Cappeless and tailless therapeutic exogenous mRNA and method for producing same

Abstract

A biofunctional polynucleotide in the form of a therapeutic exogenous mRNA with a hairpin in place of the cap and poly (A) tail and a method of producing the same are provided. The design of the biofunctional polynucleotides allows one-step production. A target mRNA vector of a biologically functional polynucleotide or a chemically synthesized mRNA molecule includes an internal translation initiation site and a delivery gene sequence. Furthermore, the target mRNA vector is designed to form a stable hairpin at the 5'end and at the 3 'end, where the hairpin comprises at least four paired nucleotides in the stem and is linked to the nearest end by no more than two unpaired nucleotides.

Description

[0001] author

[0002] Viktor Solodushko

[0003] Brian Fouty

[0004] CROSS-REFERENCE TO RELATED APPLICATIONS

[0005] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 344,299, filed on May 20, 2022, which is incorporated herein by reference in its entirety. Technical Field

[0006] The presently disclosed subject matter generally relates to the synthesis of therapeutic exogenous mRNAs having a hairpin instead of a cap and a poly(A) tail. Background Art

[0007] The success of mRNA vaccines in controlling the SARS-CoV-2 epidemic has confirmed the effectiveness of mRNA immunization, and since the first FDA approval of an mRNA vaccine for the SARS-CoV-2 epidemic in 2021, scientists have learned more about the design and synthesis of vaccine mRNA and have a better understanding of the production costs of such vaccines. Currently, mRNA synthesized for use as therapeutic drugs or vaccines is typically transcribed in vitro using a DNA template and capped and polyadenylated. The 5' cap and 3' poly(A) tail are important not only for initiating protein translation, but also for protecting against 5' and 3' exonucleases that can rapidly degrade mRNA transcripts. Unfortunately, the 5' cap is the most expensive component of exogenously produced mRNA, accounting for approximately 45% of the cost of the raw materials.

[0008] The main advantages of vaccines based on exogenous mRNA are that they are cheaper and faster to produce than traditional vaccines (such as subunits, live attenuated viruses, and inactivated viruses). In addition, vaccines based on exogenous mRNA also avoid the safety issues inherent in the use of live viruses, and the downstream purification process is simpler and the manufacturing speed is faster than traditional vaccine manufacturing methods. In addition to mRNA-based vaccines, other technologies based on therapeutic exogenous mRNA have recently attracted great interest in the field of biotechnology. This is especially true in cases where short-term protein expression is an essential property of the therapeutic agent, because the function and degradation of therapeutic exogenous mRNA occur through the same mechanisms that cause endogenous mRNA to function and degrade. In addition to vaccines, biotechnologies that may be particularly relevant to therapeutic exogenous mRNA include protein replacement, gene therapy, and cancer immunotherapy. Exogenous mRNA can also be used as a therapeutic agent for the treatment of clinical diseases.

[0009] As mentioned above, current synthetic methods for exogenous mRNA-based biotechnology also incorporate cap and tail structures. This is primarily because nearly all endogenous eukaryotic mRNAs contain a 5' cap structure and a 3' strand of adenosine nucleotides (poly(A) tail) added during RNA processing. Although both capping of eukaryotic mRNA and the addition of a long poly(A) tail are critical for the proper function and stability of current exogenous mRNA-based biotechnology, both capping and tail addition require additional steps that slow down the production of exogenous mRNA-based biotechnology and increase the cost of manufacturing the aforementioned vaccines. Redesigning mRNA transcripts so that they retain their function and stability without the need for caps and long poly(A) tails would reduce costs, increase speed, and improve the yield of in vitro mRNA production. The cap is not only required to initiate translation, but also to protect the 5' end of the mRNA transcript from exonucleases, while the poly(A) tail is required to protect the 3' end from exonucleases. Any alternative to caps and tails would need to accomplish these tasks.

[0010] A potential solution to replace the role of the cap in initiating translation is to use an internal translation initiation site, which can range from a modified single nucleotide to a sequence of hundreds of modified or unmodified nucleotides in length and is located in the middle of a polyribonucleotide. Known examples of internal translation initiation include, but are not limited to, IRES-stimulated translation initiation, 5'UTRm6A-mediated translation initiation, YTHDF1-mediated translation initiation, ribosome shunting, and repeat-associated non-AUG (RAN) translation. However, using such methods to initiate translation in transcripts lacking a 5' cap and a 3' poly(A) tail still requires a method to protect the 5' and 3' ends from exonucleases.

[0011] Therefore, there is a need in the art for an in vitro synthesized mRNA transcript that can function and remain stable without a 5' cap and / or a 3' poly(A) tail. In addition, there is a need in the art for a therapeutic exogenous mRNA technology that can be produced in vitro in one step to improve production efficiency and reduce production costs. Summary of the invention

[0012] Provided is a therapeutic exogenous mRNA having a hairpin instead of a cap and poly (A) tail and a method for producing the same. On the one hand, the biologically functional polynucleotides and methods for producing the same can be used to accelerate the production of vaccines. On the other hand, the biologically functional polynucleotides and methods for producing the same can be used to reduce the cost of vaccines and transient disease / injury treatments. On yet another aspect, the biologically functional polynucleotides and methods for producing the same can be used to increase the yield of RNA while using the same amount of raw materials for production. In general, the biologically functional polynucleotides and methods for producing the same disclosed are intended as an alternative to designing and producing therapeutic exogenous mRNA (linear and circular). In addition, the design of the biologically functional polynucleotides and methods for producing the same allow for one-step production, rather than some of the multi-step production methods required for more traditional cap-and-tail therapeutic exogenous mRNA molecules.

[0013] In a preferred embodiment, the biological functional polynucleotide is an mRNA, which comprises a target mRNA designed to form a hairpin at the 5' end and the 3' end, wherein the hairpin has no unpaired nucleotides in the stem and between the stem and the end. The hairpin of the biological functional polynucleotide is preferably formed by pairing of no less than 4 complementary base pairs, thereby producing a section of double-stranded mRNA at the 5' and 3' ends. Each hairpin comprises at least one loop, wherein the at least one loop is composed of no less than 2 unpaired nucleotides. In addition, the loop is a sequence that does not form a stable double-stranded RNA in a given hairpin, but can be connected with other sequences in the molecule without destroying the given hairpin. The target mRNA preferably includes an mRNA transcript or a chemically synthesized mRNA molecule, which includes an internal translation start site incorporated upstream of the transgenic. In a preferred embodiment, the internal translation start site is an internal ribosome entry site IRES, and is incorporated into the mRNA transcript or the chemically synthesized mRNA molecule in the 5' untranslated region (5'UTR) of the mRNA transcript or the chemically synthesized mRNA molecule. Hair clip is adjacent to the rest of mRNA at 5' end and 3' end, including but not limited to single hair clip, double hair clip and three hair clips, wherein the double hair clip and three hair clips have zero or no more than two unpaired nucleotides that separate each individual hair clip. The terminal hair clip can also be used as another important structured part (a part of structured IRES, a protein binding site based on hair clip, etc.) in mRNA molecule, and plays an additional role in mRNA translation and stability. Therefore, without departing from the theme of the invention described herein, the embodiment of biological functional polynucleotides may include a target mRNA with a variety of different types of hair clips. In addition, the hair clip at 5' region is operably connected to the internal translation start site by a joint nucleotide sequence that can vary in sequence and quantity, and the hair clip at 3' region is operably connected to the open reading frame ORF of the delivery gene by another joint nucleotide sequence that can also vary in sequence and quantity. In addition, the joint nucleotide sequence that the hair clip is operably connected to can be different in sequence and quantity.

[0014] First, the DNA sequence for creating the target mRNA sequence is inserted into a DNA source (plasmid DNA, genomic DNA, synthetic DNA, PCR product, etc.) to create a DNA template, wherein the DNA template is configured to encode an RNA transcript comprising a target mRNA, the target mRNA having an internal translation start site incorporated upstream of the delivery gene sequence, and both ends are adjacent to a hairpin. Then T7 RNA polymerase is used to complete in vitro transcription; however, other RNA polymerases, such as SP6, T3, etc., may also be used without departing from the subject matter of the invention described herein. This causes the target mRNA vector to include an internal translation start site upstream of the delivery gene sequence. In addition, since the DNA template is configured to produce an mRNA transcript, an internal translation start site is incorporated therein, and a hairpin adjacent to both the 5' end and the 3' end, there is no need to add any cap or poly (A) tail in subsequent steps, thereby allowing a step to create a stable and functional therapeutic exogenous mRNA. Alternatively, the end hairpin can be added to the mRNA only at the 5' end. In this case, it may be necessary to add a poly (A) tail at the 3' end to protect the mRNA and allow it to function normally. Similarly, the terminal hairpin can be added to the mRNA only at the 3' end. In this case, a cap may need to be added at the 5' end to protect the mRNA and allow it to function properly. Natural and modified ribonucleotides (or a combination thereof) can be used to synthesize the target mRNA. Alternatively, the target mRNA vector can be chemically synthesized without a DNA template to produce therapeutic exogenous mRNA in one step.

[0015] The above summary of the invention summarizes some features of biological functional polynucleotides and production methods so that those skilled in the relevant art can better understand the following detailed description. Additional features that constitute the subject matter of the claims will be described below. Those skilled in the relevant art should understand that they can easily use these features to design or modify other structures to achieve the same purpose as the biological functional polynucleotides and methods disclosed herein. Those skilled in the relevant art should also recognize that such equivalent designs or modifications do not depart from the scope of the biological functional polynucleotides and methods disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] These and other features, aspects and advantages of the present disclosure will become more readily understood with reference to the following description, appended claims and accompanying drawings, in which:

[0017] Figure 1 are diagrams illustrating biologically functional polynucleotides embodying features consistent with the principles of the present disclosure.

[0018] Figure 2A are diagrams illustrating biologically functional polynucleotides embodying features consistent with the principles of the present disclosure.

[0019] Figure 2B is a graph showing the eGFP fluorescence signal in cells transfected with a biologically functional polynucleotide encoding eGFP.

[0020] Figure 3A are diagrams illustrating biologically functional polynucleotides embodying features consistent with the principles of the present disclosure.

[0021] Figure 3B is a graph showing the eGFP fluorescence signal in cells transfected with a biologically functional polynucleotide encoding eGFP.

[0022] Figure 4A are diagrams illustrating biologically functional polynucleotides embodying features consistent with the principles of the present disclosure.

[0023] Figure 4B is a graph showing the eGFP fluorescence signal in cells transfected with a biologically functional polynucleotide encoding eGFP.

[0024] Figure 5A are diagrams illustrating biologically functional polynucleotides embodying features consistent with the principles of the present disclosure.

[0025] Figure 5B is a graph showing the eGFP fluorescence signal in cells transfected with a biologically functional polynucleotide encoding eGFP.

[0026] Figure 5C is a graph showing the eGFP fluorescence signal in cells transfected with a biologically functional polynucleotide encoding eGFP.

[0027] Fig. 6A are diagrams illustrating biologically functional polynucleotides embodying features consistent with the principles of the present disclosure.

[0028] Figure 6B is a graph showing the eGFP fluorescence signal in cells transfected with a biologically functional polynucleotide encoding eGFP.

[0029] Fig. 7A are diagrams illustrating biologically functional polynucleotides embodying features consistent with the principles of the present disclosure.

[0030] Figure 7B is a graph showing the eGFP fluorescence signal in cells transfected with a biologically functional polynucleotide encoding eGFP.

[0031] Fig. 8A are diagrams illustrating biologically functional polynucleotides embodying features consistent with the principles of the present disclosure.

[0032] Figure 8Bis a graph showing the expression of hemagglutinin HA (ELISA data) in cells transfected with a biologically functional polynucleotide encoding HA. DETAILED DESCRIPTION

[0033] In the above summary of the invention, this detailed description, the following claims and the accompanying drawings, reference is made to specific features of the invention, including method steps. It should be understood that the disclosure of the invention in this specification includes all possible combinations of these specific features. For example, when a specific feature is disclosed in the context of a specific aspect or embodiment of the invention or a specific claim, the feature may also be used in combination with other specific aspects of the embodiments of the invention to the extent possible / or in the context of other specific aspects of the embodiments of the invention, and is generally used in the present invention.

[0034] Exemplary Definitions

[0035] In accordance with long-standing patent law convention, the words "a" and "an" are used in this application, including the claims, to mean "one or more."

[0036] The term "comprising" and its grammatical equivalents are used herein to indicate that other components, steps, etc. are optionally present. For example, a biologically functional polynucleotide "comprising" components A, B, and C may only contain components A, B, and C, or may contain not only components A, B, and C, but also one or more other components.

[0037] The term "consisting of" and its grammatical equivalents are used herein to indicate that other components, steps, etc. are not optional. For example, a biologically functional polynucleotide "consisting of" components A, B, and C can only contain components A, B, and C.

[0038] As used herein, the terms "about" and "approximately" are used interchangeably and should generally be understood to refer to a numerical range around a given number, as well as all numbers within the recited numerical range (e.g., "about 5 to 15" means "about 5 to about 15" unless otherwise specified). In addition, all numerical ranges herein should be understood to include each integer within the range.

[0039] According to the present invention, polynucleotides, nucleic acid fragments, nucleic acid sequences, etc. include but are not limited to DNA (including but not limited to genomic or extragenomic DNA), genes, peptide nucleic acids (PNA), RNA (including but not limited to rRNA, mRNA and tRNA), nucleosides and appropriate nucleic acid fragments, which can be obtained from natural sources, chemically synthesized, modified or otherwise prepared or synthesized in whole or in part by artificial means.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and compositions similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and compositions are described herein. For the purposes of the present invention, the following terms are defined as follows:

[0041] As used herein, the term "internal translation start site" describes an RNA element that allows for initiation of translation in a cap-independent manner.

[0042] The term "subject" as used herein describes an organism that can be treated using the compositions of the present invention, including mammals, such as primates. Mammalian species that may benefit from the disclosed treatment methods include, but are not limited to, apes, chimpanzees, orangutans, humans, monkeys, domestic animals (such as dogs and cats), livestock (such as horses, cattle, pigs, sheep, goats, and chickens), and other animals (such as mice, rats, guinea pigs, and hamsters).

[0043] The term "treatment" or any grammatical variant thereof (e.g., treatment, treating, and therapeutic treatment, etc.) as used herein includes, but is not limited to, alleviating the symptoms of a disease or condition; and / or reducing, suppressing, inhibiting, alleviating, improving, or affecting the progression, severity, and / or scope of a disease or condition. The term "effective amount" as used herein refers to an amount that can treat or improve a disease or condition or can produce a desired therapeutic effect.

