Nucleic acid amplification efficiency optimization control method and nucleic acid quantitative detection system

Abstract

The invention belongs to the technical field of biological and genetic engineering, and particularly relates to a nucleic acid amplification efficiency optimization control method and a nucleic acid quantitative detection system. According to the nucleic acid amplification efficiency optimization control method disclosed by the invention, the nucleic acid amplification efficiency is optimized by combining control modes such as temperature and fluorescence real-time regulation and control, and the nucleic acid amplification efficiency is optimized by monitoring the real-time state of the nucleic acid amplification reaction and dynamically and adaptively adjusting the temperature condition of the nucleic acid amplification reaction; the nucleic acid amplification efficiency is improved, the quantitative detection repeatability is optimized, the nucleic acid amplification efficiency is improved, the amplification consistency is optimized, and the quantitative detection repeatability of the nucleic acid is effectively improved.

Description

Technical Field

[0001] The invention belongs to the technical field of biology and genetic engineering, and specifically relates to a nucleic acid amplification efficiency optimization control method and a nucleic acid quantitative detection system. Background Art

[0002] In vitro amplification of nucleic acids is the basis of molecular biology research and one of the important molecular diagnostic technologies in the biomedical field. It has important applications in disease diagnosis and pathogen detection, and is also widely used in precision medicine, food safety testing, and public safety monitoring. With the development of biotechnology, more and more in vitro amplification technologies for nucleic acids have emerged, such as polymerase chain reaction (PCR amplification) and loop-mediated isothermal amplification. At present, real-time fluorescence quantitative PCR and digital PCR based on polymerase chain reaction (PCR) are important technical means to achieve quantitative detection of nucleic acids. Among these technologies, the efficiency of nucleic acid amplification has an important influence on the accuracy of quantitative detection of nucleic acids, and is one of the key factors that need to be focused on in the implementation of quantitative detection of nucleic acids.

[0003] However, due to the high sensitivity of nucleic acid in vitro amplification technology, if the experimental environment is contaminated by aerosols, false positive results are easily generated. In addition, since two or more primers are involved in the process of nucleic acid in vitro amplification reaction, non-specific binding between primers is inevitable to produce primer dimers, which will consume the reaction substrate in the reaction system, thereby reducing the efficiency of the reaction and the detection sensitivity, and at the same time, it is easy to cause false positive results and misjudgment of the results. In particular, nucleic acid amplification detection requires dozens of temperature cycles. It is restricted by various factors such as nucleic acid amplification temperature conditions and changes in the relative concentration of template nucleic acid. The efficiency of nucleic acid amplification is a dynamic change process in the entire detection process: at the beginning of amplification, the concentration of template nucleic acid molecules is low, which is not conducive to the start of the amplification reaction, resulting in a relatively low amplification efficiency; after performing multiple rounds of amplification, due to the increase in the concentration of template nucleic acid, the nucleic acid amplification reaction is inhibited to a certain extent, and the efficiency of nucleic acid amplification is also limited; at the same time, in the process of nucleic acid amplification, primer annealing, enzyme binding and extension reactions are in a state of mutual promotion and competition. Maintaining constant amplification conditions in the annealing and extension phase of a round of amplification is also prone to incomplete amplification, affecting the efficiency of nucleic acid amplification.

[0004] In order to achieve higher detection accuracy and detection repeatability, how to optimize the efficiency of nucleic acid amplification has become one of the key issues that researchers need to solve. At present, one of the commonly used optimization schemes is to artificially control the concentration of target nucleic acid during nucleic acid amplification. For example, the scheme in Chinese patent CN112251500A increases the nucleic acid concentration at the beginning of amplification and reduces the nucleic acid concentration in the later stage of amplification by adding reagents such as amplification premix and primers to the amplification system in batches to improve the nucleic acid amplification efficiency of the entire amplification process. The second is to achieve this by optimizing the nucleic acid amplification system. For example, the scheme in Chinese patent CN110423796A improves the efficiency of nucleic acid amplification by introducing carbon quantum dots; such as Chinese patent CN114875119A improves the efficiency of nucleic acid amplification by introducing polydocanol and DNA mismatch repair proteins. However, the above method is relatively cumbersome to operate, and requires formula improvement in nucleic acid amplification reaction system reagents, which is also relatively difficult.

