GbbHLH130 gene and application thereof in regulating and controlling drought stress response of island cotton

Abstract

The invention provides a GbbHLH130 gene and application thereof in regulating and controlling drought stress response of island cotton, and belongs to the technical field of gene engineering. The core nucleotide sequence of the gossypium barbadense GbbHLH130 gene is as shown in SEQ ID NO: 1. According to the invention, sequence analysis is carried out on a 3 'UTR region of a GbbHLH130 gene, a GbbHLH130 silent vector is constructed, and sea island cotton is transformed by using a virus-induced gene silencing technology, so that transgenic sea island cotton is obtained. QPCR (quantitative polymerase chain reaction) detects that the expression quantity of the GbbHLH130 gene in the gossypium barbadense is obviously lower than that of a control plant; through drought simulation and drought stress phenotype observation of 15% PEG6000, it is found that the drought resistance of sea island cotton can be reduced by silencing GbbHLH130. Therefore, the GbbHLH130 gene is deduced to play a positive regulation role in the drought stress of the sea island cotton, and an ideal candidate gene is provided for the drought stress resistance of the sea island cotton.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and in particular relates to a GbbHLH130 gene and application thereof in regulating drought stress response of sea island cotton. Background Art

[0002] Abiotic stresses such as drought, salinity, extreme temperature and oxygen damage cause serious damage to plant growth and development, thereby reducing crop yields. When plants encounter abiotic stress, a series of physiological and biochemical reactions will occur in their bodies, such as reduced photosynthesis, increased respiration rate and closure of stomata.

[0003] Cotton is the most important fiber crop in my country, the second largest source of plant protein for feed and the fourth largest source of edible oil. Its production not only involves agriculture, but is also a commodity in the textile industry. Sea Island cotton, also known as long-staple cotton, has excellent fiber quality and is an important raw material for high-end, specialty cotton textiles. Abiotic stresses such as drought and salinity seriously affect the growth and survival of Sea Island cotton and reduce its yield. The traditional breeding cycle is long and cannot accurately improve a certain trait, while the transgenic breeding cycle is relatively short and the expected offspring can be obtained. Therefore, it is particularly important to use transgenic breeding to cultivate new drought-resistant cotton varieties. Summary of the invention

[0004] The present invention provides a GbbHLH130 gene and its application in regulating the drought stress response of sea island cotton. Through 15% PEG6000 simulation of drought and drought stress phenotype observation, it is found that silencing the GbbHLH130 gene can reduce the drought resistance of sea island cotton. It is inferred that the GbbHLH130 gene plays a positive regulatory role in drought stress of sea island cotton, providing an ideal candidate gene for sea island cotton to resist drought stress.

[0005] In order to achieve the above object, the present invention provides a sea island cotton GbbHLH130 gene, the core nucleotide sequence of the sea island cotton GbbHLH130 gene is shown in SEQ ID NO:1.

[0006] The present invention also provides a 3'UTR region containing the core nucleotide sequence of the GbbHLH130 gene of the sea island cotton described in the above technical solution, and the nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:2.

[0007] The present invention also provides an application of the GbbHLH130 gene of the above technical solution in positively regulating drought stress response of G. barbadense. The core nucleotide sequence of the GbbHLH130 gene of G. barbadense is shown in SEQ ID NO:1.

[0008] The present invention also provides a method for preparing drought-resistant Sea Island cotton, by silencing the core nucleotide sequence of the Sea Island cotton GbbHLH130 gene in the 3'UTR region of the above technical solution to obtain drought-intolerant Sea Island cotton;

[0009] The nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:2, and the core nucleotide sequence of the GbbHLH130 gene of G. barbadense is shown in SEQ ID NO:1.

[0010] The present invention also provides an application of the core nucleotide sequence of the GbbHLH130 gene of the Sea Island cotton in the 3'UTR region of the above technical solution in silencing in the preparation of drought-intolerant Sea Island cotton, characterized in that the nucleotide sequence of the 3'UTR region is as shown in SEQ ID NO: 2, and the core nucleotide sequence of the GbbHLH130 gene of the Sea Island cotton is as shown in SEQ ID NO: 1.