[0044] The term "therapeutic agent" or any grammatical variant thereof as used herein includes, but is not limited to, drug therapy for treating a patient with an existing disease or condition. The types of therapeutic agents that can be used to treat an existing disease or condition in a patient include, but are not limited to, mRNA-based therapies for the following diseases: cancer, infection, genetic disease, autoimmunity, etc.

[0045] The term "prophylactic agent" or any grammatical variation thereof as used herein includes, but is not limited to, a drug therapy used to prevent or ameliorate the effects of a disease or condition that the patient has not yet contracted. Types of prophylactic agents that can be used to prevent or ameliorate the effects of a disease or condition include, but are not limited to, vaccines.

[0046] The term "carrier" as used herein refers to a diluent, adjuvant, excipient or carrier vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including petroleum (e.g., mineral oil), vegetable oils (e.g., peanut oil, soybean oil, and sesame oil), animal oils, or synthetic oils. Saline solutions and aqueous solutions of glucose and glycerol can also be used as liquid carriers.

[0047] The term "carrier" as used herein is intended to include any solvent, dispersion medium, coating, diluent, buffer, isotonic agent, solution, suspension, colloid, inert substance, etc., or a combination thereof, as long as it is pharmaceutically acceptable, can be used for administration to the relevant animal. One or more carriers are commonly used for biological compounds, especially chemotherapeutic agents, and are well known to those of ordinary skill in the pharmaceutical field. Unless any conventional medium or agent is incompatible with the active ingredient, it can be considered for use in diagnostic, preventive and therapeutic compositions. One or more supplementary active ingredients can also be incorporated into or administered with one or more disclosed chemotherapeutic compositions.

[0048] As used herein, the term "DNA source" refers to any DNA fragment carrying a suitable polymerase promoter, internal translation start site, transgene, untranslated region or linker, enhancer, repressor, and any other required regulatory elements (including hairpin nucleotide sequences) to create a suitable mRNA transcript. Alternatively, a DNA molecule isolated from the total genomic DNA of a particular species can be used as a "DNA source". Therefore, a DNA source obtained from a biological sample using one of the compositions disclosed herein may refer to one or more DNA sources that may or may not have been isolated or purified from the total genomic DNA of the particular species from which it originated. The term "DNA source" includes DNA fragments and smaller fragments of such fragments, as well as recombinant vectors, including, for example, plasmids, cosmids, phages, viruses, PCR products, synthetic DNA, DNA ligation products, and the like.

[0049] The term "effective amount" used herein refers to an amount that can treat or improve a disease or condition or can produce the desired therapeutic effect.

[0050] The terms "such as" or "for example" as used herein are used for illustration only and are not limiting and should not be construed to refer to only those items explicitly listed in the specification.

[0051] The terms "identical" or percent "identity" in the context of two or more nucleic acid or polypeptide sequences means that two or more sequences or subsequences are the same or have a specified percentage of amino acid residues or nucleotides that are the same when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (or other algorithms available to one of ordinary skill) or by visual inspection.

[0052] As used herein, the phrase "in need of treatment" refers to a judgment made by a caregiver, such as a physician or veterinarian, that a patient requires (or will benefit in one or more ways from) treatment. This judgment may be based on a variety of factors within the caregiver's expertise, and may include the knowledge that the patient is suffering from a disease state that can be treated by one or more compounds or pharmaceutical compositions, such as those listed herein.

[0053] As used herein, the term "nucleic acid" includes one or more types: polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and any other type of polynucleotide, i.e., N-glycosides of purine or pyrimidine bases, or modified purine or pyrimidine bases (including abasic sites). The term "nucleic acid" as used herein also includes polymers of covalently bound ribonucleosides or deoxyribonucleosides, usually through phosphodiester bonds between subunits, but in some cases through phosphorothioates, methylphosphonates, etc. "Nucleic acids" include single-stranded and double-stranded DNA, and single-stranded and double-stranded RNA. Exemplary nucleic acids include, but are not limited to, gDNA; hnRNA; mRNA; rRNA, tRNA, microRNA (miRNA), small interfering RNA (siRNA), small nucleolar RNA (snORNA), small nuclear RNA (snRNA), and small sequential RNA (stRNA), etc., and any combination thereof.

[0054] As used herein, the term "naturally occurring" as applied to an object means that the object can be found in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including viruses) that can be isolated from a source in nature and has not been intentionally modified by man in the laboratory is naturally occurring. As used herein, laboratory strains of rodents that may have been selectively bred according to classical genetics are considered naturally occurring animals.

[0055] As used herein, the term "operably linked" means that the linked nucleic acid sequences are generally contiguous or substantially contiguous and, where necessary, link two or more structural elements of a vector or two or more protein coding regions. However, since enhancers generally function several thousand bases away from promoters and intron sequences may be of variable length, some polynucleotide elements may be operably linked but not contiguous.

[0056] As used herein, the term "patient" (also interchangeably referred to as "host" or "subject") refers to any host that can receive one or more pharmaceutical compositions disclosed herein. Preferably, the subject is a vertebrate, which is intended to represent any animal species (and preferably, a mammalian species, such as humans). In certain embodiments, "patient" refers to any animal host, including but not limited to any mammalian host. Preferably, the term refers to any mammalian host, the latter including but not limited to humans and non-human primates, cattle, canines, goats, guinea pigs, corvids, calanthes, equines, felines, caprines (hircines), lagomorphs, hares, wolves, murines, sheep, pigs, antelopes, racines, foxes, etc., including livestock, animal specimens, exotic animals, and companion animals, pets, and any animal under veterinary care. The patient can be of any age, as long as the patient is able to respond to the vaccination of the vaccine by producing an immune response. In a specific embodiment, the mammalian patient is preferably human.

[0057] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that preferably do not produce allergic or similar adverse reactions when applied to mammals, especially humans. As used herein, "pharmaceutically acceptable salts" refer to salts that preferably retain the desired biological activity of the parent compound and do not produce any adverse toxicological effects. Examples of such salts include, but are not limited to, acid addition salts formed with inorganic acids (e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, etc.); and salts formed with organic acids, including but not limited to acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid (pamoic acid), alginic acid, naphthoic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid, etc.; salts formed with polyvalent metal cations (e.g., zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, etc.); salts formed with organic cations formed with N,N'-dibenzylethylenediamine or ethylenediamine; and combinations thereof.

[0058] As used herein, the terms "prevent," "preventing," "prevention," "suppress," "suppressing," and "suppression" refer to the administration of a compound alone or in a pharmaceutical composition prior to the onset of clinical symptoms of a disease state to prevent any symptom, aspect, or feature of a disease state. Such prevention and suppression need not be absolute to be considered medically useful.

[0059] As used herein, the term "polypeptide" is intended to encompass the singular "polypeptide" as well as the plural "polypeptides", and includes any amino acid chain or two or more amino acid chains. Thus, as used herein, terms including, but not limited to, "peptide", "dipeptide", "tripeptide", "protein", "enzyme", "amino acid chain" and "continuous amino acid sequence" are included in the definition of "polypeptide", and the term "polypeptide" may replace or be used interchangeably with any of these terms. The term also includes polypeptides that have undergone one or more post-translational modifications, including, but not limited to, for example, glycosylation, acetylation, phosphorylation, amidation, derivatization, proteolytic cleavage, post-translational processing, or modification by the addition of one or more non-natural amino acids. Conventional nomenclature exists in the art for polynucleotide and polypeptide structures. For example, single-letter and three-letter abbreviations are widely used to describe amino acids: alanine (A; Ala), arginine (R; Arg), asparagine (N; Asn), aspartic acid (D; Asp), cysteine ​​(C; Cys), glutamine (Q; Gln), glutamic acid (E; Glu), glycine (G; Gly), histidine (H; His), isoleucine (I; Ile), leucine (L; Leu), methionine (M; Met), phenylalanine (F; Phe), proline (P; Pro), serine (S; Ser), threonine (T; Thr), tryptophan (W; Trp), tyrosine (Y; Tyr), valine (V; Val), and lysine (K; Lys). The amino acid residues described herein are preferably in the "1" isomeric form. However, residues in the "d" isomeric form may be substituted for any 1-amino acid residue as long as the desired properties of the polypeptide are retained.

[0060] "Protein" is used interchangeably with "peptide" and "polypeptide" herein and includes peptides and polypeptides produced synthetically, recombinantly or in vitro, as well as peptides and polypeptides expressed in vivo after the nucleic acid sequence is administered to a host animal or human subject. The term "polypeptide" preferably refers to any amino acid chain length, including short peptides of about 2 to about 20 amino acid residues in length, oligopeptides of about 10 to about 100 amino acid residues in length, and longer polypeptides of about 100 amino acid residues or more in length. In addition, the term is also intended to include enzymes, i.e., functional biomolecules comprising at least one amino acid polymer. The polypeptides and proteins of the present invention also include polypeptides and proteins that are or have been post-translationally modified, and include any sugar or other derivatives or conjugates added to the backbone amino acid chain.

[0061] The term "recombinant" means that the material (e.g., polynucleotide or polypeptide) has been artificially or synthetically (non-naturally) altered by human intervention. The alteration can occur while the material is within or removed from its natural environment or state.

[0062] The term "subject" as used herein describes an organism, including mammals, such as primates, to which treatment according to the compositions of the present invention may be provided. Mammalian species that may benefit from the disclosed treatment methods include, but are not limited to, humans, non-human primates (such as apes, chimpanzees, monkeys, and orangutans), domestic animals (including dogs and cats), and livestock (such as horses, cattle, pigs, sheep, and goats), or other mammalian species (including, but not limited to, mice, rats, guinea pigs, rabbits, hamsters, etc.).

[0063] The term "substantially complementary" when used to define a nucleic acid sequence means that a particular subject sequence (e.g., an oligonucleotide sequence) is substantially complementary to all or part of a selected sequence and will therefore specifically self-anneal to a portion of a DNA or RNA having a selected sequence. Therefore, the number of unpaired nucleotides acceptable in a given sequence will depend on the total number of nucleotides in a given sequence and the point at which unpaired nucleotides cause stability problems within the sequence. For example, the hairpin of the present invention comprises a "stem" and a "loop". The "stem" of the sequence will contain no less than 4 paired nucleotides, but can be much more than this. The number of unpaired nucleotides it can tolerate is the number of unpaired nucleotides that make the stem unstable, and in a preferred embodiment, the number should not exceed 20% of unpaired nucleotides. For example, a stem with 10 paired nucleotides can tolerate 2 unpaired nucleotides. On the other hand, the "loop" of the sequence will contain no less than 2 unpaired nucleotides. These unpaired nucleotides may be complementary to each other, but due to spatial folding problems, they cannot self-anneal to each other within a given hairpin and are therefore "unpaired". However, the nucleotides in the loop can be paired with other distant sequences within the molecule without destroying the given hairpin. In many cases, the sequence may be desired to be a perfect match, ie, completely complementary to the sequence to which the oligonucleotide specifically self-anneals, so that there are no mismatches in the complementary sequence.

[0064] As used herein, the terms "treat," "treating," and "treatment" refer to the administration of one or more compounds (alone or in one or more pharmaceutical compositions) after the onset of clinical symptoms of a disease state to reduce or eliminate any symptom, aspect, or feature of the disease state. Such treatment need not be absolutely effective to be considered medically useful. Thus, the terms "treatment," "treat," "treated," or "treating" may refer to therapy, or to the degree or severity of a disease that improves or alleviates one or more symptoms, whether before or after a patient becomes ill.

[0065] The term "vector" as used herein refers to any molecule / particle used as a carrier to artificially carry an external nucleic acid sequence (usually DNA or RNA) into a target cell where it can be replicated or expressed. Plasmids, PCR products, mRNA, viruses and / or cosmids are exemplary vectors.

[0066] As used herein, an "effective amount" will be understood by one of ordinary skill in the art to provide a therapeutic, prophylactic or other beneficial effect to a recipient patient.

[0067] The phrase "isolated" or "biologically pure" refers to material that is substantially or essentially free of components that normally accompany the material in its natural state. Thus, isolated polynucleotides according to the present invention preferably do not contain materials that normally associate with these polynucleotides in their natural or in situ environment.

[0068] "Linking" or "joining" refers to any method known in the art for functionally linking one or more proteins, peptides, nucleic acids or polynucleotides, including but not limited to recombinant fusion, covalent bonds, disulfide bonds, ionic bonds, hydrogen bonds, electrostatic bonds, etc.

[0069] As used herein, the term "plasmid" refers to a genetic construct consisting of genetic material (i.e., nucleic acid). Typically, a plasmid contains a replication origin that functions in a bacterial host cell (e.g., E. coli), and a selectable marker for detecting a bacterial host cell including the plasmid. The plasmid of the present invention may include one or more genetic elements as described herein, arranged so that the inserted coding sequence can be transcribed and translated in a suitable expression cell. In addition, the plasmid may include one or more nucleic acid fragments, genes, promoters, enhancers, activators, multiple cloning regions, or any combination thereof, including fragments obtained or derived from one or more natural and / or artificial sources.

[0070] Of course, the present invention also encompasses nucleic acid fragments that are complementary, substantially complementary, and / or substantially complementary to at least one or more specific nucleotide sequences specifically described herein. In a preferred embodiment, a "complementary" nucleic acid sequence is a nucleic acid sequence that can perform base pairing according to the standard Watson-Crick complementarity rules. However, the present disclosure also encompasses RNA that can be folded and stabilized by non-canonical base pairing, including but not limited to Hoogsteen base pairs and Wobble base pairs. As used herein, the term "complementary sequence" refers to a substantially complementary nucleic acid sequence that can be evaluated by comparing the same nucleotides as described above, or is defined as being able to hybridize with one or more specific nucleic acid fragments disclosed herein under relatively stringent conditions (e.g., the conditions described above).

[0071] In certain embodiments, it will be advantageous to use one or more nucleic acid fragments of the present invention in combination with an appropriate detectable marker (i.e., a "label"), such as in the case of using a labeled polynucleotide probe in a hybridization assay to determine the presence of a given target sequence. A variety of suitable indicator compounds and compositions for labeling oligonucleotide probes are known in the art, including but not limited to fluorescence, radioactivity, enzymes or other ligands that can be detected in a suitable assay, such as avidin / biotin, etc. In particular embodiments, one or more fluorescent markers or enzyme labels, such as urease, alkaline phosphatase or peroxidase, may also be used instead of radioactivity or other environmentally unfavorable reagents. For enzyme labels, it is known that colorimetric, colorimetric or fluorescent indicator substrates can be used to provide methods for detecting samples visible to the human eye, or by analytical methods such as scintillation imaging, fluorescence determination, spectrophotometry, etc., to identify specific hybridization with samples containing one or more complementary or substantially complementary nucleic acid sequences. For so-called "multiplexed" assays, in which two or more labeled probes are detected simultaneously or sequentially, it may be desirable to label a first oligonucleotide probe with a first label having a first detection characteristic or parameter (e.g., an emission and / or excitation spectrum maximum), which also labels a second oligonucleotide probe with a second label having a different second detection characteristic or parameter (i.e., separate or distinguishable from the first label). The use of multiplexed assays, particularly in the context of gene amplification / detection protocols, is well known to those of ordinary skill in the art of molecular genetics.

