An sgRNA sequence targeting the IGFL3 gene and its application in enhancing the radiosensitivity of glioblastoma
By designing the sgRNA sequence targeting the IGFL3 gene and efficiently knocking out the IGFL3 gene in human glioblastoma cell U251 using the CRISPR/Cas9 system, the problem of glioblastoma tolerance to radiotherapy was solved, and the radiosensitivity was significantly improved, providing support for the development of the IGFL3 gene as a potential target.
Patent Information
- Application Number
- CN202411862180.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-17
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2044-12-17
AI Technical Summary
Glioblastoma showed significant tolerance to radiotherapy, limiting the effect of radiotherapy and leading to high recurrence rates. Existing studies have failed to clarify the role of IGFL3 gene in tumor radiosensitivity.
The sgRNA sequence targeting the IGFL3 gene was designed, and the IGFL3 gene was knocked out efficiently in human glioblastoma cell U251 to improve radiosensitivity.
By targeting knockdown of the IGFL3 gene, the radiosensitivity of human glioblastoma cells has been significantly improved, laying the foundation for the development of the IGFL3 gene as a potential target for radiosensitivity.
Smart Images

Figure CN119592568B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to an sgRNA sequence targeting the IGFL3 gene and its application in enhancing the radiosensitivity of glioblastoma. Background Art
[0002] Glioblastoma is the most common and highly malignant primary brain tumor in the central nervous system, and is classified as grade IV glioma according to the WHO classification. It is characterized by rapid growth, strong invasiveness, easy recurrence, and high tolerance to existing treatment methods.
[0003] Radiotherapy is an important part of the standard treatment for glioblastoma, usually combined with surgical resection and chemotherapy. Its main purpose is to remove residual lesions after surgery or tumor tissues that cannot be completely resected, so as to prolong the survival time of patients and improve the prognosis. However, glioblastoma shows significant tolerance (i.e., radioresistance) to radiotherapy, which severely limits the effect of radiotherapy, not only becoming one of the main reasons for treatment failure, but also leading to a high recurrence rate of tumors, posing a great challenge to the long-term survival of patients. Therefore, finding potential targets to enhance radiosensitivity and clarifying the mechanism of radioresistance are of great practical importance and urgency.
[0004] Insulin-like growth factor 3 (IGF like family member 3, IGFL3) belongs to the insulin-like growth factor family, which plays a key role in cell energy metabolism and growth and development (especially in the fetal period). Some studies have shown that IGFL3 may respond to TGF-β signals and its expression can be up-regulated under its stimulation; during human gingival healing, the IGFL3 gene is significantly down-regulated; while in the skin of Pparg gene knockout mice, the IGFL3 gene is significantly up-regulated; in addition, IGFL3 is up-regulated in uterine leiomyomas and is involved in the immune system, angiogenesis, invasion, metabolic changes, and extracellular matrix deposition, and may be related to the dysregulation of the TGF-β3 and Wnt / β-catenin pathways. So far, there have been few studies on the IGFL3 gene at home and abroad, the mechanism of its role in tumorigenesis and development is still unclear, and there is no relevant research on the IGFL3 gene in tumor radiosensitivity. Summary of the Invention
[0005] The object of the present invention is to provide an sgRNA sequence targeting the IGFL3 gene and its application in enhancing the radiosensitivity of glioblastoma. By efficiently targeting and knocking out the IGFL3 gene, the role of this gene in the radiosensitivity of glioblastoma is clarified, laying a foundation for determining whether this gene can be a potential target for enhancing radiosensitivity.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] An sgRNA sequence for targeted knockout of the IGFL3 gene, wherein the sgRNA sequence is IGFL3-sgRNA-1 or IGFL3-sgRNA-3, and its nucleotide sequence is as follows:
[0008] IGFL3-sgRNA-1: GCCAGCCGACACCCAGGTGT;
[0009] IGFL3-sgRNA-3: GCAGGTGGAGCCACAGCGGC.
