Application of p85 alpha truncated expression construct in prevention of UVB-induced skin light injury

Abstract

The invention relates to application of a p85alpha truncated expression construct in prevention of UVB-induced skin light injury, and provides nucleic acid for coding the truncated expression construct, a recombinant vector, a recombinant host cell and a primer group for amplifying the nucleic acid. The invention discloses a p85 alpha truncated expression construct which can antagonize UVB-induced PERK-p53-PERP pathway activation and cell apoptosis promotion effects. The mutant and derivatives thereof have application values in prevention of UVB-induced skin light injury reaction and preparation of products for prevention of UVB-induced skin light injury.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to the application of a p85α truncated expression construct in preventing UVB-induced skin photodamage. Background Art

[0002] Solar radiation is an important environmental risk factor that induces human skin damage, among which ultraviolet (UV) radiation is most closely related to photodamage. UV can be divided into long-wave ultraviolet (Ultraviolet A, UVA, 320-400nm), medium-wave ultraviolet (Ultraviolet B, UVB, 280-320 nm) and short-wave ultraviolet (Ultraviolet C, UVC, 100-280 nm), and their effects on inducing skin photodamage reactions increase in sequence. Since UVB has a shorter wavelength and stronger biological effects, its radiation stimulates the production of reactive oxygen species (ROS), causing oxidative stress and inflammatory reactions in the skin, leading to tissue damage. Studies have shown that UVB can destroy the structure and function of proteins, lipids and nucleic acids, thereby causing pathological damage reactions such as skin burns, blistering, dermatitis and even skin cancer. Therefore, the prevention and control strategies, technologies and drug research on UVB-induced photodamage effects have always attracted much attention.

[0003] In order to prevent and control skin photodamage caused by UVB radiation, the use of photochemical protectants to interfere with skin photodamage has become a research hotspot. In the process of inducing p53 activation and promoting cell apoptosis, UVB can induce binding reaction with endoplasmic reticulum (ER) stress-sensing protein PERK (protein kinase R-like ER kinase), further activating the PERK-p53-PERP signaling pathway, and ultimately mediating the apoptosis effect of skin keratinocytes and stromal cells (Lun Song et al., 2021). Therefore, it is of great significance to deeply study the mechanism of skin photodamage and develop more effective anti-photodamage products.

[0004] In view of this, the present invention designs a truncated expression construct, which can antagonize UVB-induced PERK-p53-PERP pathway activation and pro-apoptotic effects, and thus has potential application value in preventing UVB-induced skin photodamage response. Summary of the invention

[0005] In order to make up for the deficiencies of the prior art, the present invention proposes the following technical solutions: In a first aspect, the present invention provides a truncated expression construct of p85α, the amino acid sequence of the truncated expression construct is shown in SEQ ID NO:1.

[0006] In the present invention, p85α includes wild type, also known as PIK3R1, p85, AGM7, GRB1, IMD36. The term covers full-length, unprocessed p85α. The term covers, for example, p85α genes, human p85α, and p85α from any other vertebrate source, including mammals, such as primates and rodents (e.g., mice and rats). As a preferred embodiment, in the present invention, p85α is a human gene with a gene ID of 5295.

[0007] Truncated expression constructs usually refer to DNA, RNA or protein molecules artificially produced in molecular biology. These molecules are partial sequences of complete genes or proteins. Truncated expression constructs can be used for a variety of research purposes, including studying the functional domains of proteins, producing soluble proteins for easy purification, removing unnecessary signal peptides or transmembrane regions, and studying protein-protein interactions.

[0008] The second aspect of the present invention provides a biological material, which comprises any one of the following: (a) a nucleic acid encoding the truncated expression construct described in the first aspect of the present invention; (b) a recombinant vector, which comprises the nucleic acid described in (a); (c) a recombinant host cell, which comprises the nucleic acid described in (a) or the recombinant vector described in (b).

[0009] In the present invention, the term "nucleic acid" refers to a polymeric form of nucleotides of any length, which contains deoxyribonucleotides, ribonucleotides and / or their analogs, including DNA, RNA and DNA / RNA hybrids, and also includes DNA or RNA analogs, such as those containing modified backbones (e.g., peptide nucleic acids (PNA) or thiophosphates) or modified bases. Therefore, the nucleic acids of the present invention include DNA, cDNA, mRNA, recombinant nucleic acids, etc. Once the coding sequence of the truncated expression construct of the present invention or a sequence having more than 80% identity therewith is isolated, the fusion protein can be obtained in large quantities using recombinant technology.