[0072] Biologically functional polynucleotides

[0073] Figure 1-8B Preferred embodiments of biologically functional polynucleotides 105 and methods for producing the same for therapeutic exogenous mRNA-based technologies are shown. Biologically functional polynucleotides 105 are generally designed to be stable and functional without the need for a cap or poly(A) tail. Figure 1 Designs of several biologically functional polynucleotides 105 that can be used as therapeutic mRNAs are depicted, including biologically functional polynucleotides 105 that lack a cap and a poly(A) tail. Figure 2A and Figure 2B Depicted are the biologically functional polynucleotides 105 with corresponding eGFP fluorescence signals in transfected HEK293 cells 24 hours after electroporation. All four biologically functional polynucleotides 105 have identical sequences except that their terminal sequences form or do not form a stable hairpin 105B. Figure 3A and Figure 3BDepicted are biologically functional polynucleotides 105 with corresponding eGFP fluorescence signals in transfected HEK293 cells 24 hours after electroporation. All biologically functional polynucleotides 105 have identical sequences except that their terminal sequences form or do not form stable hairpins 105B and include or do not include a short internal poly(A) sequence flanked by 5' and 3' terminal hairpins 105B. Figure 4A and Figure 4B Depicted are biologically functional polynucleotides 105 with corresponding eGFP fluorescence signals in transfected HEK293 cells 24 hours after electroporation. All vectors have identical sequences except for terminal hairpins 105B or short poly(A) sequences where indicated. Figure 5A-Figure 5C Depicted are the biologically functional polynucleotides 105 with corresponding eGFP fluorescence signals in transfected HEK293 cells 24, 48, 72 and 96 hours after electroporation. Fig. 6A and Figure 6B Depicted are the biologically functional polynucleotide 105 with corresponding eGFP fluorescence signals in transfected HEK293 cells 24 and 48 hours after electroporation. Fig. 7A and Figure 7B Depicted are the biologically functional polynucleotide 105 with corresponding eGFP fluorescence signals in transfected HEK293 cells 24 and 48 hours after electroporation. Fig. 8A and 8B Depicted is a biologically functional polynucleotide 105 with corresponding hemagglutinin (HA) expression (ELISA data) in transfected MDCK cells after 12 hours. When the present invention refers to a method comprising two or more defined steps, the defined steps may be performed in any order or simultaneously (unless the context excludes this possibility), and the method may include one or more additional steps that are performed before any defined step, between two defined steps, or after all defined steps (unless the context excludes this possibility).

[0074] In a preferred embodiment, the biological functional polynucleotide 105 is an mRNA composed of a target mRNA designed to form a hairpin 105B at the 5' end and the 3' end, wherein the hairpin 105B comprises a stem structure and a loop structure. The stem is adjacent to the remaining mRNA transcript or chemically synthesized mRNA molecule 105A, and preferably comprises at least 80% of paired nucleotides, and can tolerate up to two unpaired nucleotides at the mRNA end. The loop is connected to the stem and preferably comprises at least 2 unpaired nucleotides in a given hairpin. The hairpin 105B of the biological functional polynucleotide 105 is preferably formed by pairing of no less than 4 complementary base pairs, thereby generating a double-stranded mRNA at the 5' end and the 3' end. Each hairpin 105B comprises at least one loop; however, other preferred embodiments of the biological functional polynucleotide 105 may include a cap, a tail, or a cap and a tail without departing from the subject matter of the invention described herein.

[0075] In a preferred embodiment, the following (hairpin) sequences at the 5' and 3' ends are preferred:

[0076] Double hairpin structure

[0077] 5' end

[0078] GGGCCGUCCGGGCAAUUGCCCGGACGGCCCCCCGGCAGCCCGCAA UUGCGGGCUGCCGGG>>>>>

[0079] 3' end

[0080] >>>>>GCGCGCCAGGGCGCCAAUUGGCGCCCUGGCGCGCCCGCGGGUGGGCGCCAAUUGGCGCCCACCCGCGG

[0081] Three hairpin structure

[0082] 5' end

[0083] GGGAGACCCGAGCUCGGAUCCGAGCUCGGAUCCGAGCUCGGGUC UCCCGCUGCCUGUCCGGGCAUAUGCCCGGACAGGCAGCGACGCUGGC UGGACGCUUAAGCGUCCAGCCAGCGUC>>>>>

[0084] 3' end

[0085] >>>>>CGGACGACGUCGCUCAGGUAUACCUGAGCGACGUCGUCCG ACCGGUGCUCACGUGCGGCUGCAGCCGCACGUGAGCACCGGUGGGUCGAGGCUGAUCGGCGAGCUCGGUUAACCGAGCUCGCCGAUCAGCCUCGACCC

[0086] However, the influence of these terminal hairpins on mRNA function is largely independent of sequence and depends mainly on the stability of the hairpin formed. In another preferred embodiment, the stable hairpin comprises a range of 20-40 nucleotides and has a higher GC percentage in the stem. However, it will be appreciated by those skilled in the art that stable hairpins with different numbers of nucleotides and / or comprising different nucleotide combinations can also be used to produce biological functional polynucleotides, and do not depart from the subject matter of the invention described herein.

[0087] The target mRNA preferably includes an mRNA transcript or a chemically synthesized mRNA molecule 105, which includes an internal translation start site 105C incorporated at the upstream 105C of the delivery gene sequence. In a preferred embodiment, the internal translation start site 105C is an internal ribosome entry site (IRES) and is incorporated into the mRNA transcript 105 (or the chemically synthesized mRNA molecule) in the 5' untranslated region 5'UTR of the mRNA transcript 105 (or the chemically synthesized mRNA molecule). The hairpin 105B of the target mRNA 105 is adjacent to the internal translation start site 105C of the delivery gene sequence and the untranslated region of the mRNA transcript or the chemically synthesized mRNA molecule 105A at one or both of the 5' end and the 3' end. The hairpin 105B of the biological functional polynucleotide 105 includes but is not limited to a single hairpin, a double hairpin and a triple hairpin, wherein the double hairpin and the triple hairpin have zero or a minimum number of unpaired nucleotides separating each individual hairpin. Therefore, without departing from the inventive theme described herein, the embodiment of biological functional polynucleotide 105 may include a target mRNA with a plurality of different types of hairpin 105B. For example, biological functional polynucleotide 105 may include a double hairpin operably connected to the target mRNA in the 5' non-translated region and an mRNA operably connected to the double hairpin of the target mRNA in the 3' non-translated region. For example, target mRNA 105 may have a single hairpin at 5' end and three hairpins at 3' end. In addition, the hairpin 105B at 5' end is operably connected to the internal translation start site 105C by a joint nucleotide sequence that can vary in sequence and quantity, and the hairpin 105B at 3' non-translated region is operably connected to the open reading frame (ORF) of the delivery gene by another joint nucleotide sequence that can also vary in sequence and quantity. In addition, the sequence and quantity of the joint nucleotide sequence to which hairpin 105B is operably connected may be different.

[0088] The DNA sequence for creating the target mRNA is first inserted into a DNA source (plasmid DNA, genomic DNA, synthetic DNA, PCR product, etc.) to create a DNA template, wherein the DNA template is configured to encode an RNA transcript containing the target mRNA 105, which has an internal translation start site 105C, which is incorporated upstream of the transgene and adjacent to the hairpin 105B at both ends. Then, in vitro transcription is completed using T7 RNA polymerase; however, other RNA polymerases, such as SP6, T3, etc., can be used without departing from the subject matter of the invention described herein. This results in the target mRNA vector 105 containing an internal translation start site 105C upstream of the transgene. In addition, since the DNA template is configured to produce an mRNA transcript, in which an internal translation start site 105C is incorporated, and has a hairpin 105B adjacent to the 5' end and the 3' end, it is not necessary to add any cap or poly (A) tail in the subsequent steps, thereby allowing a stable and functional therapeutic exogenous mRNA to be created in one step. Natural and modified ribonucleotides (or a combination thereof) can be used to synthesize the target mRNA 105. Alternatively, a terminal hairpin 105B can be added to the mRNA only at the 5' end. In this case, a poly (A) tail may need to be added to the 3' end to protect the mRNA and allow it to function properly. Similarly, a terminal hairpin 105B can be added to the target mRNA 105 only at the 3' end. In this case, a cap may need to be added to the 5' end to protect the mRNA and allow it to function properly.

[0089] Alternatively, the target mRNA 105 can be chemically synthesized without the use of a DNA template, thereby producing a therapeutic exogenous mRNA in a single step. Currently, chemically produced RNA (i.e., RNA produced in vitro without the use of a DNA template) is almost always synthesized using automated solid phase methods. Other methods include RNA solid phase synthesis combined with chemical ligation to connect multiple chemically synthesized RNA chains to form mRNA.

[0090] Therapeutic and preventive uses

[0091] Another aspect of the present invention relates to the use of target mRNA 105 to facilitate efficient transfection of target cells, tissues and / or organs, and / or for treatment and prevention, such as gene-based therapy and vaccines, respectively.

[0092] In one embodiment, the present invention provides a method for generating therapeutic or experimental mRNA for delivery to target cells, tissues and / or organs, comprising introducing into cells a composition comprising an effective amount of single-stranded polynucleotides comprising the target mRNA 105 of the present invention, which may include at least one regulatory element. In a specific embodiment, the mRNA regulatory element of the present invention can be used to affect protein expression control of one or more mRNAs encoding one or more gene products, therapeutic agents, proteins, etc. in a suitable host cell.

[0093] In addition, the present invention provides a method for treating a disease, wherein the method comprises administering to a subject in need of such treatment and / or vaccination an effective amount of a composition comprising one or more polynucleotide sequences encoding a selected target protein, wherein the polynucleotide sequence is operably positioned with one or more mRNA regulatory elements disclosed herein, such that the regulatory element is capable of affecting, altering, reducing, increasing or otherwise controlling the translation of the encoded protein based on the mRNA whose translation is affected by the regulatory element.

[0094] The present invention also provides the use of the compositions disclosed herein in the manufacture of a medicament for treating, preventing or ameliorating the symptoms of a disease, disorder, dysfunction, injury or trauma, including but not limited to treating, preventing and / or preventing a disease, disorder or dysfunction, and / or ameliorating one or more symptoms of such a disease, disorder or dysfunction. Exemplary conditions for which the biologically functional polynucleotide 105 may be particularly useful include but are not limited to viral, bacterial or other pathogen infection, cancer, diabetes, allergies, autoimmune diseases / disorders, kidney disease, cardiovascular disease, pancreatic disease, intestinal disease, liver disease, nervous system disease, neuromuscular disorder, neuromotor disorder, neuroskeletal injury, nervous system disability, neurosensory dysfunction, stroke, alpha 1-antitrypsin (AAT) deficiency, Batten disease, ischemia, eating disorders, Alzheimer's disease, Huntington's disease, Parkinson's disease, bone disease and lung disease.

[0095] The present invention also provides a method for treating or improving the symptoms of such diseases, injuries, conditions or dysfunctions in mammals. Such methods generally involve at least the step of administering one or more biologically functional polynucleotides 105 of the present invention to a mammal in need thereof, in an amount and for a time sufficient to treat or improve the symptoms of such diseases, injuries, conditions or dysfunctions in mammals.

[0096] Such treatment regimens are particularly contemplated in human treatment by administering one or more compositions intramuscularly, intravenously, subcutaneously, intrathecally, intraperitoneally, or by direct injection into an organ or tissue of the subject being cared for.

[0097] The present invention also provides a method for providing a therapeutically effective amount of the biologically functional polynucleotide 105 of the present invention to a mammal in need thereof, the amount and time being effective to provide the patient with a therapeutically effective amount of a desired therapeutic agent encoded by one or more nucleic acid fragments contained in the biologically functional polynucleotide 105. Preferably, the therapeutic agent is mRNA, but other embodiments of the biologically functional polynucleotide 105 can be selected from the group consisting of ribozymes, peptide nucleic acids, siRNA, RNAi, antisense oligonucleotides, and antisense polynucleotides.

[0098] Pharmaceutical composition

[0099] The present invention also provides therapeutic or pharmaceutical compositions comprising active ingredients in a form that can be combined with a therapeutically or pharmaceutically acceptable carrier. The genetic constructs of the present invention can be prepared into various compositions or formulated in appropriate pharmaceutical carriers for administration to human or animal subjects.

[0100] The biologically functional polynucleotides 105 of the present invention provide new and useful methods for regulating protein translation in suitable mammalian cells, and provide new opportunities for the expression of one or more selected target genes in the mammalian cells. The biologically functional polynucleotides 105 of the present invention also provide compositions comprising one or more disclosed biologically functional polynucleotides 105.

[0101] As described herein, the compositions of the present invention may also include a pharmaceutical excipient, a buffer, a transfection agent, a nanoparticle, a nanolipoprotein particle, a lipid nanoparticle (NLP), or a diluent, and may be formulated for administration to an animal, particularly a human. Such compositions may also optionally include liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, or nanoparticles, or may be otherwise formulated for administration to a cell, tissue, organ, or body of a subject in need thereof. Such compositions can be formulated for a variety of therapies, for example, for the improvement, prevention and / or treatment of conditions such as peptide deficiency, polypeptide deficiency, peptide overexpression, polypeptide overexpression, including, for example, conditions that lead to diseases or disorders, such as viral, bacterial or other pathogen infection, cancer, tumor or other malignant growth, neurological deficit, allergy, autoimmune disease / disorder, joint disease, heart or lung disease, ischemia, stroke, cerebrovascular accident, transient ischemic attack (TIA); diabetes and / or other pancreatic diseases; cardiocirculatory diseases or dysfunction (including, for example, hypotension, hypertension, atherosclerosis, hypercholesterolemia, vascular damage or disease); neurological diseases (including, for example, Alzheimer's disease, Huntington's disease, Tay-Sachs disease and Parkinson's disease, memory loss, trauma, movement disorders, neuropathy and related diseases); biliary, kidney or liver diseases or dysfunction; musculoskeletal or neuromuscular diseases (including, for example, arthritis, paralysis, cystic fibrosis (CF), amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), muscular dystrophy (MD), etc.).

