Primer combination for screening long mesocotyl rice by using KASP molecular marker and application of primer combination

Abstract

The invention discloses a primer combination for screening long mesocotyl rice by using a KASP molecular marker and application of the primer combination, the primer combination is composed of two upstream primers and a downstream primer, the nucleotide sequences of the upstream primers are as shown in SEQ ID No.1-2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.3. The primer combination can be used for detecting the base type at the 578bp from the upstream promoter sequence ATG of the rice polyamine oxidase gene OsPAO5 gene, and when the base type is the homozygous type of G, the rice is long mesocotyl rice / high emergence rate rice. A theoretical basis is laid for breeding high-quality rice varieties, and a molecular assisted selection means is provided.

Description

Technical Field

[0001] The invention relates to a primer combination for screening long mesocotyl rice by utilizing KASP molecular markers and application thereof, and belongs to the field of molecular genetic breeding. Background Art

[0002] Rice is one of the most important food crops in my country. More than 60% of the population in my country relies on rice as their staple food. However, my country is currently facing problems such as an aging population and a lack of agricultural labor. Direct seeding of rice can save a lot of manpower and solve the problem of labor shortage. However, the current direct seeding of rice has problems such as poor germination, difficulty in full seedling, and uneven emergence. Therefore, improving the germination and emergence rate of direct seeding rice has become an imminent problem.

[0003] The embryonic axis of rice is mainly divided into three parts: hypocotyl, mesocotyl and epicotyl. The mesocotyl is crucial for the seed to break through the soil and germinate. The mesocotyl refers to the part between the coleoptile node and the radicle attachment point. Generally, varieties with long mesocotyls have the advantages of high germination rate and fast emergence speed under deep soil covering conditions.

[0004] Therefore, developing a KASP marker for early identification of rice with longer mesocotyl length can lay a theoretical foundation for breeding high-quality rice varieties and provide a molecular-assisted selection method. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a primer combination for screening long mesocotyl rice using KASP molecular markers and its application.

[0006] Technical solution: The present invention provides a primer combination for screening long mesocotyl rice using KASP molecular markers, wherein the primer combination consists of two upstream primers and one downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID No.1-2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.3.

[0007] The 5' end of the upstream primer also includes a fluorescent label.

[0008] The fluorescent label includes FAM or HEX.

[0009] The present invention also provides a kit for screening long mesocotyl rice, and the kit comprises the above primer combination.

[0010] The kit further includes FLU-ARMS for KASP 2X PCR mix 2xKASP MIX and ddH2O.

[0011] The present invention also provides the use of the primer combination and the kit in screening long mesocotyl rice / high seedling emergence rate rice.

[0012] The present invention also provides a method for screening long mesocotyl rice / high seedling emergence rate rice, using the genomic DNA of the rice variety to be tested as a template, using the above-mentioned primer combination or kit to perform PCR amplification, when the base at the 578bp starting from the upstream promoter sequence ATG of the OsPAO5 gene in the amplified product is a homozygous G, it represents that the rice is long mesocotyl rice / high seedling emergence rate rice.

[0013] The PCR amplification program is as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, gradient annealing / extension at 61-55°C for 1 min, decreasing 0.6°C in each cycle, 10 cycles; denaturation at 95°C for 15 s, annealing / extension at 55°C for 1 min, 32 cycles.

[0014] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: the primer combination of the present invention can be used to detect the base type at the 578 bp starting from the upstream promoter sequence ATG of the rice polyamine oxidase gene OsPAO5 gene. When it is homozygous for G, it represents that the rice is long mesocotyl rice / high seedling emergence rate rice. It lays a theoretical foundation for breeding high-quality rice varieties and provides a molecular assisted selection method. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 OsPAO5-KASP marker typing results for 107 rice varieties in Jiangsu Province.

[0016] Figure 2 Comparison of mesocotyl length and emergence rate of 107 rice varieties in Jiangsu Province; * indicates that the T test reached a significant level, i.e., P≤0.05, and ** indicates that the T test reached an extremely significant level, i.e., P≤0.01.