[0010] The term "identity", also known as "homology", refers to an amino acid sequence or base sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical or 100% identical to the sequence provided by the present invention. To determine sequence identity, sequence alignment can be performed in various ways known to those skilled in the art, for example, using BLAST, BLAST-2, ALIGN, NEEDLE, Megalign (DNASTAR), Snapgene or DNAMAN software, etc. Those skilled in the art can determine appropriate parameters for alignment, including any algorithm required to achieve optimal alignment in the full-length sequence being compared.

[0011] Furthermore, the base sequence of the nucleic acid is as shown in SEQ ID NO:2 or has 80% or more identity with SEQ ID NO:2.

[0012] The recombinant vector of the present invention refers to an artificial construct that can deliver and preferably express one or more target genes or sequences in a host cell. The recombinant vector of the present invention is not limited and can be an expression vector, a cloning vector, etc. In certain embodiments, the recombinant vector comprises a target gene, a promoter, a terminator encoding a fusion protein of the present invention, or optionally further comprises a marker gene. The recombinant vector can use a known vector or a self-constructed vector.

[0013] Furthermore, the recombinant vector includes an expression vector and a cloning vector.

[0014] Most cloning vectors are high-copy vectors, usually prokaryotic bacteria. The gene to be cloned is connected to the plasmid of the cloning vector and then introduced into the prokaryotic bacteria. The plasmid will replicate in large quantities in the prokaryotic bacteria to form a large number of gene clones. The expression vector is a vector that adds expression elements (such as promoters, RBS, terminators, etc.) to the basic skeleton of the cloning vector to enable the expression of the target gene.

[0015] Furthermore, the cloning vector includes a plasmid vector, a phage vector, and a phage-plasmid hybrid vector.

[0016] The plasmid vector includes but is not limited to PET-GST, PET-HiS, PET-Trx, PET-CKS, PET-DsbA, Plp-OmpA, plp-STII, PMBP-P, PMBP-C, etc. The phage vector includes lambda phage and M13 phage. The phage-plasmid hybrid vector includes cosmid vector and phagemid vector.

[0017] Furthermore, the expression vector includes a plasmid expression vector, a virus expression vector, and a large fragment expression vector.

[0018] The plasmid expression vector includes prokaryotic expression vector, yeast expression vector, Ti plasmid expression vector. The viral expression vector includes but is not limited to baculovirus expression vector, SV40 virus type transformation vector, retrovirus vector, adenovirus vector. The large fragment expression vector includes TAC-transferable artificial vector, MAC-mammalian artificial chromosome, etc.

[0019] Furthermore, the recombinant host cells include eukaryotic cells and prokaryotic cells.

[0020] The host cell or recombinant host cell in the present invention refers to any cell type suitable for transformation, transfection, transduction, etc. with an expression vector or nucleic acid construct containing the nucleic acid provided by the present invention. Host cells include any progeny of a parent cell, which differs from the parent cell due to mutations occurring during replication. Preferably, the recombinant host cell includes prokaryotic cells and eukaryotic cells; more preferably, the prokaryotic cells include bacteria, actinomycetes, cyanobacteria, mycoplasmas, chlamydia, and rickettsia; more preferably, the eukaryotic cells include mammalian cells, insect cells, plant cells, and yeast cells.

[0021] The third aspect of the present invention provides a derivative of the truncated expression construct described in the first aspect of the present invention or the biomaterial described in the second aspect of the present invention, wherein the derivative is formed by modifying, encapsulating and / or covalently binding the truncated expression construct described in the first aspect of the present invention or the biomaterial described in the second aspect of the present invention with other substances.

[0022] In the present invention, the term "derivative" refers to a substance formed by a modification, encapsulation and / or covalent binding of a truncated expression construct of the present invention or a nucleic acid encoding a truncated expression construct with other substances, which maintains the desired activity or characteristics of the protein or nucleic acid. In some embodiments, the protein has co-translational and / or post-translational modifications, such as one or more of phosphorylation, acetylation, methylation, ubiquitination, glycosylation, hydroxylation, sulfation, and fatty acylation. These modifications can be obtained by production in mammalian cells or by in vitro site-directed modification of synthetic peptides. When the truncated expression construct of the present invention has an amino acid substitution relative to a related reference sequence, the substitution is preferably a conservative amino acid substitution. The truncated expression construct of the present invention may also include modified amino acids. Amino acid modifications may include, for example, phosphorylation, acetylation, methylation, amidation, or any other amino acid modification known in the art, as long as the protein maintains the desired characteristics.