[0102] In some preferred embodiments, the target mRNA 105 having at least one hairpin 105B can be formulated with one or more pharmaceutically acceptable solutions for administration to cells or animals alone or in combination with one or more other treatment modalities, particularly for the treatment of human cells, tissues and diseases affecting humans. This includes embodiments of biologically functional compounds that also contain at least one cap and poly (A) tail. If necessary, additional nucleic acid fragments can be operably connected to the target mRNA carrier 105, and then its product can be administered to animals (alone or in combination with one or more other agents, for example, proteins or polypeptides or various pharmaceutically active agents, therapeutic polypeptides, biologically active fragments or variants thereof). In fact, considering that additional agents do not produce significant adverse effects and / or prevent target mRNA 105 from being expressed in the animal body to which the biologically functional polynucleotide 105 is administered when in contact with target cells or host tissues, there is almost no restriction on other ingredients that can be included. Therefore, the composition comprising the biologically functional polynucleotide 105 can be delivered together with various other agents according to the needs of a particular situation. Such compositions can be purified from host cells or other biological sources, or can be chemically synthesized as described herein.

[0103] Those skilled in the art are familiar with the formulation of pharmaceutically acceptable excipients and carrier solutions, and the development of suitable dosages and treatment regimens to use the specific compositions described herein in various treatment regimens, including, for example, oral, parenteral, intravenous, intranasal, intraarticular, intramuscular administration and formulation. Typically, these preparations may contain at least about 0.1% of the active compound or more, although the percentage of the active ingredient may of course vary, and may conveniently be between about 1% or 2% to about 70% or 80% or more of the weight or volume of the total preparation. Of course, the amount of active compound in each therapeutically useful composition may be prepared so that a suitable dosage is obtained in any given unit dose of the compound. Those skilled in the art of preparing such pharmaceutical preparations will consider factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations, so various dosages and treatment regimens may be desirable.

[0104] In some cases, it is desirable to deliver the disclosed biofunctional polynucleotide 105 by subcutaneous, intraocular, intravitreal, parenteral, subcutaneous, intravenous, intracerebroventricular, intramuscular, intrathecal, oral, intraperitoneal, oral or nasal inhalation delivery or direct injection into one or more cells, tissues or organs in a suitably formulated pharmaceutical composition disclosed herein. The method of administration may also include those described in U.S. Patent Nos. 5,543,158, 5,641,515 and / or 5,399,363 (each patent is fully incorporated herein by explicit reference). Solutions of active compounds as free alkali or pharmacologically acceptable salts may be prepared in sterile water and may also be appropriately mixed with one or more surfactants (e.g., hydroxypropyl cellulose). Dispersions may also be prepared in glycerol, liquid polyethylene glycol, mixtures thereof, and oils. Under normal storage and use conditions, these preparations contain preservatives to prevent the growth of microorganisms.

[0105] Compositions in pharmaceutical form containing the disclosed biologically functional polynucleotides 105 suitable for injection include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injection solutions or dispersions (U.S. Pat. No. 5,466,468, the entire contents of which are incorporated herein by explicit reference). In all cases, the form must be sterile and must be fluid for ease of injection. It must remain stable under manufacturing and storage conditions and must be protected from the contaminating effects of microorganisms (e.g., bacteria and fungi). The carrier can be a solvent or dispersion medium, for example, containing water, ethanol, a polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), a suitable mixture thereof, and / or a vegetable oil. Appropriate fluidity can be maintained, for example, by using a coating (e.g., lecithin), maintaining the desired particle size in the case of dispersion, and using a surfactant.

[0106] The compositions of the present invention can be administered to the subject being treated by standard routes, including but not limited to pulmonary, intranasal, oral, inhalation, parenteral, such as intravenous, topical, transdermal, intradermal, transmucosal, intraperitoneal, intramuscular, intracapsular, intraorbital, intracardiac, intratracheal, subcutaneous, subcutaneous, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, and intrasternal injection. In a preferred embodiment, the composition is administered by intranasal, pulmonary or oral routes.

[0107] For the administration of injectable aqueous solution, for example, if necessary, a suitable buffer solution can be used, and the liquid diluent is first made isotonic with enough saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, those skilled in the art will understand the usable sterile aqueous medium according to the present disclosure. For example, a dose can be dissolved in 1ml isotonic NaCl solution, then added to 1000ml subcutaneous injection or injected into a predetermined infusion site (for example, referring to " Leimington Pharmaceutical Science " (Remington's Pharmaceutical Sciences) the 15th edition, pages 1035-1038 and 1570-1580). According to the condition of the subject being treated, some changes will inevitably occur in the dosage. In any case, the person responsible for administration will determine the appropriate dosage for individual subjects. In addition, for human administration, the preparation should meet the sterility, pyrogenicity and general safety and purity standards required by the FDA Office of Biological Products standards.

[0108] The method for preparing a sterile injection solution is to add the required amount of the biologically functional polynucleotide 105 together with the other several ingredients listed above (as needed) to an appropriate solvent, and then filter sterilize. Generally, the method for preparing a dispersion is to add various sterilized active ingredients to a sterile carrier, which contains a basic dispersion medium and the required other ingredients listed above. For sterile powders for preparing sterile injection solutions, the preferred preparation method is vacuum drying and freeze drying technology, which can produce powders of the active ingredient and any additional required ingredients from a previously sterile filtered solution.

[0109] Compositions comprising the disclosed biologically functional polynucleotides 105 can also be formulated into neutral or salt forms. Pharmaceutically acceptable salts include acid addition salts (formed by free amino groups of proteins), which are formed by inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed by free carboxyl groups can also be derived from inorganic bases (e.g., sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide) and organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine, etc.). After preparation, the solution will be administered in a manner compatible with the dosage formulation and administered in a therapeutically effective amount. These formulations are easily administered in various dosage forms, such as injectable solutions, drug release capsules, etc.

[0110] The amount of the composition comprising the disclosed biologically functional polynucleotides 105 and the time required to administer the composition will be within the purview of the skilled artisan having the benefit of the present teachings. However, it is likely that administration of a therapeutically effective amount of the disclosed composition can be achieved by a single administration, e.g., a single injection of a sufficient number of infectious particles to provide a therapeutic benefit to a patient receiving such treatment. Alternatively, in some cases, multiple or continuous administrations of the composition comprising the disclosed biologically functional polynucleotides 105 may be required, whether over a relatively short period of time or a relatively long period of time, which can be determined by the physician supervising the administration of such compositions.

[0111] Example

[0112] The following examples are used to show illustrative embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in these examples represent techniques that have been found to work well in the practice of the present invention and can therefore be considered to constitute preferred modes for its practice. However, in view of this disclosure, it will be appreciated by those skilled in the art that many changes may be made in the disclosed specific embodiments without departing from the spirit and scope of the present invention and still obtaining the same or similar results.

[0113] Example 1—Presented herein is the ability of an uncapped and unadenylated RNA vector with an unstructured UTR to express a fluorescent reporter gene (eGFP) from the EMCV IRES to a target mRNA 105 of the same length but with a stable terminal hairpin 105B at one or more ends, in the form of a biologically functional polynucleotide with a transcript or chemically synthesized mRNA molecule operably linked to the hairpin 105B at one or more ends. The use of an internal translation initiation sequence can generate a target mRNA 105 without a 5' cap and a poly(A) tail. Due to the lack of a 5' cap and a 3' poly(A) tail, these RNAs are easily degraded by exonucleases, thereby significantly reducing their expression efficiency. The addition of a stable terminal hairpin 105B to each end of a transcript or chemically synthesized mRNA molecule 105A lacking a cap and a poly(A) tail may increase protein translation by reducing its susceptibility to exonuclease activity and / or affecting regulatory mechanisms of protein translation. The effect on the expression efficiency of eGFP 24 h after delivery of the vector into HEK293 cells by electroporation was investigated when a stable secondary RNA hairpin was incorporated at one or both ends of the mRNA ( FIG. 2 ).

[0114] The results were compared with eGFP expression from a control vector (-R-) that contained an IRES and had 5' and 3' UTRs of the same length, but lacked a stable terminal hairpin. As shown in Figure 2, transfection with a control vector without hairpin 105B resulted in very low eGFP expression. If the transcript or chemically synthesized mRNA molecule 105 contained a 5' hairpin (hR-), eGFP expression increased slightly, but the presence of hairpin 105B (-Rh) at the 3' end had a significantly greater positive effect on eGFP expression. Delivery of transcripts or chemically synthesized mRNA molecules 105 with 5' and 3' hairpins (hRh) resulted in maximum eGFP expression. These findings suggest that the addition of terminal secondary structure improves translation initiated by the EMCV IRES in target mRNAs 105 lacking caps and poly (A) sequences.

[0115] Example 2—Internal poly(A) sequences can serve as additional entry points for poly(A) binding proteins (PABPs) and play an important role in regulating gene expression, especially in MSCV IRES-driven vectors, which are less dependent on the 3' poly(A) terminus for translation initiation. To determine whether such internal poly(A) sequences would increase the translation efficiency of target mRNA 105 with one or more terminal hairpins, relatively short (40 bp) poly(A) fragments were inserted downstream of the 5' terminal hairpin or upstream of the 3' terminal hairpin, and eGFP expression was then assessed. All vectors had the same IRES-eGFP internal transcription cassette and differed only in the presence or absence of the terminal hairpin and poly(A) fragment. HEK293 cells were electroporated with these target mRNAs, and the eGFP signal was measured 24 hours later.

[0116] As shown in FIG3 , if the 3′ end is unstructured (i.e., lacking a hairpin; haR- and hR-), the presence of a poly(A) sequence downstream of the 5′ hairpin has little effect on eGFP expression. Similar to Example 1, target mRNAs 105 with hairpin 105B at the 3′ end expressed more eGFP than target mRNAs 105 with only hairpin 105B at the 5′ end, but the addition of a poly(A) segment immediately upstream of the 3′ hairpin (-Rh vs. -Rah) had minimal effect on expression. All vectors with both 5′ and 3′ hairpins showed higher eGFP expression than target mRNAs 105 with a single hairpin. Adding a poly(A) sequence to target mRNAs 105 with terminal hairpins had minimal effect on eGFP expression.

[0117] Example 3—Next, the effect of replacing the terminal hairpin with a short poly(A) fragment was investigated to determine whether this would increase eGFP expression. Addition of a longer poly(A) tail to the 3' end of an mRNA can increase protein expression from a capped messenger by stabilizing the RNA and activating translational regulatory mechanisms. Whether this also happens with short poly(A) fragments when translation is initiated from an internal IRES in transcripts or chemically synthesized mRNA molecules105 has not been fully investigated.

[0118] The 5' and 3' terminal hairpins were replaced by short poly(A) fragments, and the translation efficiency of these target mRNAs 105 in HEK293 cells was determined. The cells were electroporated with the appropriate vectors, and eGFP expression was measured 24 hours after vector delivery. As shown in Figure 4, the addition of short terminal 3'poly(A) sequences to target mRNAs 105 lacking 3' terminal hairpins slightly increased eGFP expression (-R- to -Ra, aR to aRa, and hR- to hRa), while the addition of short terminal 5'poly(A) sequences to target mRNAs 105 lacking 5' terminal hairpins had no significant effect on eGFP expression (aR- to -R-, aRa to -Ra, aRh to -Rh). The positive effect of hairpin 105B on eGFP expression was much greater than the effect of the short terminal poly(A) sequence. Target mRNAs 105 having hairpins 105B at both ends of the transcript or chemically synthesized mRNA molecule 105 had the highest eGFP expression compared to vectors having other terminal configurations.

[0119] Example 4—A transcript or chemically synthesized mRNA molecule operably linked to a terminal hairpin is able to support higher levels of eGFP expression. It was investigated whether capping and post-translational polyadenylation with a longer poly(A) tail would affect the translation efficiency of a target mRNA 105 having 5' and 3' hairpins. As shown in FIG4 , a biologically functional polynucleotide 105 having a transcript or chemically synthesized mRNA molecule operably linked to a double-sided terminal hairpin coupled to an internal poly(A) sequence downstream of the 5' terminal hairpin (haRh) vector has the best expression efficiency. Therefore, it was selected as the preferred biologically functional polynucleotide 105 for these experiments. A vector without an IRES sequence but with the same eGFP ORF was used for comparison (-R-). The lengths of the 5' and 3' UTRs of this vector are comparable to those in the vector haRh, but are intentionally designed not to form a stable secondary structure (i.e., no terminal hairpin is formed). The two (control) vectors (-R- and haRh) were then cleaved with 3'-O-Me-m 7 Capping with a G(5')ppp(5')G RNA cap analog (also known as anti-reverse cap analog (ARCA)) and polyadenylation using E. coli Poly(A) polymerase results in tails greater than 200 bases, resulting in two additional vectors - (ChaRhA) and (CRA).

[0120] eGFP levels in target cells were measured between 24 and 96 hours after vector delivery ( Figure 5B and 5C) to assess the stability of protein expression. Cell transfection was achieved by electroporation. The control vector -R- lacks a 5' cap and a long terminal poly(A) and expresses barely detectable eGFP. The vectors CRA (which uses a 5' cap to initiate translation and is polyadenylated) and haRh (which initiates translation via an IRES and lacks a cap and a poly(A) tail) have comparable eGFP expression when used at equimolar concentrations ( Figure 5C ). The vector (ChaRhA) that combined a double-sided hairpin, a 5' cap, a long poly(A) tail, and the MSCV IRES produced the highest eGFP levels at all time points. From 24 to 96 hours after electroporation, the fluorescence signal decayed at a consistent rate in all cells.

[0121] To determine which modification was primarily responsible for the increased eGFP expression in the ChaRhA vector (the Cap or the long poly(A) tail), two additional biologically functional polynucleotides were generated: ChaRh was capped but lacked a long poly(A) tail, and haRhA was not capped but had a long poly(A) tail ( Fig. 6A ). Although both modifications increased eGFP expression, e.g. Figure 6B As shown, the effect of adding the cap (ChaRh) is greater than the effect of adding the poly(A) tail (haRhA). The effects of adding the cap and the poly(A) tail are additive. Similar to the findings in Figure 5, there was no difference in the rate at which the eGFP signal decayed over time between the vectors.

[0122] Example 5—The presence of more complex secondary structure near one end of an RNA may protect that end from exonucleases by physically restricting exonuclease access to the end.

