Method for rapidly detecting porcine pseudorabies virus by RAA-LFD

Abstract

The invention belongs to the field of virus detection, and relates to a method for rapidly detecting porcine pseudorabies virus by RAA-LFD. The biological composition or the kit is provided, a sample to be detected reacts with the RAA primer group and the probe in an RAA-LFD reaction system, and the detection test strip is adopted to detect the reacted liquid. The RAA primer group is selected from any one of the following primer groups: a primer group of which the nucleotide sequences are respectively shown as SEQ ID NO.3 and SEQ ID NO.4, a primer group of which the nucleotide sequences are respectively shown as SEQ ID NO.5 and SEQ ID NO.6, or a primer group of which the nucleotide sequences are respectively shown as SEQ ID NO.15 and SEQ ID NO.16. Through combination of RAA and LFD, the kit can realize portability, sensitivity and high specificity, is suitable for on-site rapid detection of PRV, and provides technical support for prevention and control of PRV.

Description

Technical Field

[0001] The invention belongs to the field of virus detection and relates to a method for quickly detecting porcine pseudorabies virus by using RAA-LFD. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Pseudorabies (PR) is a highly contagious disease caused by pseudorabies virus (PRV) with neurological and respiratory symptoms as the main symptoms, which endangers the global pig industry. Pseudorabies is listed as a Class B multi-animal disease with legal notification by the World Organization for Animal Health, and it is very easy to infect a variety of livestock and wild animals. Due to the serious epidemic trend of pseudorabies in pigs, most nucleic acid detection methods mainly include PCR and qPCR, but they all have the disadvantages of requiring expensive equipment, professional operators, and long reaction time, making it difficult to popularize them in grassroots testing departments and farms. In view of the current prevalence of PRV, there is an urgent need for a method that can be portable, sensitive, highly specific, and suitable for on-site detection to quickly diagnose the disease and control its prevalence. Summary of the invention

[0004] In order to address the deficiencies of the prior art, the purpose of the present invention is to provide a method for rapid detection of porcine pseudorabies virus by RAA-LFD. By combining recombinase-mediated isothermal amplification technology (recombinase-acid amplification, RAA) with lateral flow chromatography technology (LFD), it is possible to achieve rapid detection of PRV that is portable, sensitive, highly specific, and suitable for on-site use, thereby providing technical support for the prevention and control of PRV disease.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] In a first aspect, a biological composition comprises a RAA primer set, wherein the RAA primer set is selected from any one of the following primer sets:

[0007] The primer set having nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4, the primer set having nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6, or the primer set having nucleotide sequences as shown in SEQ ID NO.15 and SEQ ID NO.16.

[0008] The RAA primer set of the present invention is used for RAA amplification of PRV. The present invention uses the gE conservative gene fragment and designs multiple pairs of RAA primer sets according to the RAA primer design principle. Experimental studies have shown that the use of the above three primer sets can avoid nonspecific amplification.

[0009] Further research in the present invention shows that, compared with the other two pairs of primer sets, the primer sets with nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4 respectively have better amplification effect when performing RAA amplification on PRV.

[0010] RAA uses recombinase, single-strand binding protein and DNA polymerase to replace the thermal cycle melting process of traditional PCR. Under the constant temperature of 35-42°C, it searches for homologous DNA sequences in the genomic template, completes chain displacement in 10-30 minutes to achieve rapid nucleic acid amplification, and combines with LFD to achieve rapid on-site visual detection of nucleic acid amplification products. In order to realize the combined detection of RAA and LFD, in some embodiments, the biological composition also includes a probe, and the nucleotide sequence of the probe is shown in SEQ ID NO.17.

[0011] In one or more embodiments, the 5' end of the probe is labeled with 6-fluorochrome (6-FAM), the 31 position is modified by tetrahydrofuran (THF) substitution, and the 3' end is phosphorylated using Spacer C3.

[0012] In one or more embodiments, one primer of the primer set is labeled with biotin. Specifically, the 5' end of the primer is labeled with biotin. More specifically, the 5' end of the forward primer is labeled with biotin.

[0013] In a second aspect, a RAA-LFD kit for detecting porcine pseudorabies virus comprises the above biological composition.

[0014] In some embodiments, a RAA-LFD reaction system is further included, wherein the RAA-LFD reaction system includes a RAA reaction system.