[0017] Figure 3 Seven varieties including Nanjing 58 were selected in OsPAO5 -578G / A Sequencing results. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0019] Case study 1: Development of SNP molecular markers related to mesocotyl length in rice

[0020] The SNP in the upstream promoter region of the gene OsPAO5, which regulates the length of rice mesocotyls, was detected. -578G / A ) mutation to develop KASP markers, the designed primer set consists of two upstream primers OsPAO5-FAM-F and OsPAO5-HEX-F and one downstream primer OsPAO5-R. The primers were synthesized by Nanjing Qingke Biological Company.

[0021] The sequence of OsPAO5-FAM-F is 5'-GGACCACATGGACAGGTGCC-3' (SEQ ID No. 1), and its 5' end also includes a FAM fluorescent tag sequence ( GAAGGTGACCAAGTTCATGCT ).

[0022] The sequence of OsPAO5-HEX-F is 5'-GGACCACATGGACAGGTGCT-3' (SEQ ID No. 2), and its 5' end also includes a HEX fluorescent tag sequence ( GAAGGTCGGAGTCAACGGATT ).

[0023] The sequence of OsPAO5-R is 5'-GATGATGCGGTGGATTGGC-3' (SEQ ID No. 3).

[0024] Implementation Case 2: Detection Method of KASP Marker

[0025] A total of 107 rice varieties were randomly selected from high-yield varieties in Jiangsu Province as experimental materials for KASP detection and statistics of mesocotyl length and seedling emergence rate.

[0026] 1. Statistics of mesocotyl length and emergence rate

[0027] In the present invention, 107 rice varieties to be tested that are harvested at maturity are placed in a 37° C. oven to dry the internal moisture of the seeds.

[0028] Mix soil: Mix nutrient soil and vermiculite in a ratio of 3:1.

[0029] Sowing: Sow the dried seeds in the soil at a depth of 5 cm, 10 seeds per line, and repeat 5 times.

[0030] Growth environment: Culture in a dark incubator at 28°C and 80% humidity for 10 days, spraying an appropriate amount of water regularly every day until germination.

[0031] Mesocotyl length statistics: Use a ruler to measure the mesocotyl length of the tested variety on the 10th day after sowing.

[0032] Seedling emergence rate statistics: Statistics on the direct seeding emergence rate of different varieties on the 10th day after sowing.

[0033] 2. Extraction of template DNA

[0034] On the 10th day after sowing, leaves of 107 rice materials to be tested were sampled, and genomic DNA of young leaves was extracted using the CTAB method. Real-time fluorescence quantitative PCR was performed using the primer set synthesized in Example 1, and the instrument model was ABI ViiA7 real-time fluorescence quantitative instrument.

[0035] 3. KASP marker detection

[0036] (1) Preparation of primer working solution

[0037] The three synthesized primer powders were diluted to 100 mM with ddH2O, and then prepared into working solutions according to the following formula: OsPAO5-FAM-F 12 μL, OsPAO5-HEX-F 12 μL, OsPAO5-R 30 μL, ddH2O 46 μL.

[0038] (2) Preparation of KASP reaction system

[0039] Template DNA 2.85 μL, KASP primer set working solution 0.15 μL, FLU-ARMS for KASP 2X PCRmix 5 μL (Guangzhou Good Biotechnology Co., Ltd.), ddH2O 2 μL.

[0040] (3) KASP reaction procedure

[0041] ABI ViiA7 real-time fluorescence quantification instrument operation sequence: 1. Open QuantStudio6&7 software. 2. In the "setup settings" box, click "experiment settings" and create a new experiment. 3. In the installation menu, select ViiA 7System; 96-Well (0.2ml); Genotyping; Other; Standard. 4. Define the PCR plate and define the FAM fluorescent label as OsPAO5 -578G Genotype, HEX fluorescent tag defined as OsPAO5 -578A 5. Select the well plate position, define the unknown DNA sample as Unknown (U), and define the negative control as Negative Control (N). 6. Set the running program: 95℃ pre-denaturation for 10min; 95℃ denaturation for 15s, 61-55℃ gradient annealing / extension for 1min, decrease 0.6℃ for each cycle, 10 cycles; 95℃ denaturation for 15s, 55℃ annealing / extension for 1min, 32 cycles; 30℃, 1min plate reading.