[0005] Therefore, the field of nucleic acid amplification technology is expected to establish a method for optimizing the control of nucleic acid amplification efficiency by monitoring the real-time state of the nucleic acid amplification reaction and dynamically and adaptively adjusting the temperature conditions of the nucleic acid amplification reaction. This has always been a technical problem that needs to be urgently solved in the field of nucleic acid amplification technology. Summary of the invention

[0006] To this end, the technical problem to be solved by the present invention is to provide a method for optimizing and controlling nucleic acid amplification efficiency, which effectively realizes the improvement of nucleic acid amplification efficiency and consistency optimization in the PCR process;

[0007] The second technical problem to be solved by the present invention is to provide a nucleic acid quantitative detection system.

[0008] In order to solve the above technical problems, a method for optimizing and controlling nucleic acid amplification efficiency described in the present invention includes the steps of preliminary experiment and optimization experiment; wherein:

[0009] The preliminary experiment includes:

[0010] (a1) conducting a preliminary experiment to determine the temperature condition for nucleic acid denaturation: preparing a nucleic acid amplification mixture, performing a first nucleic acid amplification by real-time fluorescence quantitative PCR, and obtaining a first melting curve after a first melting, obtaining a normalized fluorescence curve and a second-order derivative result of the melting process by analysis, and recording characteristic temperature points T1 and T2 of the derivative curve; wherein T1 is the temperature corresponding to the lowest point of the second-order derivative curve, and T2 is the temperature corresponding to the highest point of the second-order derivative curve;

[0011] (a2) conducting a preliminary experiment to determine the nucleic acid annealing extension temperature conditions: preparing a primer reaction mixture, performing a second nucleic acid amplification by real-time fluorescence quantitative PCR, and obtaining a second melting curve after a second melting, obtaining a primer melting fluorescence intensity change curve and a second derivative result by analysis, and recording characteristic temperatures T3 and T4 of the derivative curve; wherein T3 is the temperature corresponding to the lowest point of the second derivative curve, and T4 is the temperature corresponding to the highest point of the second derivative;

[0012] The optimization experimental steps include:

[0013] (b1) dynamically adjusting the target fluorescence quantitative PCR conditions according to the temperatures T1, T2, T3 and T4 determined in the preliminary experimental step, continuously collecting the fluorescence value changes of the target fluorescence channel of the reaction system, and obtaining the fluorescence continuous change curve of the nucleic acid amplification reaction process; and obtaining the fluorescence steady-state value of each nucleic acid annealing extension stage in the nucleic acid amplification;

[0014] (b2) drawing and fitting a fluorescence envelope growth curve according to the fluorescence steady-state value of each nucleic acid annealing and extension stage, and drawing continuous change curves of multiple samples;

[0015] (b3) Calculate the number and concentration of target nucleic acid molecules contained in each sample in different application scenarios.

[0016] Specifically, in the nucleic acid amplification efficiency optimization control method, in the step (a1), the nucleic acid amplification mixture includes a target nucleic acid template, a primer, a polymerase, and a premix;

[0017] Preferably, the premix includes a reaction buffer, a fluorescent dye and / or deionized water;

[0018] Preferably, the number n of thermal cycles of the first nucleic acid amplification is 30-50 cycles;

[0019] Preferably, the temperature of the first melting step is set to: increase from 60°C to 95°C.

[0020] Specifically, in the nucleic acid amplification efficiency optimization control method, in the step (a2), the primer reaction mixture includes primers, primer complementary chains, polymerase, and premixed solution;

[0021] Preferably, the premix includes a reaction buffer, a fluorescent dye and / or deionized water;

[0022] Preferably, the temperature of the second melting step is set as: the temperature is increased from 40°C to 80°C.

[0023] Specifically, in the nucleic acid amplification efficiency optimization control method, in the step (b1), in the dynamic adjustment step, a single thermal cycle of the fluorescent quantitative PCR is divided into the following stages:

[0024] High temperature denaturation stage S1, setting the temperature to the temperature T2, and setting the pre-denaturation time t1 and the cycle stage denaturation time t3;

[0025] In the cooling stage S2, the temperature change rate v1 is set until the temperature drops to the temperature T3;

[0026] Nucleic acid annealing and extension stage S3, setting the temperature change rate v2 until the temperature rises to the temperature T4, and the time consumed in this stage is t2;

[0027] Rapid heating stage S4, setting the temperature change rate v3 until the temperature rises to the temperature T2;

[0028] Preferably, a constant temperature stage S5 is further included between S3 and S4, and the set temperature is maintained at T4, and the fluorescence intensity of the amplification reaction will continue to increase until the fluorescence intensity of all target fluorescence channels reaches a steady state (CV≤5%), and the time consumed is t4;

[0029] Preferably, the number n of thermal cycles of the fluorescent quantitative PCR is 40, constituting the nucleic acid variable temperature amplification reaction process.