[0023] Furthermore, the modification includes one or more of phosphorylation, acetylation, methylation, ubiquitination, glycosylation, hydroxylation, sulfation, and fatty acylation.

[0024] Furthermore, the encapsulation includes liposome encapsulation, exosome encapsulation, metal nanoparticle encapsulation, silica encapsulation, polysaccharide nanocarrier encapsulation, synthetic polymer nanocarrier encapsulation, cell penetrating peptide encapsulation, protein cage encapsulation, and virus-like particle encapsulation.

[0025] Furthermore, the other substances include one or more components selected from the group consisting of a detectable label, a free adjuvant, a stabilizer, a buffer, a surfactant, a salt and a preservative.

[0026] The detectable label comprises at least one of a radioisotope, a metal nanomaterial, a fluorescein, a biotin, avidin, a biotin / avidin protein complex, a biotin / avidin protein complex, a chromophore, an electron-dense substance, and an enzyme.

[0027] The fourth aspect of the present invention provides a set of primers, which can amplify the nucleic acid described in the second aspect of the present invention, and the primers include the base sequences shown in SEQ ID NO: 3-4.

[0028] The fifth aspect of the present invention provides a product for preventing UVB-induced skin photodamage, which comprises the truncated expression construct described in the first aspect of the present invention, the biomaterial described in the second aspect of the present invention, the derivative described in the third aspect of the present invention and / or the primer described in the fourth aspect of the present invention.

[0029] Furthermore, the product is selected from a pharmaceutical composition, a probe set, a primer set, a kit, a chip, a test paper, a high-throughput sequencing, a system, an equipment, and a device.

[0030] The pharmaceutical composition of the present invention can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or by implanted drug storage devices. The pharmaceutical composition of the present invention can contain any commonly used non-toxic pharmaceutically acceptable carrier, adjuvant or excipient. In some cases, pharmaceutical acids, bases or buffers can be used to adjust the pH of the preparation to improve the stability of the compound or its dosage form. The term parenteral as used in the present invention includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. As long as the target tissue can be reached, the pharmaceutical composition of the present invention can be administered to the receptor by any route.

[0031] Furthermore, the pharmaceutical composition also includes pharmaceutical excipients.

[0032] The pharmaceutical adjuvant or pharmaceutically acceptable carrier or excipient in the context of the present invention refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulation material or any type of formulation aid. The pharmaceutical adjuvant can also be a binder, a wetting agent, a disintegrant, an emulsifier, a cosolvent, a solubilizing agent, an osmotic pressure regulator, a surfactant, a colorant, a pH regulator, an antioxidant or an antibacterial agent.

[0033] The sixth aspect of the present invention provides the use of the truncated expression construct described in the first aspect of the present invention, the biomaterial described in the second aspect of the present invention, the derivative described in the third aspect of the present invention and / or the primer described in the fourth aspect of the present invention in the preparation of a product for preventing UVB-induced skin photodamage.

[0034] The seventh aspect of the present invention provides a method for preparing the truncated expression construct described in the first aspect of the present invention, which method includes genetic engineering technology and artificial synthesis.

[0035] Furthermore, the steps of the genetic engineering technology include: culturing the recombinant host cell described in the second aspect of the present invention to express the truncated expression construct described in the first aspect of the present invention; or, transfecting the host cell with the recombinant vector described in the second aspect of the present invention to express the truncated expression construct described in the first aspect of the present invention; or, transforming the host cell with the nucleic acid described in the second aspect of the present invention to express the truncated expression construct described in the first aspect of the present invention.

[0036] Advantages and beneficial effects of the present invention: The present invention provides a truncated expression construct of p85α, which can antagonize UVB-induced PERK-p53-PERP pathway activation and pro-apoptotic effects, and the molecule is smaller than p85α and has better drugability, and has potential application value in preventing UVB-induced skin photodamage reactions. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Schematic diagram of the construction scheme for wild-type p85α and its truncated expression constructs.

[0038] Figure 2 This is a graph showing the difference in the ability of wild-type p85α and its truncated expression construct to bind to PERK.