[0011] The present invention also provides a PCR method for extracting and amplifying the 3'UTR region containing the core nucleotide sequence of the GbbHLH130 gene of Sea Island Cotton according to the above technical solution, comprising the following steps:

[0012] Extract DNA from leaves of sea island cotton;

[0013] Using the leaf DNA of sea island cotton as a template, PCR amplification was performed using cloning primers and LA-Taq polymerase; wherein:

[0014] PCR reaction system: template DNA 1.0 μL, forward primer 2.0 μL, reverse primer 2.0 μL, 10× PCR buffer 5.0 μL, dNTPs 4.0 μL, LA-Taq polymerase 0.5 μL and ddH2O 35.5 μL, total volume 50 μL.

[0015] Preferably, the cloning primers used are:

[0016] GbbHLH130-pTRV2-F:

[0017] 5'-tgagtaaggttaccgaattcGGAAAGTGAAGATGTAGCCATT-3';

[0018] GbbHLH130-pTRV2-R:

[0019] 5'-gcgtgagctcggtaccCGATACTCCTTAAGTTAGGTCC-3'.

[0020] Preferably, the PCR amplification procedure is:

[0021] Pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s; annealing at 58°C for 30 s; extension at 72°C for 60 s; 34 PCR cycles, extension at 72°C for 10 min.

[0022] The present invention also provides a method for preparing a drought-intolerant sea island cotton complex plant, comprising the following steps:

[0023] Using the pTRV2 viral silencing vector, the 3'UTR region containing the core nucleotide sequence of the GbbHLH130 gene of the sea island cotton described in claim 2 is connected to the pTRV2 viral silencing vector by homologous recombination, and is transferred into Agrobacterium GV3101 by the freeze-thaw method to obtain GbbHLH130-pTRV2;

[0024] Agrobacterium cultures of pTRV1 and GbbHLH130-pTRV2 were mixed in a ratio of 1:1 and infiltrated into two intact cotyledons of cotton seedlings at the two-leaf one-heart stage using a needleless syringe to obtain drought-intolerant sea island cotton complex plants.

[0025] Compared with the prior art, the advantages and positive effects of the present invention are:

[0026] 1. The present invention constructs a GbbHLH130 silencing vector by sequence analysis of the 3'UTR region of the GbbHLH130 gene, and transforms the island cotton using virus-induced gene silencing technology (using pTRV2 as a virus silencing vector) to obtain transgenic island cotton complex plants.

[0027] 2. The expression level of GbbHLH130 gene in sea island cotton was significantly lower than that in control plants by qPCR detection; the phenotype observation of drought and drought stress simulated by 15% PEG6000 showed that silencing GbbHLH130 would reduce the drought resistance of sea island cotton. It is inferred that GbbHLH130 gene plays a positive regulatory role in drought stress of sea island cotton, providing an ideal candidate gene for sea island cotton to resist drought stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 A schematic diagram of the expression level of the GbbHLH130 gene provided in an embodiment of the present invention, wherein the left figure shows the expression levels in different tissues; the right figure shows the expression levels in different time periods under drought stress;

[0029] Figure 2 The virus-induced silencing vector provided in the embodiment of the present invention is constructed, wherein M: DL2000; 1: GbbHLH130-pTRV2 silencing vector amplification;

[0030] Figure 3The virus-induced silencing vector PCR detection provided in the embodiment of the present invention, wherein, M: DL2000; b: 1-7: GbbHLH130-pTRV2 silencing vector PCR detection;

[0031] Figure 4 PCR detection of Agrobacterium transformation of the GbbHLH130-pTRV2 silencing vector provided in the embodiment of the present invention, wherein M: DL2000, 1-8: PCR detection of GbbHLH130-pTRV2 Agrobacterium transformation;