[0030] In the nucleic acid annealing extension stage S3, within the basic time t2, if the fluorescence intensity in all target fluorescence channels has reached a stable state (based on the fluorescence change CV value, such as CV≤5%), the annealing extension stage ends and there is no need to add the S5 stage; if the fluorescence intensity of all target fluorescence channels cannot be stabilized within the basic time t2, the constant temperature stage S5 is executed, in which the temperature is maintained at T4, and the fluorescence intensity continues to increase until the fluorescence intensity of all target fluorescence channels reaches a steady state (CV≤5%), and the additional time consumed is t4. At this time, the time consumed in the entire nucleic acid annealing extension stage is calculated as t2'=t2+t4.

[0031] Specifically, the nucleic acid amplification efficiency optimization control method is:

[0032] In the S1 stage, the pre-denaturation time t1 and / or the cycle stage denaturation time t3 are independently 1-120s; and / or,

[0033] In the S2 stage, the temperature change rate v1 is 1-10°C / s; and / or,

[0034] In the S3 stage, the temperature change rate v2 is 0.1-5°C / s; and / or,

[0035] In the S4 stage, the temperature change rate v3 is 1-10°C / s.

[0036] Specifically, in the nucleic acid amplification efficiency optimization control method, in the S3 stage, while performing temperature thermal cycling, the fluorescence value changes of the target fluorescence channel of the reaction system and the fluorescence steady-state value of each nucleic acid annealing extension stage are continuously collected.

[0037] Specifically, in the nucleic acid amplification efficiency optimization control method, in the step (b2), the fluorescence envelope growth curve includes fitting using a sigmoid growth curve, a cubic function curve, or a quartic function curve.

[0038] Specifically, in the nucleic acid amplification efficiency optimization control method, in step (b3), the application scenario includes real-time fluorescence quantitative PCR or real-time digital PCR; wherein,

[0039] In the real-time fluorescence quantitative PCR, according to the ΔCt method or 2 (-ΔΔCT) Methods The relative expression of nucleic acid in each sample was calculated;

[0040] In the real-time digital PCR, each amplification curve C is calculated. t Value, preset threshold C th t , such as C t >C th t , then the micro-reaction unit determines micro-negative; if C t <C th t , then the micro-reaction unit is judged as positive, and the nucleic acid quantitative copy number concentration C is calculated according to the following digital PCR quantitative formula:

[0041]

[0042] Among them, N neg -Number of negative microunits; N T -Total number of microcells; V m -Microcell volume.

[0043] The invention also discloses the application of the nucleic acid amplification efficiency optimization control method in the field of genetic engineering.

[0044] The present invention also discloses a nucleic acid quantitative detection system for implementing the nucleic acid amplification efficiency optimization control method, comprising a detection device and a control system; wherein the control system operates according to the nucleic acid amplification efficiency optimization control method.

[0045] The nucleic acid amplification efficiency optimization control method of the present invention optimizes the nucleic acid amplification efficiency by combining control methods such as temperature and real-time fluorescence regulation. The real-time state of the nucleic acid amplification reaction is monitored and the temperature conditions of the nucleic acid amplification reaction are dynamically and adaptively adjusted to achieve the purpose of improving the nucleic acid amplification efficiency and optimizing the repeatability of quantitative detection. This not only improves the nucleic acid amplification efficiency and optimizes the consistency of amplification, but also more effectively improves the repeatability of nucleic acid quantitative detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0047] Figure 1 This is a flow chart of the nucleic acid amplification efficiency optimization control method of the present invention;

[0048] Figure 2 This is a schematic diagram of the structure of the nucleic acid quantitative detection system of the present invention;

[0049] Figure 3 The results of the nucleic acid denaturation temperature conditions in Example 1 are determined;

[0050] Figure 4 The results of determining the nucleic acid annealing extension temperature conditions in Example 1;

[0051] Figure 5 The method for dynamically setting the thermal cycle temperature in Example 1;

[0052] Figure 6 The fluorescence change state of the nucleic acid amplification process in Example 1 is shown in FIG.