[0039] Figure 3 Diagram for analyzing the ability of p85α-M4 to regulate the activation of the PERK-p53-PERP pathway.

[0040] Figure 4 Graph analyzing the ability of p85α-M4 to regulate UVB-induced pro-apoptotic responses. DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present invention, but not for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute limitations of the present invention in any way. The experimental methods in the following examples, unless otherwise specified, are conventional methods, and the materials and reagents used in the following examples, unless otherwise specified, are all obtained from commercial sources.

[0042] Embodiment 1, research method

[0043] 1. Establish a UVB-induced skin photodamage model: Human skin keratinocytes (HaCaT) were used as a model. The cells were irradiated with a UVB dose (0.5 kJ / m2) that has been proven to induce apoptosis in HaCaT cells in previous studies. The expression levels of related proteins and cell apoptosis response were detected after a specified period of time after irradiation.

[0044] 2. Construction of p85α mutants and analysis of their PERK binding ability differences: A series of p85α truncated expression constructs were constructed according to the structural and functional domain characteristics of p85α. The full-length p85α (WT-p85α) is 1-724 amino acids; p85α M1 is a truncated expression construct of 1-617 amino acids; p85α M2 is a truncated expression construct with 322-430 amino acids knocked out; p85α M3 is a truncated expression construct with (1-322) + (430-617) amino acids; and p85α M4 is a truncated expression construct with 430-617 amino acids knocked out.

[0045] Taking p85α M4 as an example, the method for constructing a truncated expression construct is as follows: the amino acids 430-617 of the wild-type p85α (1-724aa) are truncated, and the two amino acid sequences 1-429 and 618-724 are directly connected after truncation, and the full-length and p85α mutant construction primers are used for amplification, and inserted into the pcDNA3.1-FLAG vector for connection, and then the connection product is transformed into the Trans5α competent state, and Escherichia coli is added for amplification and then plated. After 12-16 hours, a single clone is picked and verified by bacterial liquid PCR. After successful sequencing, a large number of amplifications are performed and plasmids are extracted, and the expression is verified by transfection in HaCaT cells. The primers for constructing the full-length and p85α mutants are shown in Table 1.

[0046] Table 1. Primers for truncated expression constructs

[0047] name Upstream primer Downstream primer Flag-WT-p85α (1-724aa) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO:3) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATA (SEQ ID NO:4) Flag-p85α-M1 (1-617aa) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO:3) GACACTATAGAATAGGGCCCTCTAGACCATGTCTTCTCATCATGATGGGGCA (SEQ ID NO:5) Flag- p85α-M2 (Δ322-430aa) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO:3) GACACTATAGAATAGGGCCCTCTAGACAGTGGGAGTGGCACCTTCCAGG (SEQ ID NO: 6) Flag- p85α-M3 (1-322)+(430-617)aa GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO:3) GACACTATAGAATAGGGCCCTCTAGAAGAACCTGATCAAGGTGATCGA (SEQ ID NO:7) Flag- p85α-M4 (Δ430-617aa) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO:3) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATA (SEQ ID NO:4)

[0048] The cDNA of p85α and its truncated expression constructs were amplified using the primer pairs shown in Table 1 and inserted into the pcDNA3.1-FLAG empty vector to construct the expression plasmids.

[0049] The wild-type p85α and its truncated expression construct expression plasmids were transfected into HaCaT cells respectively, and the whole cell lysate was taken and immunoprecipitated with anti-FLAG antibody. The immunoprecipitate was identified with anti-PERK antibody; and the p85α truncated expression construct that lost the PERK binding ability was screened.

[0050] 3. Analysis of the role of p85α mutants in regulating the induction and activation of the PERK-p53-PERP pathway and mediating cell apoptosis response: In HaCaT cells with knockdown of p85α expression levels, full-length p85α and p85α mutants that lost the PERK binding ability were complemented. The WESTERN-BLOT method was used to detect the difference in the ability of wild-type and mutant p85α in mediating UVB-induced PERK-p53-PERP pathway activation response. The phthalocyanine blue exclusion experiment was used to detect the difference in the ability of wild-type and mutant p85α in mediating UVB-induced cell apoptosis response.

[0051] II. Research Results 1. By constructing a p85α truncated expression construct expression plasmid and analyzing the structural basis of the binding reaction between p85α and PERK ( Figure 1 ) found that amino acids 430-617 of p85α mediate its binding reaction with PERK, so the mutant lacking this domain (p85α-M4) completely lost its PERK binding reactivity ( Figure 2 ), whose sequence is shown in Table 2.

