 M glucose, 50 μL of 20 M NaCl, and 1 mg / mL glucose dehydrogenase (calculated based on the total volume of the enzyme catalytic system). The reaction conditions were: temperatures of 25℃, 30℃, 37℃, and 40℃, and a shaking speed of 50 rpm. The enzyme catalytic reaction was initiated with the addition of the substrate NMN and ended after 6 h. After the reaction, 1 mL of sample was taken from the reaction flask, and the amount of NMNH generated in the reaction solution was detected by HPLC. Glucose dehydrogenase mutant BsuGDH Y39Q / A93K / H157R The results of catalytic synthesis of NMNH from NMN at different temperatures are shown in Table 2.

[0201] Table 2. Concentration and conversion rate of NMNH synthesized by glucose dehydrogenase mutant at different temperatures.

[0202]

[0203] According to Table 2, the conversion rate of NMNH synthesized by the glucose dehydrogenase mutant at different temperatures shows that the glucose dehydrogenase mutant can efficiently synthesize NMNH in the range of 25℃ to 40℃.

[0204] (2) Catalytic performance of glucose dehydrogenase mutant enzyme at different pH values

[0205] The performance of the prepared glucose dehydrogenase mutant in catalyzing the synthesis of NMNH from NMN at different pH values ​​was investigated. The enzyme catalytic system consisted of: 100 μL of 60 mM NMN, 50 μL of 2 M glucose, 50 μL of 20 M NaCl, 800 μL of buffer solution, and 1 mg / mL of glucose dehydrogenase (calculated based on the total volume of the enzyme catalytic system). Different pH values ​​were controlled using buffer solutions with varying pH values: pH 7.5 (50 mM pH 7.5 Tris-HCl buffer), pH 8.0 (50 mM pH 8.0 Tris-HCl buffer), pH 8.5 (50 mM pH 8.5 Tris-HCl buffer), and pH 9.0 (50 mM pH 9.0 Tris-HCl buffer). The reaction conditions were: temperature 30 °C, shaker speed 50 rpm. The enzyme catalytic reaction was initiated with the addition of the substrate NMN and ended after 6 h. After the reaction, 1 mL of sample was taken from the reaction flask, and the amount of NMNH generated in the reaction solution was determined by HPLC. glucose dehydrogenase mutant BsuGDH Y39Q / A93K / H157RThe results of NMN to NMNH synthesis catalyzed at different pH values ​​are shown in Table 3.

[0206] Table 3. Concentration and conversion rate of NMNH synthesized by glucose dehydrogenase mutants at different pH values.

[0207]

[0208] According to Table 3, the conversion rate of NMNH synthesized by the glucose dehydrogenase mutant at different pH values ​​shows that the glucose dehydrogenase mutant can efficiently synthesize NMNH in the pH range of 7.5–10.0.

[0209] (3) The yield of NMNH synthesized by glucose dehydrogenase mutant enzyme under different initial NMN concentrations

[0210] The yield of NMNH synthesized by the prepared glucose dehydrogenase mutant under different initial NMN concentrations was investigated. The enzyme-catalyzed reaction system consisted of: 100 μL of NMN stock solution (concentrations of 60 mM, 180 mM, 360 mM, and 540 mM), 50 μL of 2 M glucose, 50 μL of 20 M NaCl, 800 μL of 50 mM pH 8.0 Tris-HCl buffer, and 1 mg / mL glucose dehydrogenase (calculated based on the total volume of the enzyme-catalyzed system). The reaction conditions were: 35℃ and 50 rpm shaking. The reaction was initiated with the addition of NMN and continued for 12 h. After the reaction, 1 mL of sample was taken from the reaction flask, and the amount of NMNH generated in the reaction solution was detected by HPLC. Glucose dehydrogenase mutant BsuGDH Y39Q / A93K / H157R The results of synthesizing NMNH at different initial NMN concentrations are shown in Table 4.

[0211] Table 4. Concentration and conversion rate of NMNH synthesized by glucose dehydrogenase mutants at different initial NMN concentrations.

[0212]

[0213] According to Table 4, the conversion rates of glucose dehydrogenase mutants to NMNH at different initial concentrations of NMN show that glucose dehydrogenase mutants can efficiently synthesize NMNH at different concentrations. Among them, the conversion rate of NMNH synthesis is the highest, reaching 92.32%, when the initial NMN concentration is 6mM.

[0214] Example 3: Glucose dehydrogenase mutant enzyme produces high levels of NMNH

[0215] Targeting the mutation sites Y39, I75, A93, H157, and I195, which are highly efficient sites for NMNH synthesis, the glucose dehydrogenase mutant with the Y39Q mutation was selected to efficiently synthesize NMNH.