[0032] Figure 5 A cotton albino phenotype diagram provided by an embodiment of the present invention;

[0033] Figure 6 A schematic diagram of qPCR detection of GbbHLH130-pTRV2 silenced cotton provided in an embodiment of the present invention;

[0034] Figure 7 This is a diagram for detecting drought resistance of GbbHLH130-pTRV2 silenced cotton provided in an embodiment of the present invention, wherein the left side shows the phenotypic observation of GbbHLH130-pTRV2 silenced cotton and control plants after normal growth for 30 days and drought stress for 1 week; the right side shows the survival rate statistics of GbbHLH130-pTRV2 silenced cotton and control plants; the experiment was repeated 3 times independently;

[0035] Figure 8 A schematic diagram of PEG stress of GbbHLH130-pTRV2 silenced cotton and control plants provided in an embodiment of the present invention;

[0036] Fig. 9 Schematic diagram of the measurement of physiological indicators of GbbHLH130-pTRV2 silenced cotton and control plants before and after drought stress provided in an embodiment of the present invention, wherein, the upper figure: the measurement of H2O2 content; the middle figure: the measurement of SOD content; the lower figure: the measurement of MDA content (*P<0.05, **P<0.01). DETAILED DESCRIPTION

[0037] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] Example 1 Bioinformatics Analysis of GbbHLH130

[0039] Firstly, the coding sequence of GbbHLH130 and the 3000bp sequence of the upstream promoter were obtained using the cotton omics database (http: / / cotton.zju.edu.cn / ), and the secondary structure, molecular weight and isoelectric point of the GbbHLH130 protein were analyzed using DNAstar software.

[0040] The results showed that the full length of the GbbHLH130 gene was 1020bp, and its core nucleotide sequence was shown in SEQ ID NO:1, encoding 339 amino acids (the amino acid sequence was shown in SEQ ID NO:3), with a molecular weight of 38018.43kD and an isoelectric point of 8.52. It was mainly composed of α-helix and random coil, of which 124 α-helices accounted for 36.58% and 175 random coils accounted for 51.62%.

[0041] The upstream 3000bp sequence of GbbHLH130 promoter was analyzed through Plant-CARE website, and it was found that it had light response elements (AAAC-motif, I-box, TCT-motif, etc.), abscisic acid response element ABRE, MYB binding site MBS involved in drought induction, gibberellin response element P-box and gibberellin response element TATC-box, as shown in Table 1.

[0042] Table 1 Prediction of cis-acting elements

[0043]

[0044] Example 2 Expression patterns in different tissues and under drought stress

[0045] Seeds of the sea island cotton variety Xinhai No. 16 (XH16) were sown in nutrient soil, and when they grew to the 3-leaf stage, different tissues (roots, stems, leaves and cotyledons) were collected and stored in a -80°C refrigerator for later use. The remaining healthy 3-leaf cotton with consistent growth was transferred to hydroponics, and after 2 days of recovery, it was transferred to Hoagland's nutrient solution and treated with 15% (mass fraction) PEG 6000. Cotton leaves were collected at 0h, 2h, 4h, 6h, 12h and 24h after treatment, and the total RNA of different cotton tissues and leaves after PEG 6000 stress treatment was extracted using a plant total RNA extraction kit (Tiangen Reagent Company). The extracted total RNA of different cotton tissues and leaves after PEG 6000 stress treatment was reverse transcribed to synthesize the first chain of cDNA, wherein the reverse transcription synthesis system is shown in Table 2.

[0046] Table 2 Reverse transcription system

[0047]

[0048] After mixing, centrifuge briefly, and then place it in a constant temperature water bath for incubation at 25°C for 5 min, followed by incubation at 42°C for 60 min, and finally at 70°C for 5 min to terminate the reaction. Store in a -80°C refrigerator for subsequent experiments.