[0015] In some embodiments, a test strip is also included. Specifically, the test strip uses lateral flow chromatography to detect the amplification product. When the test strip detects the reaction product, a red band appears at the detection line, or a blue band appears at both the detection line and the quality control line, indicating that pseudorabies virus is present in the sample to be tested.

[0016] In a third aspect, a method for rapid detection of porcine pseudorabies virus by RAA-LFD is provided, the above-mentioned biological composition or kit is provided, a sample to be tested is reacted with a RAA primer set and a probe in a RAA-LFD reaction system, and a test strip is used to detect the liquid after the reaction.

[0017] In some embodiments, the reaction temperature is 35-42° C., and the reaction time is 20-30 min.

[0018] In some embodiments, the reaction liquid is diluted and then detected using a test strip.

[0019] The beneficial effects of the present invention are:

[0020] The present invention designs a primer set for RAA amplification of porcine pseudorabies virus. Experiments show that the primer set can specifically amplify porcine pseudorabies virus. At the same time, RAA-LFD detection of porcine pseudorabies virus can be achieved by designing a probe and a primer set, as well as a test strip. The method can be a rapid, portable and sensitive nucleic acid detection method, and can achieve visual detection results in 30 minutes, with a minimum detection limit as low as 10 2 copies / μL, which is suitable for on-site visual detection of pseudorabies virus in pigs and has important guiding significance for the prevention and control of pseudorabies in pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0022] Figure 1 Schematic diagram of the RAA-LFD detection system in an embodiment of the present invention.

[0023] Figure 2 This is a diagram showing the PCR identification results of the recombinant plasmid standard product pMD18-T-PRV-gE in Example 1 of the present invention.

[0024] Figure 3 This is a diagram showing the RAA primer screening results in Example 2 of the present invention.

[0025] Figure 4 This is a result diagram of the RAA-LFD reaction system in Example 4 of the present invention.

[0026] Figure 5 This is a graph showing the specificity test results in Example 6 of the present invention.

[0027] Figure 6 This is a sensitivity test result diagram in Example 5 of the present invention.

[0028] Figure 7This is a graph showing the PCR test results of clinical samples in Example 7 of the present invention.

[0029] Figure 8 This is a diagram of the RAA-LFD determination results of clinical samples in Example 7 of the present invention. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0031] Unless otherwise specified, all reagents and consumables involved in the present invention are commercially available.

[0032] The materials and instruments involved in the following examples are as follows:

[0033] Main Materials:

[0034] Positive samples of pseudorabies virus (PRV-XD-F3), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV-2), classical swine fever virus (CSFV), and porcine parvovirus (PPV) were preserved by our laboratory; clinical samples came from the breeding farm of Shangri-La Pure Land Co., Ltd., and a total of 30 blood samples were collected.

[0035] RAA primers and probes were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0036] DNA constant temperature rapid amplification kit and DNA constant temperature rapid amplification kit (colloidal gold test strip type) were purchased from Anpu Future Biotechnology Co., Ltd.

[0037] The experimental techniques in the examples are all conventional methods and methods recommended by the reagent instructions.

[0038] Example 1: Construction of a positive plasmid for the full gene of pseudorabies virus gE.

[0039] Using PRV-XD-F3 strain DNA as a template, PCR amplification was performed using primers, and the product was cloned into pMD18-T to construct the recombinant plasmid PMD18-T-PRV-gE. The recombinant plasmid was prepared according to the Tiangen plasmid extraction kit and sequenced and identified by PCR sequencing by Sangon Biotech (Shanghai) Co., Ltd.

[0040] PCR amplification: DNA was used as a template for PCR amplification. The total system (25 mL) included 12.5 mL of 2×PCR Master Mix, 1 μL of each upstream and downstream specific primers, 2 μL of template, and 8.5 μL of sterile double distilled water to make up the reaction system.

[0041] PCR amplification specific primers are as follows:

[0042] 5′-GGTGTGGGTGGCGTTTTATCT-3′(SEQ ID NO.1)

[0043] 5′-TTTTGGTGGGCATGTCGGAATG-3′(SEQ ID NO.2)

[0044] The PCR amplification procedure is as follows.

[0045]

[0046] The results are as follows Figure 2 shown.