[0010] A cell for targeted knockout of the IGFL3 gene, which uses the CRISPR / Cas9 system to knockout the IGFL3 gene of human glioblastoma cell U251.
[0011] A method for improving the radiosensitivity of human glioblastoma cell U251, the specific steps are to knockout the IGFL3 gene of human glioblastoma cell U251.
[0012] Furthermore, the above method is to knockout the IGFL3 gene using the CRISPR / Cas9 system.
[0013] The application of the above sgRNA sequence in improving the radiosensitivity of human glioblastoma cell U251.
[0014] Compared with the prior art, the beneficial effects of the present invention are:
[0015] (1) The present invention designs 2 highly efficient sgRNA sequences for targeted knockout of the IGFL3 gene. Through gene knockout efficiency detection, the present invention can achieve highly efficient knockout of the IGFL3 gene on human glioblastoma cell U251, which lays a foundation for further research on the function of this gene.
[0016] (2) By targeted knockout of the IGFL3 gene of the present invention, the radiosensitivity of human glioblastoma cell U251 can be effectively improved, providing a solid foundation for further developing the IGFL3 gene as a potential target for improving radiosensitivity. Description of the Drawings
[0017] Figure 1 It is a graph showing the change of IGFL3 mRNA expression after treating human glioblastoma cell U251 with gradient doses of X-rays.
[0018] Figure 2It is a diagram showing the differential expression of IGFL3 mRNA in radioresistant (U251-RR) and wild-type (U251-WT) human glioblastoma cells U251 by GEO analysis.
[0019] Figure 3 It is a diagram showing the change in the expression of IGFL3 protein after treating human glioblastoma cells U251 with 5 Gy X-rays.
[0020] Figure 4 It is a schematic diagram of the sgRNA sequence targeting the third exon of the IGFL3 gene.
[0021] Figure 5 It is a schematic diagram of the pLVR-sgRNAs-CMV-Cas9 gene knockout vector structure; its main functional elements include: 5'-LTR and 3'-LTR (long terminal repeats); U6 and CMV promoters (driving the expression of sgRNA and Cas9 respectively); Esp3I restriction site and sgRNA insertion site; Cas9 gene (encoding the CRISPR / Cas9 nuclease); SV40 nuclear localization signal; GFP gene (green fluorescent protein gene); IRES (internal ribosome entry site for co-expression); Neo gene (neomycin resistance gene); WPRE (hepatitis virus post-transcriptional regulatory element); Amp resistance gene (ampicillin resistance gene); and pUC Ori (replication origin).
[0022] Figure 6 It is an electrophoresis identification diagram of the colony PCR products transformed with the IGFL3 gene knockout vector.
[0023] Figure 7 It is a diagram showing the gene knockout efficiency identified by Western blot after knocking out the IGFL3 gene in human glioblastoma cells U251.
[0024] Figure 8 It is a statistical diagram showing the effect of knocking out the IGFL3 gene on the colony formation rate of human glioblastoma cells U251 after treatment with gradient X-ray irradiation.
[0025] Figure 9 It is a diagram showing the effect of knocking out the IGFL3 gene on the apoptosis of human glioblastoma cells U251 after X-ray treatment. Specific implementation methods
[0026] To make the objectives, technical solutions, and advantages of the present invention clearer, the following describes the embodiments of the present invention in detail with reference to the accompanying drawings. It should be clear that the described embodiments are only a part of the present invention, not all of it. Without involving creative labor, other embodiments that those skilled in the art can obtain based on this belong to the protection scope of the present invention. Therefore, the following detailed description based on the drawings is only an example and does not limit the protection scope of the present invention.