[0049] Real-time fluorescence quantitative PCR

[0050] The TransStart TipGreen qPCR SuperMix (+DyeⅡ) kit ordered by Beijing Quanshijin Biotechnology Co., Ltd. was used to quantitatively analyze GbbHLH130 in different tissues of cotton and leaves after PEG 6000 stress treatment. To ensure the credibility of the test results, the concentration of the extracted RNA was adjusted to 2 μg / μL before reverse transcription.

[0051] According to the CDS sequence of GbbHLH130, the fluorescent quantitative primers GbbHLH130-qF: TTGCAAACTCGGAACCAGGA; GbbHLH130-qR: CGAATCTTGCAAGGGACCGA were designed and synthesized using the primer software DNAMAN. The amplification system is shown in Table 3.

[0052] Table 3 Fluorescence quantitative amplification system

[0053]

[0054] Adoption 2 -△△Ct The relative expression of the target gene was analyzed by the method, and three biological replicates were set.

[0055] like Figure 1 The results showed that the expression level of GbbHLH130 was highest in cotyledons (12.5 times), followed by leaves (4.9 times) and roots (3.52 times), and the lowest in stems (1 times).

[0056] Example 3 Construction of virus-induced gene silencing vector for GbbHLH130 gene

[0057] Gene silencing vector construction

[0058] Use Quanshijin -Basic Seamless Cloning and Assembly Kit was used to complete the vector construction. The following primers were designed in the 3'UTR region containing the core nucleotide sequence of the GbbHLH130 gene of G. barbadense (its nucleotide sequence is shown in SEQ ID NO: 2, a total of 329 bp of nucleotide sequence):

[0059] GbbHLH130-pTRV2-F:

[0060] tgagtaaggttaccgaattcGGAAAGTGAAGATGTAGCCATT;

[0061] GbbHLH130-pTRV2-R:

[0062] gcgtgagctcggtaccCGATACTCCTTAAGTTAGGTCC,

[0063] PCR amplification was performed using DNA from XH16 leaves as a template. The amplification system was as follows:

[0064]

[0065] The PCR reaction program was as follows: 94°C, 3 min; 94°C, 30 s, 58°C, 30 s, 72°C, 30 s, 34 cycles; 72°C, 10 min; 5 μl of PCR product was taken and detected by 1% agarose gel electrophoresis. Figure 2 The pTRV2 empty vector was double-digested and then connected with the PCR product, and then transformed into DH5α competent cells. After PCR detection of the bacterial solution, the Figure 3 As shown, a band of the same size as the target band was obtained, and the positive clone was subsequently sequenced and verified and named as the GbbHLH130-pTRV2 recombinant plasmid.

[0066] Example 4 GbbHLH130 gene Agrobacterium transformation and cotton transformation

[0067] Preparation of Agrobacterium GV3101 competent cells

[0068] (1) Activation of GV3101 bacterial solution: In a clean bench, use a sterilized inoculation loop to pick up a small amount of GV3101 bacterial solution and streak it continuously on a YEP solid medium plate containing rifampicin resistance prepared in advance. Then seal the plate and place it upside down in a constant temperature incubator at 28°C for about 2 days;

[0069] (2) Pick a single colony and inoculate it into 5 ml of YEP liquid medium supplemented with 50 mg / L rifampicin, and culture it overnight at 28°C in a shaking incubator (speed > 200 rpm);

[0070] (3) Add 1 ml of culture to 100 ml (two 50 ml bottles) of liquid YEP and continue to culture on a shaker at 28°C until the OD600 is about 0.8-1;

[0071] (4) Place the culture on ice and shake it to cool the culture rapidly. Keep it on ice for at least 15 minutes.