[0123] To test whether the presence of a more complex secondary structure near one end of the RNA could protect that end from exonucleases by physically restricting exonuclease access to the end, we investigated whether a triple terminal hairpin structure in the delivered RNA improved protein expression compared to a single hairpin. Since the addition of a poly(A) segment had little effect on eGFP expression in previous experiments, three new biologically functional polynucleotides 105 without internal poly(A) sequences were constructed and compared to target mRNAs 105(hRh) with single hairpins at both ends ( Fig. 7A ). In one vector, we replaced the single 5' hairpin with a triple hairpin structure (hhhRh). The hairpins 105B were connected using unpaired adapters. The second vector was constructed by replacing the single 3' hairpin in the hRh vector with a 3' triple hairpin structure using the same strategy (hRhhh). The last vector has triple hairpin structures at both ends (hhhRhhh).

[0124] To assess the stability of protein expression, eGFP levels in HEK293 cells transfected with each vector were measured 24 and 48 h after vector delivery by electroporation ( Figure 7B ). All vectors with triple hairpins showed enhanced eGFP expression compared to the single hairpin vector (hRh). The vector with triple hairpins incorporated at both the 5' and 3' ends (hhhRhhh) produced the highest eGFP levels at both time points. Of particular note, the fluorescence signal at 48 hours after electroporation for all vectors was approximately 42-43% of the value observed at 24 hours, except for the vector with triple hairpins at both ends (hhhRhhh), where the fluorescence was 48%. The reduction in fluorescence decay rate is likely due to improved vector stability in the cell.

[0125] Example 6: To evaluate the unique effects of using a 5' double hairpin and IRES on membrane protein expression, an mRNA vector encoding influenza hemagglutinin (HA) instead of eGFP was tested. Fig. 8A As shown, four additional biologically functional polynucleotides 105 were generated that differed only at the 5' mRNA end: 1) an mRNA vector without a cap and without IRES, 2) an mRNA vector with a cap ( ARCA) and no IRES, 3) uncapped mRNA vector with 5' double hairpin and IRES, and 4) capped ( ARCA), 5' double hairpin and IRES mRNA vectors. (n=2, *P<0.05). All four vectors have 3' double hairpin and poly(A) tail. Figure 8B Shows the -mRNA reagent transfection 12 hours later, HA expression in MDCK cells using equal amounts of mRNA (ELISA data). Figure 8B As shown, the use of a 5' double hairpin and IRES increased HA expression by approximately 5-fold compared to a vector with a 5' cap and no IRES. In addition, the addition of a 5' cap to an mRNA vector with a 5' double hairpin and IRES had little effect on total HA expression.

[0126] discuss

[0127] We show here that mRNAs designed to form hairpin secondary structures at both the 5' and 3' ends can maintain high levels of reporter gene expression in eukaryotic cells, even in the absence of a 5' cap and a 3' polyadenylation tail, as long as they contain an EMCV IRES in their 5'UTR. Equimolar levels of mRNAs containing the EMCV IRES showed the same protein expression levels as conventionally constructed (without IRES) mRNAs containing a 5' cap and a 3' poly-(A) tail. The presence of an internal, but not a terminal, poly(A) segment did not significantly affect protein expression. Combining post-transcriptional capping and polyadenylation with terminal hairpins can improve translation efficiency compared to either strategy alone. Using a triple hairpin structure instead of a single hairpin further increased protein expression, outperforming capping and polyadenylation vectors without an IRES.

[0128] In general, therapeutic mRNA production is a three-step process: 1) in vitro mRNA synthesis from a DNA template, 2) addition of a modified guanylate cap to the 5' end of the mRNA, and 3) addition of a poly(A) tail to the 3' end of the mRNA. mRNA can be capped during transcription by adding a cap analog to the nucleotide mix during synthesis, or the cap can be added after the mRNA is fully transcribed. Regardless of which method is used, it always results in a portion of the mRNA being uncapped, rendering it translationally inactive. In terms of the poly(A) tail, a relatively short poly(A) tail can be added directly to the end of the mRNA during transcription by including the sequence into the DNA template. Alternatively, a longer poly(A) tail can be added after in vitro transcription using a recombinant poly(A) polymerase, resulting in a more stable mRNA.

[0129] The question is whether mRNA can be synthesized without a cap and a poly(A) tail and still function when introduced into cells. To make in vitro mRNA transcripts function without a 5' cap, an alternative method is needed to initiate protein synthesis. One approach is to include an internal ribosome entry site (IRES) in the 5' region to initiate translation. Cells use IRES to increase translation of certain proteins during mitosis and programmed cell death. Viruses often use IRES to ensure that viral translation is active when host translation is inhibited. While positive-strand RNA viral genomes that utilize an internal ribosome entry site (IRES) to promote cap-independent translation are influenced by the presence of poly(A) binding protein (PABP) and poly(A) status, transcription from other IRESs is much less dependent on polyadenylation status. The EMCV IRES used in the vectors described here does rely on the conventional set of eukaryotic initiation factors (with the exception of eIF4E and intact eIF4G), but it does not require PABP or 5'-3' communication with the poly(A) tail in vitro, at least during the first round of initiation. Therefore, using an IRES rather than a 5' cap to initiate protein synthesis allows removal of the poly(A) tail without significantly impairing protein synthesis.

[0130] Therefore, it should be possible to generate uncapped and unadenylated mRNA with an open reading frame downstream of the IRES that allows efficient protein translation. However, this approach has not yet been used for molecular biology applications or for vaccine or therapeutic drug production because the uncapped 5' end and the non-adenylated 3' end are extremely sensitive to exonuclease degradation, which reduces the stability of the mRNA.

[0131] One approach to protect exogenously generated uncapped and non-adenylated mRNA from exonuclease degradation is to construct circular RNA. EMCV IRES-driven reporter RNA vectors can be designed to produce circular RNAs that have neither a cap nor poly(A). This type of circular RNA has no free ends susceptible to exonuclease attack and is therefore more stable, resulting in prolonged protein expression. However, due to the rigid secondary structure of circular RNA and its lack of flexibility, transfection of cells with exogenous circular RNA activates antiviral gene products, such as OAS, PKR, and RIG-I, thereby initiating cellular responses against circular RNA.

[0132] Another approach to protect the ends of mRNAs lacking a cap and a poly(A) tail is to add nucleotide hairpins to the 5' and 3' ends. Nucleotide hairpins are a pairing of complementary base pairs and are an essential secondary structure of RNA. They can guide RNA folding, determine interactions with ribozymes, protect mRNA from degradation, serve as a recognition motif for RNA-binding proteins, or serve as a substrate for enzymatic reactions. Studies have shown that a 5' stem-loop structure stabilizes mRNA in different bacteria, possibly by preventing RNase E from interacting with the 5' end of the messenger. Notably, the location of this stem-loop at or very near the 5' and 3' ends appears to be critical for its stabilizing effect, while the sequence of the hairpin and its position relative to the ribosome binding site appear to have little effect. Up to two unpaired nucleotides upstream of the 5' hairpin can be accommodated without reducing the stability of the mRNA, but the addition of 10-15 unpaired nucleotides of random sequence is as destabilizing as the deletion of the 5' hairpin. A strong Shine-Dalgarno sequence near the 5' end of the message in E. coli recruits ribosomes and stabilizes the message by preventing nucleases from accessing the degradation signals present in naked mRNA.

[0133] The role of terminal hairpins in eukaryotes has not been extensively studied, as this structure does not appear to be common in metazoans. At the 5' end, terminal hairpins can interfere with the process of cap induction, whereas at the 3' end, most mRNAs are flanked by polyadenylation signals followed by 10-30 downstream nucleotides and a poly(A) tail, making terminal hairpin formation unlikely. Non-polyadenylated mRNAs are rare in eukaryotes.

[0134] We hypothesized that by adding the stabilizing hairpin 105B during in vitro synthesis, we could protect both ends of the exogenous mRNA vector; this would stabilize the molecule and protect it from exonuclease degradation when delivering the mRNA to target cells. However, this would only be possible for mRNAs that do not rely on their ends to function. Adding the EMCV IRES to the 5' end to initiate translation would allow us to generate in vitro mRNA transcripts in a single step, thus avoiding the expensive and time-consuming 5' capping and 3' poly(A) addition.

[0135] By using this strategy, we generated a potent mRNA transcript that is identical to a conventionally constructed mRNA containing a 5' cap and a 3' poly(A) tail. The use of three hairpins at each end resulted in the greatest reporter gene expression from any of the vectors tested (i.e., conventional construct, hairpin 105B with an IRES, or hairpin 105B with an IRES with a cap and poly(A) tail). Such mRNA structures are not commonly found in eukaryotic cells, but they can be easily synthesized in vitro in a single step and then delivered as drugs or vaccines. In these experiments, we used the EMCV IRES, but other IRESs may be used. However, the function of each IRES may vary from vector to vector, so experimental verification of the results is required.

[0136] These results indicate that the 5' cap and 3' poly(A) tail are not always necessary for successful expression of exogenously generated mRNA in eukaryotic cells. The inclusion of a 5' IRES is sufficient to initiate translation of the encoded protein. The inclusion of hairpin 105B (single or triple) at each end protects the mRNA from degradation by exonucleases. This provides a potential method for rapid generation of exogenous mRNA in one step, thereby saving time and reducing costs.

[0137] References

[0138] The following references, to the extent they provide exemplary procedural or other details supplementary to those set forth herein, are hereby expressly incorporated by reference in their entirety:

[0139] 1. Teijaro, JR, Farber, DL (2021). COVID-19 vaccines: modes of immune activation and future challenges. Nature Reviews Immunology 21, 195-197.10.1038 / s41577-021-00526-x.

[0140] 2. Wadhwa, A., Aljabbari, A., Lokras, A., Foged, C., Thakur, A. (2020). Opportunities and Challenges in the Delivery of mRNA-based Vaccines. Pharmaceutics 12.10.3390 / Pharmaceutics 12020102.

[0141] 3. Ramanathan, A., Robb, GB, Chan, SH (2016). mRNA capping: biological functions and applications. Nucleic Acids Research, 44, 7511-7526.10.1093 / nar / gkw551.

[0142] 4. Ghosh, A., Lima, CD (2010). Enzymology of RNA cap synthesis. Wiley Interdisciplinary Reviews-RNA 1, 152-172.10.1002 / wrna.19.

[0143] 5. Shuman, S. (2001). Structure, mechanism, and evolution of the mRNA capping apparatus. Progress in Nucleic Acids Research and Molecular Biology 66, 1-40.10.1016 / s0079-6603(00)66025-7.

[0144] 6. Shatkin, AJ (1976). Capping of eucaryotic mRNAs. Cell 9, 645-653. 10.1016 / 0092-8674(76)90128-8.

[0145] 7. Decroly, E., Ferron, F., Lescar, J., Canard, B. (2011). Conventional and unconventional mechanisms for capping viral mRNA. Nature Reviews Microbiology 10, 51-65.10.1038 / nrmicro2675.

[0146] 8. Galloway, A., Cowling, VH (2019). mRNA cap regulation in mammalian cell function and fate. Biochemistry and Biophysics Behavioral Gene Regulation Mechanisms 1862, 270-279.10.1016 / j.bbagrm.2018.09.011.

[0147] 9. Osborne, MJ, Borden, KL (2015). The eukaryotic translation initiation factor eIF4E in the nucleus: taking the road less traveled. Immunological Reviews 263, 210-223.10.1111 / imr.12240.

[0148] 10. Culjkovic, B., Topisirovic, I., Borden, KL (2007). Controlling gene expression through RNA regulons: the role of the eukaryotic translation initiation factor eIF4E. Cell Cycle 6, 65-69.10.4161 / cc.6.1.3688.

[0149] 11. Trepotec, Z., Geiger, J., Plank, C., Aneja, MK, Rudolph, C. (2019). Segmented poly(A) tails significantly reduce recombination of plasmid DNA without affecting mRNA translation efficiency or half-life. RNA 25, 507-518.10.1261 / rna.069286.118.

[0150] 12. Nicholson, AL, Pasquinelli, AE (2019). Tales of Detailed Poly(A) Tails. Trends in Cell Biology 29, 191-200.10.1016 / j.tcb.2018.11.002.

[0151] 13. Beverly, M., Hagen, C., Slack, O. (2018). Poly A tail length analysis of in vitro transcribed mRNA by LC-MS. Analytical Bioanalytical Chemistry 410, 1667-1677.10.1007 / s00216-017-0840-6.

[0152] 14. Mangus, DA, Evans, MC, Jacobson, A. (2003). Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression. Genome Biology 4, 223.10.1186 / gb-2003-4-7-223.

[0153] 15. Goldstrohm, AC, Wickens, M. (2008). Multifunctional deadenylase complexes diversify mRNA control. Nature Reviews Molecular Cell Biology 9, 337-344.10.1038 / nrm2370.

[0154] 16. Nelson, J., Sorensen, E. W., Mintri, S., Rabideau, A. E., Zheng, W., Besin, G., Khatwani, N., Su, S. V., Miracco, E. J., Issa, W. J., Hoge, S., et al. (2020). Impact of mRNA chemistry and manufacturing process on innate immune activation. Science Advances 6, eaaz6893.10.1126 / sciadv.aaz6893.

[0155] 17. Rosa, SS, Prazeres, DMF, Azevedo, AM, Marques, MPC (2021). mRNA vaccines manufacturing: Challenges and bottlenecks. Vaccine 39, 2190-2200.10.1016 / j.vaccine.2021.03.038.

[0156] 18. Copur, M. (2021). Messenger RNA vaccines: Beckoning of a New Era in Cancer Immunotherapy. Oncology (Williston Park) 35, 190-198.10.46883 / ONC.2021.3504.0198.

[0157] 19. Van Hoecke, L., Roose, K. (2019). How mRNA therapeutics are entering the monoclonal antibody field. Journal of Translational Medicine, 17, 54.10.1186 / s12967-019-1804-8.

[0158] 20. Contreras, R., Cheroutre, H., Degrave, W., Fiers, W. (1982). Simple, efficient in vitro synthesis of capped RNA useful for direct expression of cloned eukaryotic genes. Nucleic Acids Research, 10, 6353-6362. 10.1093 / nar / 10.20.6353.

[0159] 21. Konarska, MM, Padgett, RA, Sharp, PA (1984). Recognition of cap structure in splicing in vitro of mRNA precursors. Cell 38, 731-736.10.1016 / 0092-8674(84)90268-x.

[0160] 22. Pelletier, J., and Sonenberg, N. (1985). Insertion mutagenesis to increase secondary structure within the 5' noncoding region of a eukaryotic mRNA reduces translational efficiency. Cell 40, 515-526. 10.1016 / 0092-8674(85)90200-4.