[0053] Figure 7 is the fluorescence change curve state result actually obtained in Example 1;

[0054] Figure 8 is the envelope of the fluorescence amplification curve corresponding to each micro-unit of the digital PCR in Example 1;

[0055] Fig. 9 The optimized results of the Ct value difference distribution obtained by amplifying and testing samples of the same concentration using the schemes of Example 1 (A) and Comparative Example 1 (B) are shown. DETAILED DESCRIPTION

[0056] like Figure 1 The flowchart shown in the figure, a nucleic acid amplification efficiency optimization control method described in the following embodiment of the present invention includes the steps of preliminary experiment and optimization experiment; wherein,

[0057] The preliminary experiment includes:

[0058] (a1) conducting a preliminary experiment to determine the temperature condition for nucleic acid denaturation: preparing a nucleic acid amplification mixture, performing a first nucleic acid amplification by real-time fluorescence quantitative PCR, and obtaining a first melting curve after a first melting, obtaining a normalized fluorescence curve and a second-order derivative result of the melting process by analysis, and recording characteristic temperature points T1 and T2 of the derivative curve; wherein T1 is the temperature corresponding to the lowest point of the second-order derivative curve, and T2 is the temperature corresponding to the highest point of the second-order derivative curve;

[0059] (a2) conducting a preliminary experiment to determine the nucleic acid annealing extension temperature conditions: preparing a primer reaction mixture, performing a second nucleic acid amplification by real-time fluorescence quantitative PCR, and obtaining a second melting curve after a second melting, obtaining a primer melting fluorescence intensity change curve and a second derivative result by analysis, and recording characteristic temperatures T3 and T4 of the derivative curve; wherein T3 is the temperature corresponding to the lowest point of the second derivative curve, and T4 is the temperature corresponding to the highest point of the second derivative;

[0060] The optimization experimental steps include:

[0061] (b1) dynamically adjusting the target fluorescence quantitative PCR conditions according to the temperatures T1, T2, T3 and T4 determined in the preliminary experimental step, continuously collecting the fluorescence value changes of the target fluorescence channel of the reaction system, and obtaining the fluorescence continuous change curve of the nucleic acid amplification reaction process; and obtaining the fluorescence steady-state value of each nucleic acid annealing extension stage in the nucleic acid amplification;

[0062] (b2) drawing and fitting a fluorescence envelope growth curve according to the fluorescence steady-state value of each nucleic acid annealing and extension stage, and drawing continuous change curves of multiple samples;

[0063] (b3) Calculate the number and concentration of target nucleic acid molecules contained in each sample in different application scenarios.

[0064] In some specific embodiments, in step (a1), the nucleic acid amplification mixture includes a target nucleic acid template, a primer, a polymerase, and a premix;

[0065] Preferably, the premix includes a reaction buffer, a fluorescent dye and / or deionized water;

[0066] Preferably, the number n of thermal cycles of the first nucleic acid amplification is 30-50 cycles;

[0067] Preferably, the temperature of the first melting step is set to: increase from 60°C to 95°C.

[0068] In some specific embodiments, in step (a2), the primer reaction mixture includes primers, primer complementary chains, polymerase, and premixed solution;

[0069] Preferably, the premix includes a reaction buffer, a fluorescent dye and / or deionized water;

[0070] Preferably, the temperature of the second melting step is set as: the temperature is increased from 40°C to 80°C.

[0071] In some specific embodiments, in the step (b1), in the dynamic adjustment step, a single thermal cycle of the fluorescent quantitative PCR is divided into the following stages:

[0072] High temperature denaturation stage S1, setting the temperature to the temperature T2, and setting the pre-denaturation time t1 and the cycle stage denaturation time t3;

[0073] In the cooling stage S2, the temperature change rate v1 is set until the temperature drops to the temperature T3;

[0074] Nucleic acid annealing and extension stage S3, setting the temperature change rate v2 until the temperature rises to the temperature T4, and the time consumed in this stage is t2;

[0075] Rapid heating stage S4, setting the temperature change rate v3 until the temperature rises to the temperature T2;

[0076] Preferably, a constant temperature stage S5 is further included between S3 and S4, and the set temperature is maintained at T4, and the fluorescence intensity of the amplification reaction will continue to increase until the fluorescence intensity of all target fluorescence channels reaches a steady state (CV≤5%), and the time consumed is t4;

[0077] Preferably, the number n of thermal cycles of the fluorescent quantitative PCR is 40, constituting the nucleic acid variable temperature amplification reaction process.

[0078] In some specific embodiments, in the nucleic acid annealing extension stage S3, within the basic time t2, if the fluorescence intensity in all target fluorescence channels has reached a stable state (based on the fluorescence change CV value, such as CV≤5%), the annealing extension stage ends and there is no need to add the S5 stage; if the fluorescence intensity of all target fluorescence channels cannot be stabilized within the basic time t2, the constant temperature stage S5 is executed, in which the temperature is maintained at T4, and the fluorescence intensity continues to increase until the fluorescence intensity of all target fluorescence channels reaches a steady state (CV≤5%), and the additional time consumed is t4. At this time, the time consumed in the entire nucleic acid annealing extension stage t2 is calculated. ’ =t2+t4.