[0216] With strain BL21-BsuGDH Y39Q / A93K / H157R Using this strain (carrying a glucose dehydrogenase mutant with mutations at the Y39Q, A93K, and H157R sites) as the starting strain, after induction expression and cell disruption, a glucose dehydrogenase mutant enzyme solution was prepared. The prepared enzyme solution was used to catalyze the synthesis of NMNH from NMN.

[0217] The enzyme-catalyzed reaction system consisted of: 100 μL of 360 mM NMN stock solution, 50 μL of 2 M glucose, 50 μL of 20 M NaCl, 800 μL of 50 mM pH 8.0 Tris-HCl buffer, and 1 mg / mL glucose dehydrogenase (calculated based on the total volume of the enzyme-catalyzed system). The reaction conditions were: 35℃ and 50 rpm shaking. The reaction was initiated with the addition of NMN as the substrate. When the concentration of NMN in the reaction solution fell below 3 mM, 100 μL of 360 mM NMN stock solution and 50 μL of 2 M glucose were added to the reaction system. This process was repeated four times before the reaction was terminated. After the reaction, a 1 mL sample was taken from the reaction flask, and the amount of NMNH generated in the reaction solution was detected by HPLC. The HPLC results confirmed that the glucose dehydrogenase mutant BsuGDH... Y39Q / A93K / H157R The yield of NMNH synthesized by catalysis reached 41.2 g / L.

[0218] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A glucose dehydrogenase mutant, characterized in that, The glucose dehydrogenase mutant was obtained by combining Y39Q / A93K / H157R mutations in the amino acid sequence of wild-type glucose dehydrogenase, and the amino acid sequence of wild-type glucose dehydrogenase is shown in SEQ ID NO.

1.

2. An isolated polynucleotide, characterized in that, The polynucleotide encodes the glucose dehydrogenase mutant of claim 1.

3. The isolated polynucleotide according to claim 2, characterized in that, The nucleotide sequence of the polynucleotide is shown in SEQ ID NO.

32.

4. A nucleic acid construct, characterized in that, The nucleic acid construct comprises the isolated polynucleotide as described in claim 2 or 3.

5. A cell, characterized in that, The cell contains the nucleic acid construct of claim 4 or the genome integrated with an exogenous polynucleotide as shown in SEQ ID No. 32, and the cell is selected from bacteria or fungi.

6. The method for preparing the glucose dehydrogenase mutant according to claim 1, characterized in that, The process includes the following steps: culturing the cells as described in claim 5, inducing the expression of the glucose dehydrogenase mutant, and collecting and lysing the cells after induction to obtain the enzyme solution of the glucose dehydrogenase mutant.

7. The use of the glucose dehydrogenase mutant of claim 1, the isolated polynucleotide of claim 2 or 3, the nucleic acid construct of claim 4, and the cell of claim 5 in the preparation of NMNH.

8. The use as described in claim 7, characterized in that, The application is for use in the catalytic preparation of NMNH from NMN.

9. A method for preparing NMNH, characterized in that, The preparation method includes using the glucose dehydrogenase mutant of claim 1 to catalyze NMN, thereby obtaining NMNH.

10. The preparation method according to claim 9, characterized in that, The preparation method further includes any one or more of the following features: 1) The temperature at which the glucose dehydrogenase mutant is used to catalyze NMN is 25℃-40℃; 2) The pH value for catalyzing NMN using a glucose dehydrogenase mutant is 6-10; 3) When using the glucose dehydrogenase mutant to catalyze NMN, the final concentration of the glucose dehydrogenase mutant is 0.5 mg / mL to 200.0 mg / mL, based on the total volume of the catalytic system; 4) When using the glucose dehydrogenase mutant to catalyze NMN, the initial concentration of NMN is 6~60mM, based on the total volume of the catalytic system; 5) The catalytic system using glucose dehydrogenase mutant to catalyze NMN includes: glucose dehydrogenase mutant, NMN, glucose, NaCl, and pH buffer.

11. The preparation method according to claim 10, characterized in that, The preparation method further includes any one or more of the following features: 1) The catalytic system for NMN catalyzed by glucose dehydrogenase mutant includes: glucose dehydrogenase mutant, NMN, glucose, NaCl, and pH buffer. Based on the total volume of the catalytic system, the concentration of glucose in the catalytic system is 0.05~2.0 mol / L, and / or the concentration of NaCl is 0.1~4.0 mol / L. 2) During the catalytic process, NMN and / or glucose are added 1 to 10 times.

Citation Information

Patent Citations

  • Multiseparation paper money counting machine

    CN2657108Y