[0047] Example 2: RAA primer design and screening

[0048] Primer Premier 5.0 software was used to design and synthesize RAA primers. The seven pairs of RAA primers were named RAA-R / F1-7 using the gE conservative gene fragment and referring to the design principles of RAA primers. The nucleotide sequence information of each RAA primer is as follows:

[0049] RAA-R1: CGGAGATGGGCATCGGCGACTACCTG (SEQ ID NO.3)

[0050] PAA-F1: CCGGGCGAGAAGAGCTGCGAGTGGAA (SEQ ID NO.4)

[0051] RAA-R2: CGTGTTCTTTGTGGCGGTGGGC (SEQ ID NO.5)

[0052] RAA-F2: CGCGGGTGGTAGATGCAGGGCT (SEQ ID NO.6)

[0053] RAA-R3:GCCGAGTACGTCACGGTCATCA(SEQ ID NO.7)

[0054] RAA-F3: GGGAGCACAGCACGCAGAGCCA (SEQ ID NO.8)

[0055] RAA-R4: CCACGGAGACAGCGGCTACGAG (SEQ ID NO.9)

[0056] RAA-F4: CACGCCATAGTTGGGTCCATTCG (SEQ ID NO.10)

[0057] RAA-R5: AGTTCAGCAGCGACGAGGACGAC (SEQ ID NO.11)

[0058] RAA-F5: CACGCCATAGTTGGGTCCATTCG (SEQ ID NO.12)

[0059] RAA-R6: CCACGGAGACAGCGGCTACGAG (SEQ ID NO.13)

[0060] RAA-F6: CGCCATAGTTGGGTCCATTCGTC (SEQ ID NO.14)

[0061] RAA-R7:AGCGGAGACAGCGGCTACGAGGG (SEQ ID NO.15)

[0062] RAA-F7: TTTGGTGGGCATGTCGGAATGCG (SEQ ID NO.16)

[0063] RAA primer screening was performed using pMD18-T-PRV-gE standard positive plasmid as template and ddH 2 O was used as negative control to screen the best RAA primers. The 7 pairs of RAA primers designed were used to perform RAA reaction using a DNA constant temperature rapid amplification kit. The reaction system is as follows:

[0064]

[0065] An equal volume of nucleic acid extraction reagent (saturated phenol: chloroform: isoamyl alcohol = 25:24:1) was added to the amplified product, and the mixture was centrifuged. 7 μL of the supernatant was taken out for 1.5% agarose gel electrophoresis to screen the best RAA primer.

[0066] The results are as follows Figure 3 , 7 pairs of RAA primers were subjected to isothermal amplification, among which RAA-3R / 3F, RAA-4R / 4F, RAA-5R / 5F, and RAA-6R / 6F primers showed non-specific amplification and produced double bands, while RAA-1R / 2F, RAA-2R / 2F, and RAA-7R / 7F had good characteristics, but the RAA-1R / 1F primer band was the most obvious and had the best amplification effect, so RAA-1R / 1F primer was selected for subsequent experiments.

[0067] Example 3: RAA-LFD probe design

[0068] According to the optimal RAA primer screened in Example 2, Primer Premier 5.0 software was used to amplify the conservative region of the gene fragment using RAA, and the RAA-LFD probe series was designed with reference to the RAA probe design principle of the disposable nucleic acid detection test strip of Baoying Tonghui Biological Co., Ltd., and one primer / labeled with biotin (Biotin), the 5' end of the probe sequence was labeled with 6-fluorescein (6-FAM), the 31 site was replaced with tetrahydrofuran (THF), and the 3' end was phosphorylated (C3Spacer). The primers and probes were named RAA-R1 / F1' nucleotides as shown below:

[0069] RAA-R1: 5′-CGGAGATGGGCATCGGCGACTACCTG-3′

[0070] PAA-F1': 5'-Biotin-CCGGGCGAGAAGAGCTGCGAGTGGAA-3'

[0071] Probe 1:

[0072] 5′-6-FAM-CCAACGACACGGGCCTCTACACGCTGCACGnCGCCTCGGGGCC GCG-C3 Spacer-3′, as shown in SEQ ID NO. 17, n=THF.

[0073] Example 4: Establishment of RAA-LFD reaction system (such as Figure 1 (shown)

[0074] The designed RAA primers and probes were used for RAA-LFD detection using a DNA constant temperature rapid amplification kit (colloidal gold test strip type). The RAA-LFD reaction system was reacted at 37°C for 25 min, and 5 μL was drawn into a 1.5 mL PCR tube and heated with ddH 2 O for 10-fold dilution, insert the test strip into the PCR tube, and wait for 5 minutes to observe the quality control line and the test line to read the results. If bands appear on the quality control line and the test line of the test strip, it is judged as positive. If only the quality control line appears, it is judged as negative. If there is no band on the quality control line, the result is invalid.