[0079] In some specific embodiments, in the S1 stage, the pre-denaturation time t1 and / or the cycle stage denaturation time t3 are independently 1-120 s, which are determined according to different reaction systems; and / or,

[0080] In some specific embodiments, in the S2 stage, the temperature change rate v1 is 1-10°C / s, which is determined according to different reaction systems; and / or,

[0081] In some specific embodiments, in the S3 stage, the temperature change rate v2 is 0.1-5°C / s, which is determined according to different reaction systems; and / or,

[0082] In some specific embodiments, in the S4 stage, the temperature change rate v3 is 1-10°C / s, which is determined according to different reaction systems.

[0083] In some specific embodiments, in the S3 stage, while performing temperature thermal cycling, the fluorescence value changes of the target fluorescence channel of the reaction system and the fluorescence steady-state value of each nucleic acid annealing and extension stage are continuously collected.

[0084] In some specific embodiments, in the step (b2), the fluorescence envelope growth curve includes fitting using a sigmoid growth curve, a cubic function, or a quartic function curve.

[0085] In some specific embodiments, in step (b3), the application scenario includes real-time fluorescence quantitative PCR or real-time digital PCR; wherein,

[0086] In the real-time fluorescence quantitative PCR, according to the ΔCt method or 2 (-ΔΔCT) Methods The relative expression of nucleic acid in each sample was calculated;

[0087] In the real-time digital PCR, each amplification curve C is calculated. t Value, preset threshold C th t , such as C t >C th t , then the micro-reaction unit determines micro-negative; if C t <C th t , then the micro-reaction unit is judged as positive, and the nucleic acid quantitative copy number concentration C is calculated according to the following digital PCR quantitative formula:

[0088]

[0089] Among them, N neg -Number of negative microunits; N T -Total number of microcells; V m -Microcell volume.

[0090] In order to better implement the above-mentioned nucleic acid amplification efficiency optimization control method, the present invention exemplarily provides a nucleic acid quantitative detection system for implementing the nucleic acid amplification efficiency optimization control method. Figure 2 The results shown include a detection device and a control system; wherein the control system operates according to the nucleic acid amplification efficiency optimization control method.

[0091] Specifically, as attached Figure 2 The structure of the device shown in the figure, the detection device of the detection system includes a fluorescent component and a reaction component; wherein,

[0092] The fluorescence component includes a fluorescence detection CMOS camera 1, an LED excitation light source 2 and a filter lens group 3;

[0093] The reaction assembly includes a temperature control console 5, a temperature control heat sink 6, and a target reaction area 4 for performing a fluorescent quantitative PCR reaction.

[0094] The present invention is further described in the following embodiments. Figure 2 The nucleic acid quantitative detection system of the structure shown is used to optimize the control of nucleic acid amplification efficiency.

[0095] Example 1

[0096] In order to improve the efficiency and optimize the consistency of nucleic acid amplification during PCR, this embodiment adopts the following preliminary experiment and optimization experiment operations.

[0097] Determination of nucleic acid denaturation temperature conditions

[0098] Prepare the nucleic acid amplification mixture as follows: 1 μl PD-L1 plasmid, 0.4 μl primer probe (10 μM), 0.2 Taq ProHS DNA polymerase, 1 μL BSA (20 mg ml -1 ), 2 μL 5× Taq Pro Buffer, 0.5 μL 20× EvaGreen and 4.9 μL water, the total volume was 10 μL.

[0099] Wherein, the sequence structure of the PD-L1 plasmid, i.e., the primer probe, is as follows:

[0100] PD-L1 Plasmid:

[0101] GTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCACTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATCCAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACG;

[0102] Primer probe:

[0103] F: GTAATTCTGGGAGCCATCTTAT;

[0104] R: CGTCTCCTCCAAATGTGTATC.

[0105] A preliminary experiment was conducted, and the prepared nucleic acid amplification mixture was used to perform 40 thermal cycles of nucleic acid amplification on a real-time fluorescence quantitative PCR device. The specific procedure included: pre-denaturation at 95°C for 1 min, PCR cycle stage at 95°C for 15 s, 60°C for 30 s, for a total of 40 cycles.