[0072] (5) The bacterial suspension was divided into 80 ml centrifuge tubes, centrifuged at 4000 g for 5 min at 4°C, the supernatant was discarded, 50 ml of ice-cold 10% glycerol (ddH2O) was added to suspend the bacteria, and centrifuged at 4000 g for 5 min;

[0073] (6) Discard the supernatant, add 25 ml of ice-cold 10% glycerol (ddH2O) to suspend the cells, and centrifuge at 4000g for 5 min;

[0074] (7) Discard the supernatant, add 10 ml of ice-cold 10% glycerol (ddH2O) to suspend the cells, and centrifuge at 4000g for 5 min;

[0075] (8) Discard the supernatant, resuspend the cells with 10% glycerol to a final volume of 2-3 ml, and dispense into 80 μL / tubes. Freeze in liquid nitrogen and store at -70°C.

[0076] Electrotransformation of competent Agrobacterium GV3101

[0077] (1) Use tweezers to take out the electric shock cup and lid from anhydrous ethanol, turn it upside down on filter paper, and let it dry;

[0078] (2) Take out the Agrobacterium electroporation competent cells from -70°C and place them on ice;

[0079] (3) Turn on the electroporator, set the setting to manual, and adjust the "△" to 2.2KV-2.5KV;

[0080] (4) Cover the dried electric shock cup with a lid and place it in an ice bath;

[0081] (5) Pipette 2 μL of GbbHLH130-pTRV2 recombinant plasmid and add it to the competent medium. Then mix the competent medium with a 200 μL pipette and transfer it to a click cup. Cover it and place it on ice for 1 min.

[0082] (6) Use filter paper to quickly clean the water around the electric shock cup, put the electric shock cup into the clicking instrument, press the "pulse" button and click, and stop when you hear the sound;

[0083] (7) Quickly add 1 mL of liquid LB medium to the electroporation cup, mix well, aspirate, and transfer to the tube containing the competent cell;

[0084] (8) Incubate at 28°C for 1 hour, aspirate 100 μL of the culture medium and spread it on a plate containing rifampicin and kanamycin resistance culture medium, and invert and incubate for 36 hours.

[0085] (9) Pick a single clone on the plate, add it to 1 mL of liquid LB medium containing rifampicin and kanamycin resistance, and culture at 28°C for 24 hours.

[0086] (10) Perform PCR test on the bacterial solution, such as Figure 4 As shown, bands of the same size were obtained, indicating that the transformation of Agrobacterium was successful.

[0087] Cotton conversion

[0088] (1) Soak cotton seeds in 50% hydrogen peroxide for 6 h, sow them in nutrient soil (the volume ratio of nutrient soil to plant stone is 1:1), 2 plants per pot, and cultivate them in a greenhouse (28°C, 16 h light / 8 h dark).

[0089] (2) When cotton grows to the two-leaf and one-heart stage, take freshly cultured single colonies of Agrobacterium carrying auxiliary vector pTRV1, negative control vector pTRV2, positive control pTRV2-GbCLA and GbbHLH130-pTRV2 recombinant plasmids and inoculate them into 3 ml LB (kanamycin, 100 ug / ml; rifampicin, 50 ug / ml), respectively. After culturing at 28°C, 170 rpm for 16 h, add 1% accession amount to 50 ml LB (kanamycin, 100 ug / ml; rifampicin, 50 ug / ml), and culture at 28°C, 170 rpm for 12 h. When the OD600 of the bacterial solution is about 0.5, centrifuge at 4000 rpm for 10 minutes to collect the bacterial cells, and add an appropriate volume of resuspension solution (10 mM MgCl2, 10 mM MES and 200uM acetosyringone) were resuspended to a final concentration of 2.0, and the resuspension was placed at 28°C in the dark for 3h. The pTRV1 resuspension, pTRV2 resuspension, GbCLA-pTRV2 resuspension and Agrobacterium resuspension of the GbbHLH130-pTRV2 recombinant plasmid were mixed at a ratio of 1:1 (v / v) and used for inoculation.

[0090] (3) Using the leaf syringe infiltration method, first use the syringe needle to gently puncture the back of the cotyledon to create a microwound, and then use a syringe without the needle to inject the bacterial solution (pTRV1+pTRV2; pTRV1+GbCLA-pTRV2; pTRV1+GbbHLH130-pTRV2) from the wound on the back.