[0027] Table 1 Main reagents involved in the present invention
[0028]
[0029] Example 1 Screening of differentially expressed gene IGFL3 (Gene ID: 388555) after X-ray treatment of human glioblastoma cell line U251
[0030] 1. Changes in IGFL3 mRNA expression after treatment of human glioblastoma cell line U251 with gradient doses of X-ray
[0031] U251 cells were seeded in 6-well plates and irradiated with X-ray when the cells were in the logarithmic growth phase. The irradiation equipment was a Varian Clinac 600C linear accelerator in the United States, and the dose rate was set at 500 MU / min. The irradiation doses were 0, 1, 3, 5, 7, and 9 Gy, respectively. Six hours after irradiation, total cellular RNA was extracted using the Trizol method, and the extracted total RNA was reverse-transcribed into cDNA. The specific operation was as follows: 2 μg of total RNA was added to a PCR tube, preheated at 70°C for 5 minutes, and then quickly placed on ice for cooling. The required components were added according to Table 2, and the final reaction volume was adjusted to 20 μL. After thorough mixing, the sample was centrifuged. Subsequently, the sample was placed in a PCR instrument for amplification, and the program was set as follows: reaction at 25°C for 5 minutes, reaction at 42°C for 60 minutes, reaction at 72°C for 15 minutes, and finally placed at 4°C until the reaction ended.
[0032] Table 2 Reverse transcription system
[0033]
[0034] The obtained cDNA was diluted 5-fold and then subjected to real-time quantitative PCR detection. The primer sequences for detecting the target gene IGFL3 and the β-Actin internal reference were:
[0035] IGFL3-F: 5′- TGCTGTCCCGAGTCTTTTGG -3′ (SEQ ID NO.1);
[0036] IGFL3-R: 5′- ATGGGAGATAAGTGACACTGAGA -3′ (SEQ ID NO.2);
[0037] β - Actin - F: 5′ - AGAGCTACGAGCTGCCTGAC - 3′ (SEQ ID NO.3);
[0038] β - Actin - R: 5′ - AGCACTGTGTTGGCGTACAG - 3′ (SEQ ID NO.4).
[0039] The real - time quantitative PCR reaction system is shown in Table 3, and the amplification reaction program is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 40 cycles; 95°C for 15 s, 60°C for 1 min, +0.15 °C / s, 95°C for 1 s.
[0040] Table 3 Components of real - time quantitative PCR
[0041]
[0042] The PCR quantitative results are as Figure 1 shown. Irradiation with different doses of X - rays all caused varying degrees of up - regulation of the expression level of IGFL3 mRNA in human glioblastoma cell line U251, and the up - regulation amplitude was the most significant in the 5 Gy dose group (** P <0.01).
[0043] Further analysis by GEO (GSE206917) showed that, as shown in Figure 2 , compared with wild - type human glioblastoma cell line U251 (U251 - WT), the expression level of IGFL3 mRNA in radio - resistant human glioblastoma cell line U251 (U251 - RR) was significantly higher than the former (**** P <0.0001).
[0044] 2. Changes in the expression of IGFL3 protein after treating human glioblastoma cell line U251 with 2.5 Gy X - rays
[0045] As Figure 1 the results showed that the peak of IGFL3 mRNA was reached after treatment with 5 Gy X - rays. Therefore, U251 cells were irradiated with a 5 Gy dose, and total proteins were extracted using RIPA lysis buffer 48 hours later, and the level of IGFL3 protein was quantitatively analyzed by Western blot. The steps of Western blot are as follows:
[0046] 1) After quantifying the protein using the BCA method, an equal amount of the sample was loaded onto an SDS-PAGE gel. At the start of electrophoresis, the voltage was adjusted to 100 V and run for approximately 20 minutes. After compressing the sample to the same horizontal line of the separating gel, the voltage was adjusted to 150 V and electrophoresis was continued until the bromophenol blue indicator ran to the bottom of the gel and stopped.
[0047] 2) The protein was transferred to a 0.22 μm pore size NC membrane using the S-TRANS rapid membrane transfer kit. At room temperature, it was blocked with 5% non-fat milk (dissolved in Tris-HCl buffer, i.e., TBST) for 1 hour. Subsequently, the membrane was washed 3 times with TBST, 5 minutes each time.
[0048] 3) The primary antibody Anti-IGFL3 antibody was diluted with 1% BSA and incubated overnight at 4°C. The next day, the membrane was washed 3 times with TBST, 5 minutes each time.