[0106] After the experimental samples were subjected to fluorescence quantitative PCR, a 60-95°C melting experiment was performed to obtain a melting curve (heating from 60°C to 95°C, with a step length of 0.1°C). The melting curve was further analyzed to obtain a normalized fluorescence curve and a second-order derivative result of the melting process, as shown in the attached figure. Figure 3 The characteristic temperature points T1=79.7°C and T2=84°C of the derivative curve are recorded, where T1 is the temperature corresponding to the lowest point of the second-order derivative curve, and T2 is the temperature corresponding to the highest point of the second-order derivative curve.

[0107] Determination of nucleic acid annealing extension temperature conditions

[0108] Prepare the primer reaction mixture as follows: 0.4 μl primer (10 μM), 0.4 μl primer complementary strand (10 μM), 0.2 TaqPro HS DNA polymerase, 1 μl BSA (20 mg ml -1 ), 2 μL 5× Taq Pro Buffer, 0.5 μL 20× EvaGreen and 4.9 μL water, the total volume was 10 μL.

[0109] Wherein, the sequence information of the primer and the primer complementary chain is as follows:

[0110] Primers:

[0111] F: GTAATTCTGGGAGCCATCTTAT;

[0112] R: CGTCTCCTCCAAATGTGTATC;

[0113] Primer complementary strand:

[0114] F:CATTAAGACCTCGGTAGAATA;

[0115] R:GCAGAGGAGGTTTACACATAG.

[0116] A preliminary experiment was conducted, and the prepared primer reaction mixture was used for nucleic acid amplification on real-time fluorescence quantitative PCR. The specific amplification procedure included: pre-denaturation at 95°C for 1 min, PCR cycle stage at 95°C for 15 s, 60°C for 30 s, for a total of 40 cycles.

[0117] After the experimental samples were subjected to fluorescence quantitative PCR, a 40-80°C melting experiment was performed to obtain a melting curve (heating from 40°C to 80°C, with a step length of 0.1°C). The melting curve was further analyzed to obtain the fluorescence intensity change curve of primer melting and the second-order derivative results. The results are shown in the attached Figure 4 The characteristic temperatures of the derivative curves are recorded as T3 = 58°C and T4 = 66°C, where T3 is the temperature corresponding to the lowest point of the second-order derivative curve, and T4 is the temperature corresponding to the highest point of the second-order derivative curve.

[0118] Determination of thermal cycling conditions for nucleic acid amplification

[0119] In this embodiment, a dynamic adjustment strategy for the thermal cycle conditions of nucleic acid amplification is performed based on the aforementioned determined temperature points T1, T2, T3, and T4. Figure 5 The following thermal cycle conditions were set as shown, and a single thermal cycle was divided into 4 or 5 stages:

[0120] S1 is the high temperature denaturation stage, the set temperature is the temperature T2 determined above, the pre-denaturation time t1 = 60 s and the cycle stage denaturation time t3 = 15 s;

[0121] S2 is the cooling stage, and the temperature change speed v1 is set to 4°C / s until the temperature drops to the temperature T3 determined above;

[0122] S3 is the nucleic acid annealing extension stage, and the set temperature change rate v2 = 1 ° C / s until the temperature rises to the aforementioned determined temperature T4, and the time consumed in this process is t2 = 10s; in this step, within the basic time t2 = 10s, if the fluorescence intensity in all target fluorescence channels has reached a stable state (such as the example value F in this embodiment), 1 1=4000a.u., and the fluorescence change CV value is used as the judgment basis, such as CV≤5%), the annealing extension stage ends. If the fluorescence intensity of all target fluorescence channels cannot be stabilized within t2=10s (such as the example value F3=11000a.u. in this embodiment), the constant temperature stage S5 is dynamically executed, in which the temperature continues to be maintained at T4, and the fluorescence intensity continues to increase to F 40 1 = 11800 a.u., until the fluorescence intensity of all target fluorescence channels reaches a steady state (CV ≤ 5%), the additional time consumed is t4 = 10s, at which time the nucleic acid annealing extension phase consumes time t2 ’ =t2+t4=20s;

[0123] S4 is a rapid heating stage, and the temperature change rate v3 is set to 5°C / s until the temperature reaches the aforementioned set temperature T2;

[0124] 40 consecutive thermal cycles constitute the nucleic acid variable temperature amplification reaction process.

[0125] In this embodiment, while performing the temperature thermal cycle, the fluorescence value change of the target fluorescence channel (one or more) of the reaction system is continuously collected, and the fluorescence intensity change is as follows: Figure 6 As shown in the figure, the actual fluorescence continuous change curve of the nucleic acid amplification reaction process is as follows Figure 7 shown.