[0161] 23. Nielsen, DA, Shapiro, DJ (1986). Preparation of capped RNA transcripts using T7 RNA polymerase. Nucleic Acids Research, 14, 5936.10.1093 / nar / 14.14.5936.

[0162] 24. Pasquinelli, AE, Dahlberg, JE, Lund, E. (1995). Reverse 5'caps in RNAs made in vitro by phage RNA polymerases. RNA 1, 957-967.

[0163] 25. Paterson, BM, Rosenberg, M. (1979). Efficient translation of prokaryotic mRNAs in a eukaryotic cell-free system requires addition of a cap structure. Nature 279, 692-696.10.1038 / 279692a0.

[0164] 26. Green, MR, Maniatis, T., Melton, DA (1983). Human beta-globin pre-mRNA synthesized in vitro is accurately spliced ​​in Xenopus oocyte nuclei. Cell 32, 681-694.10.1016 / 0092-8674(83)90054-5.

[0165] 27. Fuchs, AL, Neu, A., Sprangers, R. (2016). A general method for rapid and cost-efficient large-scale production of 5'capped RNA. RNA 22, 1454-1466.10.1261 / rna.056614.116.

[0166] 28. Ray, D., Shah, A., Tilgner, M., Guo, Y., Zhao, Y., Dong, H., Deas, TS, Zhou, Y., Li, H., Shi, PY (2006). West Nile virus 5'-cap structure is formed by sequential guanine N-7 and ribose 2'-O methylations by nonstructural protein 5. Journal of Virology 80, 8362-8370.10.1128 / JVI.00814-06.

[0167] 29. Preiss, T., Muckenthaler, M., Hentze, MW (1998). Poly(A)-tail-promoted translation in yeast: implications for translational control. RNA 4, 1321-1331.10.1017 / s1355838298980669.

[0168] 30. Grier, AE, Burleigh, S., Sahni, J., Clough, CA, Cardot, V., Choe, DC, Krutein, MC, Rawlings, DJ, Jensen, MC, Scharenberg, AM, Jacoby, K. (2016). pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A) Sequences. Molecular Therapeutic Nucleic Acids 5, e306.10.1038 / mtna.2016.21.

[0169] 31. Cao, GJ, Sarkar, N. (1992). Identification of the gene for an Escherichia coli poly(A) polymerase. Proceedings of the National Academy of Sciences of the United States of America 89, 10380-10384.10.1073 / pnas.89.21.10380.

[0170] 32. Martin, G., Keller, W. (1998). Tailing and 3'-end labeling of RNA with yeast poly(A)polymerase and various nucleotides. RNA 4, 226-230.

[0171] 33. Weissman, D. (2015). mRNA transcript therapy. Expert Review Vaccines, 14, 265-281. 10.1586 / 14760584.2015.973859.

[0172] 34. Jang, SK, Krausslich, HG, Nicklin, MJ, Duke, GM, Palmenberg, AC, Wimmer, E. (1988). A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. Journal of Virology, 62, 2636-2643.10.1128 / JVI.62.8.2636-2643.1988.

[0173] 35. Baird, SD, Turcotte, M., Korneluk, RG, Holcik, M. (2006). Searching for IRES. RNA 12, 1755-1785.10.1261 / rna.157806.

[0174] 36. Renaud-Gabardos, E., Hantelys, F., Morfoisse, F., Chaufour, X., Garmy-Susini, B., Prats, A.C. (2015). Internal ribosome entry site-based vectors for combined gene therapy. World Journal of Experimental Medicine 5, 11-20.10.5493 / wjem.v5.i1.11.

[0175] 37. van den Akker, GGH, Zacchini, F., Housmans, BAC, van der Vloet, L., Caron, MMJ, Montanaro, L., Welting, TJM (2021). Current Practice in Bicistronic IRES Reporter Use: A Systematic Review. International Journal of Molecular Sciences 22.10.3390 / ijms22105193.

[0176] 38. Pestova, TV, Hellen, CU, Shatsky, IN (1996). Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry. Mol Cell Biol 16, 6859-6869.10.1128 / MCB.16.12.6859.

[0177] 39. Emory, SA, Bouvet, P., Belasco, JG (1992). A 5'-terminal stem-loop structure can stabilize mRNA in Escherichia coli. Gene Development 6, 135-148.10.1101 / gad.6.1.135.

[0178] 40. Deutscher, MP (2006). Degradation of RNA in bacteria: comparison of mRNA and stable RNA. Nucleic Acids Research, 34, 659-666.10.1093 / nar / gkj472.

[0179] 41. Houseley, J., Tollervey, D. (2009). The many pathways of RNA degradation. Cell, 136, 763-776.10.1016 / j.cell.2009.01.019.

[0180] 42. Shirokikh, NE, Spirin, AS (2008). Poly(A) leader of eukaryotic mRNA bypasses the dependence of translation on initiation factors. Proceedings of the National Academy of Sciences of the United States of America, 105, 10738-10743. 10.1073 / pnas.0804940105.

[0181] 43. Wigington, CP, Williams, KR, Meers, MP, Bassell, GJ, Corbett, AH (2014). Poly(A) RNA-binding proteins and polyadenosine RNA: new members and novel functions. Wiley Interdisciplinary Reviews RNA 5, 601-622.10.1002 / wrna.1233.

[0182] 44. Tusup, M., French, LE, De Matos, M., Gatfield, D., Kundig, T., Pascolo, S. (2019). Design of in vitro Transcribed mRNA Vectors for Research and Therapy. Acta Chimica Sinica (Aarau), 73, 391-394.10.2533 / chimia.2019.391.

[0183] 45. Akiyama, BM, Eiler, D., Kieft, JS (2016). Structured RNAs that evade or confound exonucleases: function follows form. Current Opinion in Structural Biology 36, 40-47.10.1016 / j.sbi.2015.12.006.

[0184] 46. ​​Maruggi, G., Zhang, C., Li, J., Ulmer, J. B., Yu, D. (2019). mRNA as a Transformative Technology for Vaccine Development to Control Infectious Diseases. Molecular Therapy, 27, 757-772.10.1016 / j.ymthe.2019.01.020.

[0185] 47. Spriggs, KA, Bushell, M., Mitchell, SA, Willis, AE (2005). Internal ribosome entry segment-mediated translation during apoptosis: the role of IRES-trans-acting factors. Cell Death and Differentiation, 12, 585-591.10.1038 / sj.cdd.4401642.

[0186] 48. Komar, AA, Hatzoglou, M. (2011). Cellular IRES-mediated translation: the war of ITAFs inpathophysiological states. Cell Cycle, 10, 229-240.10.4161 / cc.10.2.14472.

[0187] 49. Lee, KM, Chen, CJ, Shih, SR (2017). Regulation Mechanisms of Viral IRES-Driven Translation. Trends in Microbiology, 25, 546-561.10.1016 / j.tim.2017.01.010.

[0188] 50. Bradrick, SS, Dobrikova, EY, Kaiser, C., Shveygert, M., Gromeier, M. (2007). Poly(A)-binding protein is differentially required for translation mediated by viral internal ribosome entry sites. RNA 13, 1582-1593.10.1261 / rna.556107.

[0189] 51. Wesselhoeft, RA, Kowalski, PS, Anderson, DG (2018). Engineering circular RNA for potent and stable translation in eukaryotic cells. Nature Communications, 9, 2629.10.1038 / s41467-018-05096-6.

[0190] 52. Chen, YG, Kim, MV, Chen, X., Batista, PJ, Aoyama, S., Wilusz, JE, Iwasaki, A., Chang, HY (2017). Sensing Self and Foreign Circular RNAs by Intron Identity. Molecular Cell, 67, 228-238e225.10.1016 / j.molcel.2017.05.022.

[0191] 53. Svoboda, P., Di Cara, A. (2006). Hairpin RNA: a secondary structure of primary importance. Cell and Molecular Life Sciences, 63, 901-908.10.1007 / s00018-005-5558-5.

[0192] 54. Unniraman, S., Chatterji, M., Nagaraja, V. (2002). A hairpin near the 5' end stabilises the DNA gyrasemRNA in Mycobacterium smegmatis. Nucleic Acids Research, 30, 5376-5381.10.1093 / nar / gkf697.

[0193] 55. Regnier, P., Arraiano, CM (2000). Degradation of mRNA in bacteria: emergence of ubiquitous features. Biopaper 22, 235-244.10.1002 / (SICI)1521-1878(200003)22:3<235::AID-BIES5>3.0.CO;2-2.

[0194] 56. Belasco, JG, Nilsson, G., von Gabain, A., Cohen, SN (1986). The stability of E. coli gene transcripts is dependent on determinants localized to specific mRNA segments. Cell 46, 245-251. 10.1016 / 0092-8674(86)90741-5.

[0195] 57. Hansen, MJ, Chen, LH, Fejzo, ML, Belasco, JG (1994). The ompA 5' untranslated region impedes a major pathway for mRNA degradation in Escherichia coli. Molecular Microbiology, 12, 707-716.10.1111 / j.1365-2958.1994.tb01058.x.

[0196] 58. Agaisse, H., Lereclus, D. (1996). STAB-SD: a Shine-Dalgarno sequence in the 5'untranslated region is a determinant of mRNA stability. Molecular Microbiology, 20, 633-643.10.1046 / j.1365-2958.1996.5401046.x.

[0197] 59. Marzluff, WF, Wagner, EJ, Duronio, RJ (2008). Metabolism and regulation of canonical histone mRNAs: life without a poly(A) tail. Nature Reviews Genetics 9, 843-854.10.1038 / nrg2438.

[0198] 60. Martinez-Salas, E., Francisco-Velilla, R., Fernandez-Chamorro, J., Embarek, A. M. (2017). Insights into Structural and Mechanistic Features of Viral IRES Elements. Frontiers in Microbiology 8, 2629.10.3389 / fmicb.2017.02629.

[0199] The embodiments described in the foregoing description do not represent all embodiments consistent with the subject matter described herein. On the contrary, they are only some examples consistent with the aspects related to the subject matter. Although some variations have been described in detail above, other modifications or additions are also possible. Specifically, in addition to the features and / or variations described herein, further features and / or variations may also be provided. For example, the above-mentioned embodiments may be directed to various combinations and sub-combinations of the disclosed features and / or combinations and sub-combinations of several further features disclosed above. In addition, the logical flows depicted in the accompanying drawings and / or described herein do not necessarily require the specific order or continuous order shown to achieve the desired results. It is easy for those skilled in the art to understand that, without departing from the principle and scope of the subject matter of the present invention, various other changes may be made to the details, materials and arrangements of the components and method stages described and illustrated for explaining the nature of the subject matter of the present invention.

[0200] A biologically functional polynucleotide comprising

[0201] an mRNA transcript having a first end and a second end,

[0202] wherein the first terminal hairpin is located at the first end of the mRNA transcript,

[0203] wherein the second terminal hairpin is located at the second end of the mRNA transcript,

[0204] wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and

[0205] wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides.

[0206] A biologically functional polynucleotide comprising

[0207] a chemically synthesized mRNA molecule having a first end and a second end,

[0208] wherein the first terminal hairpin is located at the first end of the chemically synthesized mRNA molecule,

[0209] wherein the second terminal hairpin is located at the second end of the chemically synthesized mRNA molecule,

[0210] wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and

[0211] wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides.

[0212] A biologically functional polynucleotide comprising

[0213] An mRNA transcript with a 5' end and a 3' end,

[0214] wherein the first terminal hairpin is located at the 3' end of the mRNA transcript,

[0215] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing,

[0216] wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides, and

[0217] A cap is operably linked to the 5' end of the mRNA transcript.

[0218] A biologically functional polynucleotide comprising

[0219] A chemically synthesized mRNA molecule having a 5' end and a 3' end,

[0220] wherein the first terminal hairpin is located at the 3' end of the chemically synthesized mRNA molecule,

[0221] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing,

[0222] wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides, and

[0223] A cap operably linked to the 5' end of the chemically synthesized mRNA molecule.

[0224] A biologically functional polynucleotide comprising

[0225] An mRNA transcript with a 5' end and a 3' end,

[0226] wherein the first terminal hairpin is located at the 5' end of the mRNA transcript,

[0227] wherein the poly(A) tail sequence is located at the 3' end of the mRNA transcript,

[0228] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, and

[0229] wherein the first terminal hairpin is connected to the 5' end by no more than two unpaired nucleotides.

[0230] A biologically functional polynucleotide comprising

[0231] A chemically synthesized mRNA molecule having a 5' end and a 3' end,

[0232] wherein the first terminal hairpin is located at the 5' end of the chemically synthesized mRNA molecule,

[0233] wherein the poly(A) tail sequence is located at the 3' end of the chemically synthesized mRNA molecule,

[0234] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, and

[0235] wherein the first terminal hairpin is connected to the 5' end by no more than two unpaired nucleotides.

[0236] A DNA template configured to encode a target RNA transcript, comprising

[0237] a DNA source configured to create a target mRNA transcript,

[0238] wherein the target mRNA transcript comprises a first end and a second end,

[0239] wherein the first terminal hairpin is located at the first end of the mRNA transcript,

[0240] wherein the second terminal hairpin is located at the second end of the mRNA transcript,

[0241] wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and

[0242] wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides.

[0243] A DNA template configured to encode a target RNA transcript, comprising

[0244] a DNA source configured to create a target mRNA transcript,

[0245] wherein the target mRNA transcript comprises a first end and a second end,

[0246] wherein the first terminal hairpin is located at the first end of the mRNA transcript,

[0247] wherein the poly(A) tail is located at the second end of the mRNA transcript,

[0248] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, and

[0249] wherein the first terminal hairpin is connected to the first end by no more than two unpaired nucleotides.

[0250] A DNA template configured to encode a target RNA transcript, comprising

[0251] a DNA source configured to create a target mRNA transcript,

[0252] wherein the target mRNA transcript comprises a 5' end and a 3' end,

[0253] wherein the first terminal hairpin is located at the 3' end of the mRNA transcript,

[0254] wherein the cap is located at the 5' end of the mRNA transcript,

[0255] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, and

[0256] wherein the first terminal hairpin is connected to the first end by no more than two unpaired nucleotides.