[0049] 4) The secondary antibody was diluted with 1% BSA and incubated for 1 hour at room temperature. Subsequently, it was washed 3 times with TBST, 10 minutes each time. Finally, the ECL chemiluminescent reagent was added and imaged using a chemiluminescent imaging system.
[0050] As Figure 3 shown, compared with the control group (Cont), 5 Gy X-ray treatment also significantly increased the expression level of IGFL3 protein in U251 cells, and the difference was statistically significant (** P <0.01).
[0051] In summary, X-ray irradiation can up-regulate the expression of IGFL3 mRNA and protein, and it is speculated that IGFL3 is closely related to the radiosensitivity of human glioblastoma cell U251.
[0052] Example 2 Knockout of the IGFL3 gene in human glioblastoma cell U251
[0053] 1. Design sgRNA
[0054] Four sgRNAs targeting the third exon of the IGFL3 gene (Gene ID: 388555) were designed, and their sequences are as follows:
[0055] IGFL3-sgRNA-1: GCCAGCCGACACCCAGGTGT (SEQ ID NO.5);
[0056] IGFL3-sgRNA-2: GGTCTCCTTTAAGGATAAGA (SEQ ID NO.6);
[0057] IGFL3-sgRNA-3: GCAGGTGGAGCCACAGCGGC (SEQ ID NO.7);
[0058] IGFL3-sgRNA-4: GAAGTTTCTTGTGAAGTTGA (SEQ ID NO.8).
[0059] The schematic diagram of the above sgRNA sequences targeting the third exon of the IGFL3 gene is shown in Figure 4 .
[0060] Add "ATCCg" to the 5' end of the sgRNA to obtain the forward oligonucleotide sequence; according to the base complementary pairing principle, obtain the complementary strand of the sgRNA, add AAAC to the 5' end of the complementary strand to obtain the reverse oligonucleotide sequence, and add "c" to the 3' end.
[0061] Table 4 Forward and reverse oligonucleotide sequences
[0062]
[0063] 2. Construction of gene knockout vectors
[0064] 1) Dilute the designed paired oligonucleotide single-stranded dry powder in Table 4 to 10 μM with nuclease-free water. Take 20 μL of each and mix well, then heat at 90 °C for 10 minutes to denature, and then let it cool naturally at room temperature to complete annealing. After annealing, a small fragment double-stranded DNA containing the Esp3I restriction site is formed, with sticky ends at its ends;
[0065] 2) The CRISPR / Cas9 gene knockout vector (pLVR-sgRNAs-CMV-Cas9, as Figure 5 shown) contains the Esp3I restriction site, and use Esp3I restriction endonuclease for digestion reaction. The digestion system includes: 1 μL of Esp3I enzyme, 2 μL of 10× buffer, 1 μL of plasmid DNA, 1 μL of DTT (10 mM), and add nuclease-free water to make up the total reaction volume to 20 μL. After mixing, incubate overnight at 37 °C. After digestion, a linearized CRISPR / Cas9 vector large fragment (pLVR-sgRNAs-CMV-Cas9) with corresponding sticky ends is obtained;
[0066] 3) Ligate the above linearized CRISPR / Cas9 vector large fragment with corresponding sticky ends with the small fragment double-stranded DNA in step 1). The ligation reaction is carried out overnight at 16 °C. The specific reaction system is shown in Table 5.
[0067] Table 5 Reaction system
[0068]
[0069] 4) Transformation of vector into DH5α Escherichia coli
[0070] After thawing 50 μL of Escherichia coli competent cells on ice, add the above overnight ligation product, gently mix, and incubate on ice for 30 minutes. Subsequently, place the reaction mixture in a heat shock at 42°C for 90 seconds, quickly transfer it back to ice, and continue to incubate on ice for 2 minutes. Then, add 400 μL of LB liquid medium, place it in a constant temperature shaker at 37°C, and incubate with shaking at 180 rpm for 1 hour. After incubation, take the bacterial solution and evenly spread it on the surface of LB solid medium containing 100 μg / mL Amp. After the medium absorbs the bacterial solution, invert the culture dish and incubate it overnight at 37°C.