[0091] Example 4 Identification of Silent Plants

[0092] About 14 days after Agrobacterium infection, the leaves of GbCLA-pTRV2 plants showed a white phenotype ( Figure 5 ), indicating that GbbHLH130-pTRV2 and control cotton plants pTRV2 could be silenced.

[0093] Three GbbHLH130-pTRV2 transgenic cotton plants and pTRV2 control plants were randomly selected, and the plant total RNA extraction kit (Tiangen Reagent Company) was used to extract RNA from the leaves of transgenic cotton. The extracted leaf total RNA was reverse transcribed to synthesize the first chain of cDNA, and the reverse transcription synthesis system is shown in Table 1. After mixing, it was briefly centrifuged and then placed in a constant temperature water bath for incubation at 25°C for 5 minutes, followed by incubation at 42°C for 60 minutes, and finally 70°C for 5 minutes to terminate the reaction. It was stored in a -80°C low-temperature refrigerator for subsequent experiments. The TransStart TipGreen qPCR Super Mix (+DyeⅡ) kit ordered by Beijing Quanshijin Biotechnology Co., Ltd. was used for quantitative analysis of GbbHLH130 in transgenic cotton leaves and control plant leaves. To ensure the credibility of the test results, the extracted RNA concentration was adjusted to 2μg / μL before reverse transcription. The fluorescent quantitative primers GbbHLH130-qF: TTGCAAACTCGGAACCAGGA; GbbHLH130-qR: CGAATCTTGCAAGGGACCGA were used, and the amplification system was shown in Table 2. -□□Ct The relative expression of the target gene was analyzed by the method, and three biological replicates were set. Figure 6 As shown, compared with the control pTRV, the expression levels of the GbbHLH130 gene in the three strains of GbbHLH130-pTRV2-1 / 2 / 3 decreased by 60.6%, 71.37% and 49.1%, respectively.

[0094] Example 5 Functional analysis of GbbHLH130-silenced cotton after drought stress

[0095] GbbHLH130-pTRV2 transgenic cotton and pTRV2 control plants were used as subsequent experimental materials.

[0096] Drought resistance testing of transgenic cotton

[0097] GbbHLH130-pTRV2 transgenic cotton plants and control plants were planted in the same pot, and all cotton plants were regularly watered for 7 days; watering was stopped for 15 days, and the phenotypes were observed and photographed. The experiment was repeated 3 times (30 replicates for each strain).

[0098] PEG treatment of transgenic cotton

[0099] After 30 days of normal growth, GbbHLH130-pTRV2 transgenic cotton plants and control plants were transferred to water containing 15% PEG and cultured for 1 day under simulated drought stress, and the phenotypes were observed and the survival rate was calculated. The experiment was repeated 3 times (15 replicates for each strain).

[0100] like Figure 7As shown, GbbHLH130-pTRV2 transgenic cotton and pTRV2 control plants were subjected to drought for 15 days. The results showed that the degree of wilting of GbbHLH130-pTRV2 transgenic cotton plants after drought stress was more serious than that of pTRV2 control plants, and the survival rate of GbbHLH130-pTRV2 transgenic cotton plants was 27.35%, which was significantly lower than that of pTRV2 control plants (83.05%).

[0101] like Figure 8 As shown, after 15% PEG simulated drought stress, the wilting degree of GbbHLH130-pTRV2 transgenic cotton plants was more serious than that of pTRV2 control plants.

[0102] Example 6 Analysis of the physiological mechanism of GbbHLH130 under drought stress

[0103] The kit provided by Nanjing Jiancheng Biotechnology was used to detect the contents of H2O2, MDA, Pro and SOD in GbbHLH130-pTRV2 transgenic cotton and control pTRV2 plants under drought stress. The specific method is referred to the kit instructions.