[0075]

[0076]

[0077] The results are as follows Figure 4 The positive plasmid group showed a red strip on the test line of the lateral flow chromatography test strip, and a blue strip on the quality control line. 2 In the negative control with O as template, only the quality control line shows a blue band.

[0078] Example 5: Sensitivity test

[0079] The pMD18-T-PRV-gE standard positive plasmid was used as a template for sensitivity evaluation. The constructed pMD18-T-PRV-gE standard positive plasmid was diluted 10 times in a constant ratio according to the concentration gradient. The RAA reaction amplification system was used for detection, and ddH 2 O was used as negative control, and the RAA-LFD method was compared with conventional PCR detection to determine the minimum detection limit.

[0080] The results are as follows Figure 5 When the template concentration is 10 6 -10 4 copies / μL, the test strip detection line shows obvious red stripes, the concentration is 10 3 -10 2 When the number of copies / μL of the template decreases to 10 copies / μL, the color gradually fades and a faint band appears. When the number of copies of the template decreases to 10 copies / μL, no detection line appears, so the minimum detection limit is 10 2 copies / μL.

[0081] Example 6: Specificity test

[0082] Referring to Example 4, nucleic acids of six common pathogens such as PEDV, TGEV, PRRSV, PCV2, CSFV, and PPV and PRV nucleic acid were selected as samples for specificity testing. ddH 2 O is a negative control to verify whether there is cross reaction with other templates and evaluate its specificity.

[0083] The results are as follows Figure 6 , obvious bands appeared on the detection line of PRV nucleic acid group, while no obvious bands appeared on the detection line of other 6 pathogens, and no cross reaction occurred with other pathogens.

[0084] Example 7: Clinical sample detection application

[0085] PCR and the RAA-LFD method established in the present invention were used to detect 30 samples of pig blood with known background, respectively, with the positive plasmid as the positive control and ddH 2 O served as a negative control.

[0086] When both positive and negative comparisons are established, Figure 7 The PCR test results shown above showed a positive rate of 36.7% (11 / 30). Figure 8 The positive rate of RAA-LFD was 36.7% (11 / 30). The diagnostic sensitivity of the present invention was 91.6%; the diagnostic specificity was 100%; the test results are shown in the following table.

[0087]

[0088] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A biological composition, characterized in that: The invention comprises a RAA primer set, wherein the RAA primer set is selected from any one of the following primer sets: The primer set having nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4, the primer set having nucleotide sequences as shown in SEQ ID NO.5 and SEQ ID NO.6, or the primer set having nucleotide sequences as shown in SEQ ID NO.15 and SEQ ID NO.

16.

2. The biological composition according to claim 1, characterized in that: The RAA primer set is a primer set whose nucleotide sequences are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

3. The biological composition according to claim 1, characterized in that: The biological composition further comprises a probe, the nucleotide sequence of which is shown in SEQ ID NO.

17.

4. The biological composition according to claim 3, characterized in that: The 5' end of the probe is labeled with 6-fluorochrome, the 31 position is modified by tetrahydrofuran substitution, and the 3' end is phosphorylated using C3 Spacer; Alternatively, one primer of the primer set is labeled with biotin; preferably, the 5' end of the primer is labeled with biotin; preferably, the 5' end of the forward primer is labeled with biotin.

5. A RAA-LFD kit for detecting pseudorabies virus in pigs, characterized in that: A biological composition comprising any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that: Also included is a RAA-LFD reaction system, wherein the RAA-LFD reaction system includes a RAA reaction system.

7. The kit according to claim 5, characterized in that: Also includes test strips.

8. A method for rapid detection of porcine pseudorabies virus by RAA-LFD, characterized in that: Provide a biological composition as claimed in any one of claims 1 to 4 or a kit as claimed in any one of claims 5 to 7, react a sample to be tested with a RAA primer set and a probe in a RAA-LFD reaction system, and detect the liquid after the reaction using a test strip.

9. The method according to claim 8, characterized in that: The reaction temperature is 35-42°C, and the reaction time is 20-30 minutes.

10. The method according to claim 8, characterized in that: The reaction liquid is diluted and then tested using a test strip.

Images