[0126] In this embodiment, according to the steady-state fluorescence value of each nucleic acid annealing extension stage, the fluorescence envelope growth curve is drawn and fitted, and the continuous change curves of multiple samples are drawn as shown in FIG. Figure 8 shown.

[0127] In this embodiment, the number and concentration of target nucleic acid molecules contained in each sample in different application scenarios are further calculated. Among them, the application scenario selected in this embodiment is real-time digital PCR: Figure 8 is the fluorescence amplification curve envelope corresponding to each micro-unit of digital PCR. Each curve represents a micro-reaction unit. Calculate each amplification curve C t Value, preset threshold C th t , such as C t >C th t , the micro-reaction unit determines the micro-negative; such as C t <C th t , the micro-reaction unit is judged as positive. In this embodiment, the quantitative copy number concentration C of nucleic acid is calculated according to the digital PCR quantitative formula:

[0128]

[0129] N neg -Number of negative microunits; N T - Total number of microcells; V m -Microcell volume.

[0130] This example is based on the digital PCR method, and the calculated copy number concentration is 107 copies / μl.

[0131] Comparative Example 1

[0132] The fluorescence quantitative PCR method described in this comparative example is the same as that in Example 1, the only difference is that nucleic acid amplification is performed directly without optimization control. The specific amplification procedure includes: pre-denaturation at 95°C for 1 min, PCR cycle stage plateau temperature and time at 95°C for 15 s, 60°C for 30 s, and a total of 40 cycles.

[0133] Fig. 9 The results show the optimization results of the difference distribution of Ct values ​​obtained by amplifying and testing samples of the same concentration under the operation schemes of Example 1 and Comparative Example 1. The specific test operation method is the same as that of Example 1.

[0134] It can be seen that the method in Example 1 ( Fig. 9 After A), compared with the method in Comparative Example 1 ( Fig. 9 In Figure B), the amplification Ct values ​​of each microunit in digital PCR are more concentrated, indicating better consistency and efficiency of nucleic acid amplification, which is conducive to reducing difficult-to-classify data in digital nucleic acid analysis and obtaining more accurate quantitative nucleic acid concentration.

[0135] In summary, the nucleic acid amplification efficiency optimization control method described in the present invention optimizes the nucleic acid amplification efficiency by combining control methods such as temperature and real-time fluorescence regulation. The real-time state of the nucleic acid amplification reaction is monitored and the temperature conditions of the nucleic acid amplification reaction are dynamically and adaptively adjusted to achieve the purpose of improving the nucleic acid amplification efficiency and optimizing the repeatability of quantitative detection. This not only improves the nucleic acid amplification efficiency and optimizes the consistency of amplification, but also more effectively improves the repeatability of nucleic acid quantitative detection.

[0136] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A method for optimizing and controlling nucleic acid amplification efficiency, characterized in that: It includes the steps of preliminary experiment and optimization experiment; among them, The preliminary experiment includes: (a1) conducting a preliminary experiment to determine the temperature condition for nucleic acid denaturation: preparing a nucleic acid amplification mixture, performing a first nucleic acid amplification by real-time fluorescence quantitative PCR, and obtaining a first melting curve after a first melting, obtaining a normalized fluorescence curve and a second-order derivative result of the melting process by analysis, and recording characteristic temperature points T1 and T2 of the derivative curve; wherein T1 is the temperature corresponding to the lowest point of the second-order derivative curve, and T2 is the temperature corresponding to the highest point of the second-order derivative curve; (a2) conducting a preliminary experiment to determine the nucleic acid annealing extension temperature conditions: preparing a primer reaction mixture, performing a second nucleic acid amplification by real-time fluorescence quantitative PCR, and obtaining a second melting curve after a second melting, obtaining a primer melting fluorescence intensity change curve and a second derivative result by analysis, and recording characteristic temperatures T3 and T4 of the derivative curve; wherein T3 is the temperature corresponding to the lowest point of the second derivative curve, and T4 is the temperature corresponding to the highest point of the second derivative; The optimization experimental steps include: (b1) dynamically adjusting the target fluorescence quantitative PCR conditions according to the temperatures T1, T2, T3 and T4 determined in the preliminary experimental step, continuously collecting the fluorescence value changes of the target fluorescence channel of the reaction system, and obtaining the fluorescence continuous change curve of the nucleic acid amplification reaction process; and obtaining the fluorescence steady-state value of each nucleic acid annealing extension stage in the nucleic acid amplification; (b2) drawing and fitting a fluorescence envelope growth curve according to the fluorescence steady-state value of each nucleic acid annealing and extension stage, and drawing continuous change curves of multiple samples; (b3) Calculate the number and concentration of target nucleic acid molecules contained in each sample in different application scenarios.