[0071] 5) Identification of positive colonies by PCR
[0072] Use a pipette tip to pick a monoclonal colony into 1 mL of LB medium containing 100 μg / mL Amp, culture it in a shaker at 180 rpm and 37°C for about 6 h, and then perform PCR identification. The upstream primers are the sense sequences of the above sgRNA sequences, namely sgRNA-1-F (ATCCG GCAGGTGGAGCCACAGCGGC), sgRNA-2-F (ATCCG GCCAGCCGACACCCAGGTG), sgRNA-3-F (ATCCGGGTCTCCTTTAAGGATAAGA), sgRNA-4-F (ATCCG GAAGTTTCTTGTGAAGTTGA), and the downstream primer uses the plasmid universal sequence (5'-CATCGCGAAGCAGCGCAAAAC-3') (SEQ ID NO.9). The PCR amplification system is shown in Table 6.
[0073] Table 6 PCR amplification system
[0074]
[0075] The PCR amplification program is as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 45 seconds, for 35 cycles; finally, extend at 72°C for 7 minutes, then lower the temperature to 12°C and hold for 20 minutes. Take 5 μL of the amplification product and perform electrophoresis analysis using 2% agarose gel. The electrophoresis conditions are set to run at 150V for 20 minutes. The electrophoresis results (see Figure 6 ) show that the positive clone presents a clear amplification band at the 167 bp position. Pick the bacterial cells from the initially screened positive clones and further verify by sequencing to confirm the sequence accuracy.
[0076] 6) Amplification of positive clones and extraction of plasmid vectors
[0077] According to the identification results, the positive bacteria were inoculated into LB liquid medium containing 100 μg / mL Amp at a dilution ratio of 1:100 and cultured overnight by shaking in a constant temperature shaker at 37°C at 180 rpm. Take 10 - 15 mL of the above-mentioned bacteria cultured overnight, separate and purify plasmid DNA according to the operation process of the endotoxin-free plasmid midiprep kit, and measure the concentration and purity.
[0078] 3. Knockout of the IGFL3 gene in human glioblastoma cell line U251
[0079] 1) Cell transfection
[0080] One day in advance, inoculate U251 cells into a 6-well plate and wait until the cell density increases to about 70% the next day. Dilute 1.5 μg of the empty vector or 4 different CRISPR / Cas9 gene knockout vectors (pLVR-sgRNA-1-CMV-Cas9, pLVR-sgRNA-2-CMV-Cas9, pLVR-sgRNA-3-CMV-Cas9, and pLVR-sgRNA-4-CMV-Cas9) separately in 150 μL of serum-free DMEM and mix well to prepare a nucleic acid dilution solution. Subsequently, add 9 μL of TGfect transfection reagent to the nucleic acid dilution solution, mix well and let it stand for 5 minutes to form a transfection complex. Add the prepared transfection complex to 2 mL of cell culture medium containing complete medium in each well, mix gently and incubate in an incubator at 37°C and 5% CO2. After culturing for 24 hours, change the culture medium; after 48 hours, add Neomycin at a final concentration of 800 μg / mL for screening. After about 1 week, when most cells die, change the medium to a medium containing 100 μg / mL Neomycin and continue to culture until the cells return to normal. The recovered cells are digested with trypsin, resuspended and counted, and then inoculated into a 96-well plate by the single-cell dilution method. After about 7 days, select the wells containing monoclonal cells and mark them. When the monoclonal cells grow to cover the bottom of the well, digest them and transfer them to a 24-well plate for amplification culture; when the cells in the 24-well plate reach confluence, digest and transfer them to a 6-well plate for further amplification.