[0042] (4) KASP results analysis

[0043] After the data are exported, the specific judgment principle is as follows: if the rice variety to be tested shows a red fluorescent signal at the OsPAO5 locus, then the rice variety to be tested is OsPAO5 at the OsPAO5 locus. -578A Homozygous genotype; if the rice variety to be tested shows a blue fluorescent signal at the OsPAO5 locus, then the rice variety to be tested is OsPAO5 at the OsPAO5 locus -578GHomozygous genotype; if the rice variety to be tested shows a green fluorescence signal at the OsPAO5 locus, then the rice variety to be tested is OsPAO5 at the OsPAO5 locus -578AG Heterozygous genotype. According to the above determination method, the genotypes of 107 Jiangsu rice varieties were obtained. The results are shown in Table 1 and Figure 1 shown.

[0044] Table 1. OsPAO5-KASP detection results and mesocotyl length statistics of 107 varieties in Jiangsu Province

[0045]

[0046]

[0047]

[0048] The association analysis was conducted on genotype (homozygous type) and mesocotyl length and emergence rate. The results are shown in Table 2, Table 3 and Figure 2 shown.

[0049] Table 2 Comparison of mesocotyl length in 107 varieties in Jiangsu Province using OsPAO5-KASP marker

[0050]

[0051] Table 3 Comparison of seedling emergence rates of 107 varieties marked with OsPAO5-KASP in Jiangsu Province

[0052]

[0053] The results in Table 2 show that OsPAO5 -578G Homozygous rice varieties are more likely to be infected with OsPAO5 -578A The average mesocotyl length of homozygous rice varieties increased by 64.73%, which was a significant difference.

[0054] The results in Table 3 show that OsPAO5 -578G Homozygous rice varieties are more likely to be infected with OsPAO5 -578A The average direct seeding rate of homozygous rice varieties increased by 15.94%, which was a very significant difference.

[0055] Implementation case 3: Seven varieties including Nanjing 58 were tested in OsPAO5 -578G / A Sequencing analysis

[0056] DNA from Nanjing 58, Huaidao 5, Huzaojing 193, Suxiu 8608, Rundao 118, Lianjing 10 and Lianjing 11 was extracted and amplified using PAO5-CEXU-F (sequence as shown in SEQ ID NO.4) and PAO5-CEXU-R (sequence as shown in SEQ ID NO.5). The amplified fragments were sent to Nanjing Qingke Biological Company for sequencing. -578A / G The bases were analyzed and verified, and the sequencing results were as follows Figure 3 As shown, the results are consistent with Table 1, proving that the detection results of the primer combination of the present invention are accurate.

Claims

1. A primer combination for screening long mesocotyl rice using KASP molecular markers, characterized in that: The primer combination consists of two upstream primers and one downstream primer. The nucleotide sequences of the upstream primers are shown in SEQ ID No.1-2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

3.

2. The primer combination for screening long mesocotyl rice using KASP molecular markers according to claim 1, characterized in that: The 5' end of the upstream primer also includes a fluorescent label.

3. The primer combination for screening long mesocotyl rice using KASP molecular markers according to claim 1, characterized in that: The fluorescent label includes FAM or HEX.

4. A kit for screening long mesocotyl rice, characterized in that: The kit comprises the primer combination according to any one of claims 1 to 3.

5. The kit for screening long mesocotyl rice according to claim 4, characterized in that: The kit further includes FLU-ARMS for KASP 2X PCR mix 2xKASP MIX and ddH2O.

6. Use of the primer combination according to any one of claims 1 to 3 and the kit according to any one of claims 4 to 5 in screening long mesocotyl rice / high seedling emergence rate rice.

7. A method for screening long mesocotyl rice / high seedling emergence rate rice, characterized in that: Using the genomic DNA of the rice variety to be tested as a template, PCR amplification is performed using the primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 4 to 5. When the base at the 578bp starting from the upstream promoter sequence ATG of the OsPAO5 gene in the amplified product is a homozygous G, it represents that the rice is long mesocotyl rice / high seedling emergence rate rice.

8. The method for screening long mesocotyl rice / high seedling emergence rate rice according to claim 7, characterized in that: The PCR amplification program is as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, gradient annealing / extension at 61-55°C for 1 min, decreasing 0.6°C in each cycle, 10 cycles; denaturation at 95°C for 15 s, annealing / extension at 55°C for 1 min, 32 cycles.

Images