[0104] like Fig. 9 As shown in the figure, before drought stress, the H2O2, MDA, Pro and SOD contents in GbbHLH130-pTRV2 transgenic cotton and control pTRV2 cotton were no different from those in the control. After drought stress, the H2O2 content in GbbHLH130-pTRV2 transgenic cotton was 19.8, while the H2O2 content in the control pTRV2 plants was 11.1; the MDA content in GbbHLH130-pTRV2 transgenic cotton was 10.3, while the MDA content in the control pTRV2 plants was 4.4; the SOD content in GbbHLH130-pTRV2 transgenic cotton was 376, while the SOD content in the control pTRV2 plants was 519.7. This indicates that silencing GbbHLH130 aggravates the damage to the cell membrane, thereby enhancing the damage of drought stress to transgenic plants.

Claims

1. The GbbHLH130 gene of sea island cotton is characterized by: The core nucleotide sequence of the GbbHLH130 gene of sea island cotton is shown in SEQ ID NO:

1.

2. A 3'UTR region containing the core nucleotide sequence of the GbbHLH130 gene of Gossypium barbadense according to claim 1, characterized in that: The nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:

2.

3. The use of the GbbHLH130 gene of sea island cotton in positively regulating drought stress response of sea island cotton according to claim 1, characterized in that: The core nucleotide sequence of the GbbHLH130 gene of sea island cotton is shown in SEQ ID NO:

1.

4. A method for preparing drought-intolerant Sea Island cotton, characterized in that: Obtaining drought-intolerant Sea Island cotton by silencing the core nucleotide sequence of the Sea Island cotton GbbHLH130 gene in the 3'UTR region of claim 2; The nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:2, and the core nucleotide sequence of the GbbHLH130 gene of G. barbadense is shown in SEQ ID NO:

1.

5. Use of the core nucleotide sequence of the GbbHLH130 gene of the silencing 3'UTR region of claim 2 in the preparation of drought-intolerant G. barbadense, characterized in that: The nucleotide sequence of the 3'UTR region is shown in SEQ ID NO:2, and the core nucleotide sequence of the GbbHLH130 gene of G. barbadense is shown in SEQ ID NO:

1.

6. A PCR method for extracting and amplifying the 3'UTR region containing the core nucleotide sequence of the GbbHLH130 gene of Gossypium barbadense according to claim 2, characterized in that: The following steps are involved: Extract DNA from leaves of sea island cotton; Using the leaf DNA of sea island cotton as a template, PCR amplification was performed using cloning primers and LA-Taq polymerase; wherein: PCR reaction system: template DNA 1.0 μL, forward primer 2.0 μL, reverse primer 2.0 μL, 10× PCR buffer 5.0 μL, dNTPs 4.0 μL, LA-Taq polymerase 0.5 μL and ddH2O 35.5 μL, total volume 50 μL.

7. The method according to claim 6, characterized in that The cloning primers used were: GbbHLH130-pTRV2-F: 5'-tgagtaaggttaccgaattcGGAAAGTGAAGATGTAGCCATT-3'; GbbHLH130-pTRV2-R: 5'-gcgtgagctcggtaccCGATACTCCTTAAGTTAGGTCC-3'.

8. The method according to claim 6, characterized in that The PCR amplification procedure is: Pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s; annealing at 58°C for 30 s; extension at 72°C for 60 s; 34 PCR cycles, extension at 72°C for 10 min.

9. A method for preparing drought-intolerant sea island cotton complex plants, characterized in that: The following steps are involved: Using the pTRV2 viral silencing vector, the 3'UTR region containing the core nucleotide sequence of the GbbHLH130 gene of the sea island cotton described in claim 2 is connected to the pTRV2 viral silencing vector by homologous recombination, and is transferred into Agrobacterium GV3101 by the freeze-thaw method to obtain GbbHLH130-pTRV2; Agrobacterium cultures of pTRV1 and GbbHLH130-pTRV2 were mixed in a ratio of 1:1 and infiltrated into two intact cotyledons of cotton seedlings at the two-leaf one-heart stage using a needleless syringe to obtain drought-intolerant sea island cotton complex plants.

Images