[0257] A method for creating a biologically functional polynucleotide comprising the following steps:

[0258] generating a target mRNA vector having an mRNA transcript having a first end and a second end,

[0259] wherein the first terminal hairpin is located at the first end of the mRNA transcript,

[0260] wherein the second terminal hairpin is located at the second end of the mRNA transcript,

[0261] wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and

[0262] wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides,

[0263] wherein the target mRNA vector has one of an mRNA transcript and a chemically synthesized mRNA molecule,

[0264] inserting the target mRNA vector into a DNA source to create a DNA template,

[0265] Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and

[0266] The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

[0267] A method for creating a biologically functional polynucleotide comprising the following steps:

[0268] generating a target mRNA vector having a chemically synthesized mRNA molecule having a first end and a second end,

[0269] wherein a first terminal hairpin is located at a first end of the chemically synthesized mRNA molecule, wherein a second terminal hairpin is located at a second end of the chemically synthesized mRNA molecule, wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and

[0270] wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides,

[0271] The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

[0272] A method for creating a biologically functional polynucleotide comprising the following steps:

[0273] generating a target mRNA vector having an mRNA transcript having a 5' end and a 3' end,

[0274] wherein the first terminal hairpin is located at the 3' end of the mRNA transcript,

[0275] wherein the cap is located at the 5' end of the mRNA transcript,

[0276] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing,

[0277] wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides,

[0278] inserting the target mRNA vector into a DNA source to create a DNA template,

[0279] Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and

[0280] The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

[0281] A method for creating a biologically functional polynucleotide comprising the following steps:

[0282] generating a target mRNA vector having an mRNA transcript having a 5' end and a 3' end,

[0283] wherein the first terminal hairpin is located at the 5' end of the mRNA transcript,

[0284] wherein the poly(A) tail is located at the 3' end of the mRNA transcript,

[0285] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing,

[0286] wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides,

[0287] inserting the target mRNA vector into a DNA source to create a DNA template,

[0288] Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and

[0289] The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

[0290] A method for creating a biologically functional polynucleotide comprising the following steps:

[0291] generating a target mRNA vector having a chemically synthesized mRNA molecule having a 5' end and a 3' end,

[0292] wherein the first terminal hairpin is located at the 3' end of the mRNA transcript,

[0293] wherein the cap is located at the 5' end of the mRNA transcript,

[0294] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing,

[0295] wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides,

[0296] using the target mRNA vector to obtain a target mRNA vector product, and

[0297] The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

[0298] A method for creating a biologically functional polynucleotide comprising the following steps:

[0299] generating a target mRNA vector having a chemically synthesized mRNA molecule having a 5' end and a 3' end,

[0300] wherein the first terminal hairpin is located at the 5' end of the mRNA transcript,

[0301] wherein the poly(A) tail is located at the 3' end of the mRNA transcript,

[0302] wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing,

[0303] wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides,

[0304] using the target mRNA vector to obtain a target mRNA vector product, and

[0305] The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

[0306] A product for use as a therapeutic agent, wherein the product is prepared by:

[0307] Insert the target mRNA vector sequence into a DNA source to create a DNA template,

[0308] wherein the target mRNA vector sequence encodes a first terminal hairpin located at a first end of the target mRNA vector and a second terminal hairpin located at a second end of the target mRNA vector, wherein an internal translation start site is incorporated into the target mRNA vector,

[0309] Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and

[0310] purifying the target mRNA vector product to produce a therapeutic agent,

[0311] wherein the therapeutic agent is the product.

[0312] A product for use as a therapeutic agent, wherein the product is prepared by:

[0313] Insert the target mRNA vector sequence into a DNA source to create a DNA template,

[0314] wherein the target mRNA vector sequence encodes a first terminal hairpin at the 5' end of the target mRNA vector and a poly(A) tail at the 3' end of the target mRNA vector,

[0315] wherein an internal translation start site is incorporated into the target mRNA vector,

[0316] purifying the target mRNA vector product to produce a therapeutic agent,

[0317] wherein the therapeutic agent is the product.

[0318] A product for use as a therapeutic agent, wherein the product is prepared by:

[0319] Insert the target mRNA vector sequence into a DNA source to create a DNA template,

[0320] wherein the target mRNA vector sequence encodes a first terminal hairpin on the 3' end of the target mRNA vector and a cap at the 5' end of the target mRNA vector,

[0321] wherein an internal translation start site is incorporated into the target mRNA vector,

[0322] Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and

[0323] Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and

[0324] purifying the target mRNA vector product to produce a therapeutic agent,

[0325] wherein the therapeutic agent is the product.

[0326] A product for use as a therapeutic agent, wherein the product is prepared by:

[0327] chemically synthesizing an mRNA vector having a target mRNA vector sequence to create a chemically synthesized mRNA molecule,

[0328] The mRNA vector has a first end and a second end,

[0329] wherein the target mRNA vector sequence encodes a first terminal hairpin located at a first end of the target mRNA vector and a second terminal hairpin located at a second end of the target mRNA vector, wherein an internal translation start site is incorporated into the chemically synthesized mRNA molecule,

[0330] The chemically synthesized mRNA molecule is transcribed to obtain a target mRNA vector product,

[0331] purifying the target mRNA vector product to produce a therapeutic agent,

[0332] wherein the therapeutic agent is the product.

[0333] A product for use as a therapeutic agent, wherein the product is prepared by:

[0334] chemically synthesizing an mRNA vector having a target mRNA vector sequence to create a chemically synthesized mRNA molecule,

[0335] wherein the target mRNA vector sequence encodes the first terminal hairpin at the 5' end of the target mRNA vector and the poly(A) tail at the 3' end of the target mRNA vector,

[0336] wherein an internal translation start site is incorporated into said chemically synthesized mRNA molecule,

[0337] The chemically synthesized mRNA molecule is transcribed to obtain a target mRNA vector product,

[0338] purifying the target mRNA vector product to produce a therapeutic agent,

[0339] wherein the therapeutic agent is the product.

[0340] A product for use as a therapeutic agent, wherein the product is prepared by:

[0341] chemically synthesizing an mRNA vector having a target mRNA vector sequence to create a chemically synthesized mRNA molecule,

[0342] wherein the target mRNA vector sequence encodes the first terminal hairpin at the 3' end of the target mRNA vector and the cap at the 5' end of the target mRNA vector,

[0343] wherein an internal translation start site is incorporated into the chemically synthesized mRNA molecule, the chemically synthesized mRNA molecule is transcribed to obtain a target mRNA vector product, and the target mRNA vector product is purified to produce a therapeutic agent,

[0344] wherein the therapeutic agent is the product.

Claims

1. A biologically functional polynucleotide comprising an mRNA transcript having a first end and a second end, wherein the first terminal hairpin is located at the first end of the mRNA transcript, wherein the second terminal hairpin is located at the second end of the mRNA transcript, wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides.

2. The biologically functional polynucleotide according to claim 1, further comprising a cap at the 5' end, wherein the 5' end is one of the first end or the second end. 3 . The biologically functional polynucleotide according to claim 1 , further comprising a poly(A) tail located at the 3′ end, wherein the 3′ end is one of the first end or the second end. 4 . The biologically functional polynucleotide according to claim 1 , further comprising a cap located at the first end and a poly(A) tail located at the second end, wherein the first end is the 5′ end and the second end is the 3′ end.

5. The biologically functional polynucleotide according to claim 1, wherein the first terminal hairpin and the second terminal hairpin are one of a triple hairpin, a double hairpin and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

6. The biologically functional polynucleotide of claim 1, further comprising an internal translation start site incorporated into the mRNA transcript.

7. The biologically functional polynucleotide according to claim 6, wherein the internal translation start site is an internal ribosome entry site (IRES).

8. The biologically functional polynucleotide of claim 7, further comprising a delivery gene sequence incorporated into the mRNA transcript.

9. The biologically functional polynucleotide of claim 8, wherein the internal translation start site is incorporated into the mRNA transcript at a position upstream of the delivery gene sequence of the mRNA transcript.

10. The biologically functional polynucleotide of claim 9, wherein the internal translation start site is incorporated into the mRNA transcript at the 5' untranslated region 5'UTR of the mRNA transcript.

11. The biologically functional polynucleotide according to claim 1, further comprising a DNA source, wherein a nucleotide sequence containing instructions for said mRNA transcript is inserted into said DNA source to create a DNA template, wherein the DNA template is configured to encode an RNA transcript comprising the mRNA transcript.

12. The biologically functional polynucleotide according to claim 11, wherein the DNA source is one of plasmid DNA, genomic DNA, synthetic DNA and PCR product.

13. A biologically functional polynucleotide comprising a chemically synthesized mRNA molecule having a first end and a second end, wherein the first terminal hairpin is located at the first end of the chemically synthesized mRNA molecule, wherein the second terminal hairpin is located at the second end of the chemically synthesized mRNA molecule, wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides.

14. The biologically functional polynucleotide according to claim 13, further comprising a cap at the 5' end, wherein the 5' end is one of the first end or the second end. 15 . The biologically functional polynucleotide according to claim 13 , further comprising a poly(A) tail at the 3′ end, wherein the 3′ end is one of the first end or the second end. 16 . The biologically functional polynucleotide according to claim 13 , further comprising a cap located at the first end and a poly(A) tail located at the second end, wherein the first end is the 5′ end and the second end is the 3′ end.

17. The biologically functional polynucleotide of claim 13, wherein the first terminal hairpin and the second terminal hairpin are one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin include no more than two unpaired nucleotides between each hairpin.

18. The biologically functional polynucleotide of claim 13, further comprising an internal translation start site incorporated into the chemically synthesized mRNA molecule.

19. The biologically functional polynucleotide according to claim 18, wherein the internal translation start site is an internal ribosome entry site (IRES).

20. The biologically functional polynucleotide of claim 19, further comprising a delivery gene sequence incorporated into the chemically synthesized mRNA molecule.

21. The biologically functional polynucleotide according to claim 20, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at a position upstream of the delivery gene sequence of the chemically synthesized mRNA molecule.

22. The biologically functional polynucleotide according to claim 21, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at the 5' untranslated region 5'UTR of the chemically synthesized mRNA molecule.

23. A biologically functional polynucleotide comprising An mRNA transcript with a 5' end and a 3' end, wherein the first terminal hairpin is located at the 3' end of the mRNA transcript, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides, and A cap is operably linked to the 5' end of the mRNA transcript.

24. The biologically functional polynucleotide according to claim 23, further comprising a poly(A) tail at the 3' end.

25. The biologically functional polynucleotide of claim 23, wherein the first terminal hairpin is one of a triple hairpin, a double hairpin and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

26. The biologically functional polynucleotide of claim 23, further comprising an internal translation start site incorporated into the mRNA transcript.

27. The biologically functional polynucleotide of claim 26, wherein the internal translation start site is an internal ribosome entry site (IRES).

28. The biologically functional polynucleotide of claim 27, further comprising a delivery gene sequence incorporated into the mRNA transcript.

29. The biologically functional polynucleotide of claim 28, wherein the internal translation start site is incorporated into the mRNA transcript at a position upstream of the delivery gene sequence of the mRNA transcript.

30. The biologically functional polynucleotide of claim 29, wherein the internal translation start site is incorporated into the mRNA transcript at the 5' untranslated region 5'UTR of the mRNA transcript.

31. The biologically functional polynucleotide of claim 23, further comprising a DNA source, wherein a nucleotide sequence containing instructions for said mRNA transcript is inserted into said DNA source to create a DNA template, wherein the DNA template is configured to encode an RNA transcript comprising the mRNA transcript.

32. The biologically functional polynucleotide of claim 31, wherein the DNA source is one of plasmid DNA, genomic DNA, synthetic DNA, and PCR product.

33. A biologically functional polynucleotide comprising A chemically synthesized mRNA molecule having a 5' end and a 3' end, wherein the first terminal hairpin is located at the 3' end of the chemically synthesized mRNA molecule, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides, and A cap operably linked to the 5' end of the chemically synthesized mRNA molecule.

34. The biologically functional polynucleotide according to claim 33, further comprising a poly(A) tail at the 3' end.

35. The biologically functional polynucleotide of claim 33, wherein the first terminal hairpin is one of a triple hairpin, a double hairpin and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

36. The biologically functional polynucleotide of claim 33, further comprising an internal translation start site incorporated into the chemically synthesized mRNA molecule.

37. The biologically functional polynucleotide of claim 36, wherein the internal translation start site is an internal ribosome entry site (IRES).

38. The biologically functional polynucleotide of claim 37, further comprising a delivery gene sequence incorporated into the chemically synthesized mRNA molecule.

39. The biologically functional polynucleotide of claim 38, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at an upstream position of the delivery gene sequence of the chemically synthesized mRNA molecule.

40. The biologically functional polynucleotide of claim 39, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at the 5' untranslated region 5'UTR of the chemically synthesized mRNA molecule.

41. A biologically functional polynucleotide comprising An mRNA transcript with a 5' end and a 3' end, wherein the first terminal hairpin is located at the 5' end of the mRNA transcript, wherein the poly(A) tail sequence is located at the 3' end of the mRNA transcript, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, and wherein the first terminal hairpin is connected to the 5' end by no more than two unpaired nucleotides.

42. The biologically functional polynucleotide of claim 41, wherein a poly(A) tail is added to the 3' end of the mRNA transcript using a poly(A) polymerase.

43. The biologically functional polynucleotide of claim 41, wherein the first terminal hairpin is one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

44. The biologically functional polynucleotide of claim 41, further comprising an internal translation start site incorporated into the mRNA transcript.

45. The biologically functional polynucleotide of claim 44, wherein the internal translation start site is an internal ribosome entry site (IRES).

46. ​​The biologically functional polynucleotide of claim 45, further comprising a delivery gene sequence incorporated into the mRNA transcript.

47. The biologically functional polynucleotide of claim 46, wherein the internal translation start site is incorporated into the mRNA transcript at a position upstream of the delivery gene sequence of the mRNA transcript.

48. The biologically functional polynucleotide of claim 47, wherein the internal translation start site is incorporated into the mRNA transcript at the 5' untranslated region 5'UTR of the mRNA transcript.

49. The biologically functional polynucleotide of claim 41, further comprising a DNA source, wherein a nucleotide sequence containing instructions for said mRNA transcript is inserted into said DNA source to create a DNA template, wherein the DNA template is configured to encode an RNA transcript comprising the mRNA transcript.

50. The biologically functional polynucleotide of claim 49, wherein the DNA source is one of plasmid DNA, genomic DNA, synthetic DNA, and a PCR product.

51. A biologically functional polynucleotide comprising A chemically synthesized mRNA molecule having a 5' end and a 3' end, wherein the first terminal hairpin is located at the 5' end of the chemically synthesized mRNA molecule, wherein the poly(A) tail sequence is located at the 3' end of the chemically synthesized mRNA molecule, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, and wherein the first terminal hairpin is connected to the 5' end by no more than two unpaired nucleotides.

52. The biologically functional polynucleotide of claim 51, wherein a poly(A) tail is added to the 3' end of the chemically synthesized mRNA molecule using a poly(A) polymerase.