[0081] 2) Identification of the knockout efficiency of the IGFL3 gene by Western blot
[0082] When the U251 cells in the 6-well plate grow to a confluent state, digest the cells with trypsin and centrifuge them. After collecting the cell pellet, take 1 / 3 for protein extraction, and analyze the knockout efficiency of the IGFL3 gene of the extracted protein sample by Western blot (see Figure 7). Among them, the wild-type U251 cells transfected with the empty vector were named WT, and the U251 cell clones transfected with 4 different IGFL3 gene knockout vectors were named sg1, sg2, sg3, and sg4, respectively. The results showed that no expression of IGFL3 protein was detected in the two groups of cells, sg1 and sg3, indicating that the IGFL3-sgRNA-1 sequence and the IGFL3-sgRNA-3 sequence could efficiently knockout the IGFL3 gene, and these two groups of cells were used for subsequent gene function studies.
[0083] Example 3 Effect of IGFL3 gene knockout on the radiosensitivity of human glioblastoma cell line U251
[0084] 1. Effect of IGFL3 gene knockout on the colony formation of human glioblastoma U251 under X-ray irradiation
[0085] Colony formation assay is commonly used to evaluate the radiosensitivity of tumor cells. Wild-type U251 cells (WT) in the logarithmic growth phase and U251 cells with IGFL3 gene knockout (sg1, sg3) were seeded into 12-well plates at 250 cells per well, and 1 mL of complete medium was added. After the cells adhered, they were irradiated with different doses of X-ray (0, 1, 3, 5 Gy). Approximately 14 days later, the colony formation rate was evaluated by crystal violet staining. The results are as Figure 8 shown. The colony formation rate of each group of cells gradually decreased with different doses of X-ray treatment, showing a dose-dependent manner. Under 5 Gy irradiation, the colony formation rate of the IGFL3 gene knockout groups (sg1 and sg3) was significantly lower than that of the wild-type group, and the difference was statistically significant (* P <0.05, ** P <0.01).
[0086] 2. Effect of IGFL3 gene knockout on the apoptosis of human glioblastoma cell line U251 under X-ray irradiation
[0087] U251 cells in the logarithmic growth phase were seeded into 6-well plates. When the cell density reached 70-80%, they were irradiated with 5 Gy X-ray. After 48 hours, the cells were digested with trypsin and washed, and then analyzed by flow cytometry using Annexin V / 7-AAD staining method. The results are as Figure 9 shown. After 5 Gy irradiation, the apoptosis rate of the IGFL3 gene knockout groups (sg1, sg3) was significantly higher than that of the wild-type WT group.
[0088] In summary, the present invention provides two highly efficient sgRNA sequences targeting the IGFL3 gene, providing a solid foundation for constructing an IGFL3 gene knockout model. By targeting and knocking out the IGFL3 gene in human glioblastoma cell line U251 and subjecting the cells to X-ray irradiation, the results showed that after the gene knockout, the colony formation ability of the cells was significantly decreased and the apoptosis rate was significantly increased, indicating that knocking out the IGFL3 gene can enhance the radiosensitivity of U251 cells. This invention provides strong support for in-depth study of the role of the IGFL3 gene in the radiosensitivity of glioblastoma and for developing it as a potential target for improving radiosensitivity.
[0089] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A method for enhancing the radiosensitivity of human glioblastoma cell U251, characterized in that: Knock out the IGFL3 gene of human glioblastoma cell U251, and the knockout is to knock out the IGFL3 gene using the CRISPR / Cas9 system. The sgRNA sequences targeting the knockout of the IGFL3 gene are IGFL3-sgRNA-1 or IGFL3-sgRNA-3, and their nucleotide sequences are shown as follows: IGFL3-sgRNA-1: GCCAGCCGACACCCAGGTGT; IGFL3-sgRNA-3: GCAGGTGGAGCCACAGCGGC。 2. Use of the sgRNA sequence targeting the knockout of the IGFL3 gene in enhancing the radiosensitivity of human glioblastoma cell U251, characterized in that: The sgRNA sequences are IGFL3-sgRNA-1 or IGFL3-sgRNA-3, and their nucleotide sequences are shown as follows: IGFL3-sgRNA-1: GCCAGCCGACACCCAGGTGT; IGFL3-sgRNA-3: GCAGGTGGAGCCACAGCGGC。