2. The nucleic acid amplification efficiency optimization control method according to claim 1, characterized in that: In the step (a1), the nucleic acid amplification mixture includes a target nucleic acid template, a primer probe, a polymerase, and a premix; Preferably, the premix includes a reaction buffer, a fluorescent dye and / or deionized water; Preferably, the number n of thermal cycles of the first nucleic acid amplification is 30-50 cycles; Preferably, the temperature of the first melting step is set to: increase from 60°C to 95°C.

3. The nucleic acid amplification efficiency optimization control method according to claim 1 or 2, characterized in that: In the step (a2), the primer reaction mixture includes primers, primer complementary chains, polymerase, and premixed solution; Preferably, the premix includes a reaction buffer, a fluorescent dye and / or deionized water; Preferably, the temperature of the second melting step is set as: the temperature is increased from 40°C to 80°C.

4. The method for optimizing nucleic acid amplification efficiency according to any one of claims 1 to 3, characterized in that: In the step (b1), in the dynamic adjustment step, a single thermal cycle of the fluorescent quantitative PCR is divided into the following stages: High temperature denaturation stage S1, setting the temperature to the temperature T2, and setting the pre-denaturation time t1 and the cycle stage denaturation time t3; In the cooling stage S2, the temperature change rate v1 is set until the temperature drops to the temperature T3; Nucleic acid annealing and extension stage S3, setting the temperature change rate v2 until the temperature rises to the temperature T4, and the time consumed in this stage is t2; Rapid heating stage S4, setting the temperature change rate v3 until the temperature rises to the temperature T2; Preferably, a constant temperature stage S5 is further included between S3 and S4, and the set temperature is maintained at T4, and the fluorescence intensity of the amplification reaction will continue to increase until the fluorescence intensity of all target fluorescence channels reaches a steady state, which takes time t4; Preferably, the number n of thermal cycles of the fluorescent quantitative PCR is 40, constituting the nucleic acid variable temperature amplification reaction process.

5. The method for optimizing nucleic acid amplification efficiency according to claim 4, characterized in that: In the S1 stage, the pre-denaturation time t1 and / or the cycle stage denaturation time t3 are independently 1-120s; and / or, In the S2 stage, the temperature change rate v1 is 1-10°C / s; and / or, In the S3 stage, the temperature change rate v2 is 0.1-5°C / s; and / or, In the S4 stage, the temperature change rate v3 is 1-10°C / s.

6. The method for optimizing nucleic acid amplification efficiency according to claim 4 or 5, characterized in that: In the S3 stage, while performing temperature thermal cycling, the fluorescence value changes of the target fluorescence channel of the reaction system and the fluorescence steady-state value of each nucleic acid annealing and extension stage are continuously collected.

7. The method for optimizing and controlling nucleic acid amplification efficiency according to any one of claims 4 to 6, characterized in that: In the step (b2), the fluorescence envelope growth curve includes fitting using a sigmoid growth curve, a cubic function curve or a quartic function curve.

8. The method for optimizing and controlling nucleic acid amplification efficiency according to any one of claims 4 to 7, characterized in that: In the step (b3), the application scenario includes real-time fluorescence quantitative PCR or real-time digital PCR; wherein, In the real-time fluorescence quantitative PCR, according to the ΔCt method or 2 (-ΔΔCT) Methods The relative expression of nucleic acids in each sample was calculated; In the real-time digital PCR, each amplification curve C is calculated. t Value, preset threshold C th t , such as C t >C th t , then the micro-reaction unit determines micro-negative; if C t <C th t , then the micro-reaction unit is judged as positive, and the nucleic acid quantitative copy number concentration C is calculated according to the following digital PCR quantitative formula: Among them, N neg -Number of negative microunits; N T -Total number of microcells; V m -Microcell volume.

9. Application of the nucleic acid amplification efficiency optimization control method according to any one of claims 1 to 8 in the field of genetic engineering.

10. A nucleic acid quantitative detection system for implementing the nucleic acid amplification efficiency optimization control method according to any one of claims 1 to 8, characterized in that: It comprises a detection device and a control system; wherein the control system operates according to the nucleic acid amplification efficiency optimization control method according to any one of claims 1-8.

Images