53. The biologically functional polynucleotide of claim 51, wherein the first terminal hairpin is one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

54. The biologically functional polynucleotide of claim 51, further comprising an internal translation start site incorporated into the chemically synthesized mRNA molecule.

55. The biologically functional polynucleotide of claim 54, wherein the internal translation start site is an internal ribosome entry site (IRES).

56. The biologically functional polynucleotide of claim 55, further comprising a delivery gene sequence incorporated into the chemically synthesized mRNA molecule.

57. The biologically functional polynucleotide of claim 56, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at an upstream position of the delivery gene sequence of the chemically synthesized mRNA molecule.

58. The biologically functional polynucleotide of claim 57, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at the 5' untranslated region 5'UTR of the chemically synthesized mRNA molecule.

59. A DNA template configured to encode a target RNA transcript, comprising a DNA source configured to create a target mRNA transcript, wherein the target mRNA transcript comprises a first end and a second end, wherein the first terminal hairpin is located at the first end of the target mRNA transcript, wherein the second terminal hairpin is located at the second end of the target mRNA transcript, wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides.

60. The DNA template of claim 59, wherein the first terminal hairpin and the second terminal hairpin are one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

61. The DNA template of claim 59, wherein an internal translation start site is incorporated into the target mRNA transcript.

62. The DNA template of claim 61, wherein the internal translation start site is an internal ribosome entry site (IRES).

63. The DNA template of claim 62, further comprising a delivery gene sequence incorporated into the target mRNA transcript.

64. The DNA template of claim 63, wherein the internal translation start site is incorporated into the target mRNA transcript upstream of the delivery gene sequence of the target mRNA transcript.

65. The DNA template of claim 64, wherein the internal translation start site is incorporated into the target mRNA transcript at the 5' untranslated region 5'UTR of the target mRNA transcript.

66. The DNA template of claim 59, wherein the DNA source is one of plasmid DNA, genomic DNA, synthetic DNA, and a PCR product.

67. A DNA template configured to encode a target RNA transcript, comprising a DNA source configured to create a target mRNA transcript, wherein the target mRNA transcript comprises a first end and a second end, wherein the first terminal hairpin is located at the first end of the target mRNA transcript, wherein the poly(A) tail is located at the second end of the target mRNA transcript, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, and wherein the first terminal hairpin is connected to the first end by no more than two unpaired nucleotides.

68. The DNA template of claim 67, wherein the first terminal hairpin is one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

69. The DNA template of claim 67, wherein an internal translation start site is incorporated into the target mRNA transcript.

70. The DNA template of claim 69, wherein the internal translation start site is an internal ribosome entry site (IRES).

71. The DNA template of claim 70, further comprising a delivery gene sequence incorporated into the target mRNA transcript.

72. The DNA template of claim 71, wherein the internal translation start site is incorporated into the target mRNA transcript upstream of the delivery gene sequence of the target mRNA transcript.

73. The DNA template of claim 72, wherein the internal translation start site is incorporated into the target mRNA transcript at the 5' untranslated region 5'UTR of the target mRNA transcript.

74. The DNA template of claim 67, wherein the DNA source is one of plasmid DNA, genomic DNA, synthetic DNA, and a PCR product.

75. A DNA template configured to encode a target RNA transcript comprising a DNA source configured to create a target mRNA transcript, wherein the target mRNA transcript comprises a 5' end and a 3' end, wherein the first terminal hairpin is located at the 3' end of the target mRNA transcript, wherein the cap is located at the 5' end of the target mRNA transcript, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, and wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides.

76. A method for creating a biologically functional polynucleotide comprising the steps of: generating a target mRNA vector having an mRNA transcript having a first end and a second end, wherein the first terminal hairpin is located at the first end of the mRNA transcript, wherein the second terminal hairpin is located at the second end of the mRNA transcript, wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides, wherein the target mRNA vector has one of an mRNA transcript and a chemically synthesized mRNA molecule, inserting the target mRNA vector into a DNA source to create a DNA template, Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

77. The method of claim 76, wherein a cap is attached to the mRNA transcript at the 5' end, wherein the 5' end is one of the first end or the second end.

78. The method of claim 76, wherein the poly(A) tail is attached to a 3' end, wherein the 3' end is one of the first end or the second end.

79. The method of claim 76, wherein a cap is attached to the first end and a poly(A) tail is attached to the second end, wherein the first end is the 5' end and the second end is the 3' end.

80. The method of claim 76, wherein the first end hairpin and the second end hairpin are one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

81. The method of claim 76, further comprising a delivery gene sequence incorporated into the mRNA transcript.

82. The method of claim 81, wherein an internal translation start site of the target mRNA vector is incorporated into the mRNA transcript.

83. The method of claim 82, wherein the internal translation start site is an internal ribosome entry site (IRES).

84. The method of claim 82, wherein the internal translation start site is incorporated into the mRNA transcript at a position upstream of the delivery gene sequence of the mRNA transcript.

85. The method of claim 84, wherein the internal translation start site is incorporated into the mRNA transcript at the 5' untranslated region 5'UTR of the mRNA transcript.

86. The method of claim 76, wherein the DNA source is one of plasmid DNA, genomic DNA, synthetic DNA, and a PCR product.

87. A method for creating a biologically functional polynucleotide comprising the steps of: generating a target mRNA vector having a chemically synthesized mRNA molecule having a first end and a second end, wherein the first terminal hairpin is located at the first end of the chemically synthesized mRNA molecule, wherein the second terminal hairpin is located at the second end of the chemically synthesized mRNA molecule, wherein the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold onto themselves through nucleotide pairing, and wherein the first terminal hairpin and the second terminal hairpin are connected to the first end and the second end by no more than two unpaired nucleotides, The target mRNA vector is purified to produce therapeutic exogenous mRNA.

88. The method of claim 87, wherein a cap is attached to the chemically synthesized mRNA molecule at the 5' end, wherein the 5' end is one of the first end or the second end.

89. The method of claim 87, wherein the first end hairpin and the second end hairpin are one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

90. The method of claim 87, further comprising a delivery gene sequence incorporated into the chemically synthesized mRNA molecule.

91. The method of claim 90, wherein an internal translation start site of the target mRNA carrier is incorporated into the chemically synthesized mRNA molecule.

92. The method of claim 91, wherein the internal translation start site is an internal ribosome entry site (IRES).

93. The method of claim 91, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at an upstream position of the delivery gene sequence of the chemically synthesized mRNA molecule.

94. The method of claim 93, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at the 5' untranslated region 5'UTR of the chemically synthesized mRNA molecule.

95. A method for creating a biologically functional polynucleotide comprising the steps of: generating a target mRNA vector having an mRNA transcript having a 5' end and a 3' end, wherein the first terminal hairpin is located at the 3' end of the mRNA transcript, wherein the cap is located at the 5' end of the mRNA transcript, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides, inserting the target mRNA vector into a DNA source to create a DNA template, Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

96. The method of claim 95, further comprising a poly(A) tail at the 3' end.

97. The method of claim 95, wherein the first terminal hairpin is one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

98. The method of claim 95, further comprising incorporating an internal translation start site into the mRNA transcript.

99. The method of claim 98, wherein the internal translation start site is an internal ribosome entry site (IRES).

100. The method of claim 95, further comprising a delivery gene sequence incorporated into the mRNA transcript.

101. The method of claim 100, wherein an internal translation start site is incorporated into the mRNA transcript at a position upstream of the delivery gene sequence of the mRNA transcript.

102. The method of claim 101, wherein the internal translation start site is incorporated into the mRNA transcript at the 5' untranslated region 5'UTR of the mRNA transcript.

103. The method of claim 95, wherein the DNA source is one of plasmid DNA, genomic DNA, synthetic DNA, and a PCR product.

104. A method for creating a biologically functional polynucleotide comprising the steps of: generating a target mRNA vector having an mRNA transcript having a 5' end and a 3' end, wherein the first terminal hairpin is located at the 5' end of the mRNA transcript, wherein the poly(A) tail is located at the 3' end of the mRNA transcript, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides, inserting the target mRNA vector into a DNA source to create a DNA template, Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

105. The method of claim 104, wherein the first terminal hairpin is one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

106. The method of claim 104, further comprising incorporating an internal translation start site into the mRNA transcript.

107. The method of claim 106, wherein the internal translation start site is an internal ribosome entry site (IRES).

108. The method of claim 107, further comprising a delivery gene sequence incorporated into the mRNA transcript.

109. The method of claim 108, wherein the internal translation start site is incorporated into the mRNA transcript at a position upstream of the delivery gene sequence of the mRNA transcript.

110. The method of claim 109, wherein the internal translation start site is incorporated into the mRNA transcript at the 5' untranslated region 5'UTR of the mRNA transcript.

111. The method of claim 104, wherein the DNA source is one of plasmid DNA, genomic DNA, synthetic DNA, and a PCR product.

112. A method for creating a biologically functional polynucleotide comprising the steps of: generating a target mRNA vector having a chemically synthesized mRNA molecule having a 5' end and a 3' end, wherein the first terminal hairpin is located at the 3' end of the chemically synthesized mRNA molecule, wherein the cap is located at the 5' end of the chemically synthesized mRNA molecule, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides, using the target mRNA vector to obtain a target mRNA vector product, and The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

113. The method of claim 112, further comprising a poly(A) tail at the 3' end.

114. The method of claim 112, wherein the first terminal hairpin is one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

115. The method of claim 112, further comprising incorporating an internal translation start site into the chemically synthesized mRNA molecule.

116. The method of claim 115, wherein the internal translation start site is an internal ribosome entry site (IRES).

117. The method of claim 115, further comprising a delivery gene sequence incorporated into the chemically synthesized mRNA molecule.

118. The method of claim 117, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at an upstream position of the delivered gene sequence of the chemically synthesized mRNA molecule.

119. The method of claim 118, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at the 5' untranslated region 5'UTR of the chemically synthesized mRNA molecule.

120. A method for creating a biologically functional polynucleotide comprising the steps of: generating a target mRNA vector having a chemically synthesized mRNA molecule having a 5' end and a 3' end, wherein the first terminal hairpin is located at the 5' end of the chemically synthesized mRNA molecule, wherein the poly(A) tail is located at the 3' end of the chemically synthesized mRNA molecule, wherein the first terminal hairpin is a nucleotide sequence configured to stably fold onto itself through nucleotide pairing, wherein the first terminal hairpin is connected to the 3' end by no more than two unpaired nucleotides, using the target mRNA vector to obtain a target mRNA vector product, and The target mRNA vector product is purified to produce therapeutic exogenous mRNA.

121. The method of claim 120, wherein the first terminal hairpin is one of a triple hairpin, a double hairpin, and a single hairpin, wherein the double hairpin and the triple hairpin comprise no more than two unpaired nucleotides between each hairpin.

122. The method of claim 120, further comprising incorporating an internal translation start site into the chemically synthesized mRNA molecule.

123. The method of claim 122, wherein the internal translation start site is an internal ribosome entry site (IRES).

124. The method of claim 122, further comprising a delivery gene sequence incorporated into the chemically synthesized mRNA molecule.

125. The method of claim 124, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at an upstream position of the delivery gene sequence of the chemically synthesized mRNA molecule.

126. The method of claim 125, wherein the internal translation start site is incorporated into the chemically synthesized mRNA molecule at the 5' untranslated region 5'UTR of the chemically synthesized mRNA molecule.

127. A product for use as a therapeutic agent, wherein the product is prepared by: Insert the target mRNA vector sequence into a DNA source to create a DNA template, wherein the target mRNA vector sequence encodes a first terminal hairpin located at the first end of the target mRNA vector and a second terminal hairpin located at the second end of the target mRNA vector, wherein an internal translation start site is incorporated into the target mRNA vector, Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and purifying the target mRNA vector product to produce a therapeutic agent, wherein the therapeutic agent is the product.

128. A product for use as a therapeutic agent, wherein the product is prepared by: Insert the target mRNA vector sequence into a DNA source to create a DNA template, wherein the target mRNA vector sequence encodes a first terminal hairpin on the 5' end of the target mRNA vector and a poly(A) tail at the 3' end of the target mRNA vector, wherein an internal translation start site is incorporated into the target mRNA vector, Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and purifying the target mRNA vector product to produce a therapeutic agent, wherein the therapeutic agent is the product.

129. A product for use as a therapeutic agent, wherein the product is prepared by: Insert the target mRNA vector sequence into a DNA source to create a DNA template, wherein the target mRNA vector sequence encodes a first terminal hairpin on the 3' end of the target mRNA vector and a cap at the 5' end of the target mRNA vector, wherein an internal translation start site is incorporated into the target mRNA vector, Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and Using a DNA-dependent RNA polymerase to perform in vitro transcription on the DNA template to obtain a target mRNA vector product, and purifying the target mRNA vector product to produce a therapeutic agent, wherein the therapeutic agent is the product.

130. A product for use as a therapeutic agent, wherein the product is prepared by: chemically synthesizing an mRNA vector having a target mRNA vector sequence to create a chemically synthesized mRNA molecule, The mRNA vector has a first end and a second end, wherein the target mRNA vector sequence encodes a first terminal hairpin on the first end of the target mRNA vector and a second terminal hairpin on the second end of the target mRNA vector, wherein an internal translation start site is incorporated into said chemically synthesized mRNA molecule, The chemically synthesized mRNA molecule is transcribed to obtain a target mRNA vector product, purifying the target mRNA vector product to produce a therapeutic agent, wherein the therapeutic agent is the product.

131. A product for use as a therapeutic agent, wherein the product is prepared by: chemically synthesizing an mRNA vector having a target mRNA vector sequence to create a chemically synthesized mRNA molecule, wherein the target mRNA vector sequence encodes a first terminal hairpin at the 5' end of the target mRNA vector and a poly(A) tail at the 3' end of the target mRNA vector, wherein an internal translation start site is incorporated into said chemically synthesized mRNA molecule, The chemically synthesized mRNA molecule is transcribed to obtain a target mRNA vector product, purifying the target mRNA vector product to produce a therapeutic agent, wherein the therapeutic agent is the product.

132. A product for use as a therapeutic agent, wherein the product is prepared by: chemically synthesizing an mRNA vector having a target mRNA vector sequence to create a chemically synthesized mRNA molecule, wherein the target mRNA vector sequence encodes a first terminal hairpin at the 3' end of the target mRNA vector and a cap at the 5' end of the target mRNA vector, wherein an internal translation start site is incorporated into said chemically synthesized mRNA molecule, The chemically synthesized mRNA molecule is transcribed to obtain a target mRNA vector product, purifying the target mRNA vector product to produce a therapeutic agent, wherein the therapeutic agent is the product.

Images