[0052] 2. By analyzing the function of the p85α mutant (p85α-M4) that cannot bind to PERK in the UVB stimulation response, it was found that compared with the wild-type p85α, p85α-M4 lost the function of activating PERK and p53 and inducing PERP expression ( Figure 3 ), and can also antagonize UVB-induced apoptotic responses ( Figure 4 ).

[0053] Based on the above results, it can be seen that the truncated mutant p85α-M4 lacking amino acids 430-617 has the function of targeting PERK and antagonizing UVB-induced skin keratinocyte apoptosis, which provides a new idea for preventing UVB-induced photodamage effects. It shows that p85α-M4 has potential application value in the development of anti-ultraviolet light damage drugs.

[0054] Table 2. P85α-M4 sequence list

[0055] name sequence SEQ ID p85α-M4 amino acid sequence MSAEGYQYRALYDYKKEREEDIDLHLGDILTVNKGSLVALGFSDGQEARPEEIGWLNGYNETTGERGDFPGTYVEYIGRKKISPPTPKPRPPRPLPVAPGSSKTEADVEQQALTLPDLAEQFAPPDIAPPLLIKLVEAIEKKGLECSTLYRTQSSSNLAELRQLLDCDTPSVDLEMIDVHVLADAFKRYLLDLPNPVIPAAVYSEMISLAPEVQSSEEYIQLLKKLIRSPSIPHQYWLTLQYLLKHFFKLSQTSSKNLLNARVLSEIFSPMLFRFSAASSDNTENLIKVIEILISTEWNERQPAPALPPKPPKPTTVANNGMNNNMSLQDAEWYWGDISREEVNEKLRDTADGTFLVRDASTKMHGDYTLTLRKGGNNKLIKIFHRDGKYGFSDPLTFSSVVELINHYRNESLAQYNPKLDVKLLYPVSHHDEKTWNVGSSNRNKAENLLRGKRDGTFLVRESSKQGCYACSVVVDGEVKHCVINKTATGYGFAEPYNLYSSLKELVLHYQHTSLVQHNDSLNVTLAYPVYAQQRR 1 p85α - M4 base sequence atgagcgcggaaggctatcagtatcgcgcgctgtatgattataaaaaagaacgcgaagaagatattgatctgcatctgggcgatattctgaccgtgaacaaaggcagcctggtggcgctgggctttagcgatggccaggaagcgcgcccggaagaaattggctggctgaacggctataacgaaaccaccggcgaacgcggcgattttccgggcacctatgtggaatatattggccgcaaaaaaattagcccgccgaccccgaaaccgcgcccgccgcgcccgctgccggtggcgccgggcagcagcaaaaccgaagcggatgtggaacagcaggcgctgaccctgccggatctggcggaacagtttgcgccgccggatattgcgccgccgctgctgattaaactggtggaagcgattgaaaaaaaaggcctggaatgcagcaccctgtatcgcacccagagcagcagcaacctggcggaactgcgccagctgctggattgcgataccccgagcgtggatctggaaatgattgatgtgcatgtgctggcggatgcgtttaaacgctatctgctggatctgccgaacccggtgattccggcggcggtgtatagcgaaatgattagcctggcgccggaagtgcagagcagcgaagaatatattcagctgctgaaaaaactgattcgcagcccgagcattccgcatcagtattggctgaccctgcagtatctgctgaaacatttttttaaactgagccagaccagcagcaaaaacctgctgaacgcgcgcgtgctgagcgaaatttttagcccgatgctgtttcgctttagcgcggcgagcagcgataacaccgaaaacctgattaaagtgattgaaattctgattagcaccgaatggaacgaacgccagccggcgccggcgctgccgccgaaaccgccgaaaccgaccaccgtggcgaacaacggcatgaacaacaacatgagcctgcaggatgcggaatggtattggggcgatattagccgcgaagaagtgaacgaaaaactgcgcgataccgcggatggcacctttctggtgcgcgatgcgagcaccaaaatgcatggcgattataccctgaccctgcgcaaaggcggcaacaacaaactgattaaaatttttcatcgcgatggcaaatatggctttagcgatccgctgacctttagcagcgtggtggaactgattaaccattatcgcaacgaaagcctggcgcagtataacccgaaactggatgtgaaactgctgtatccggtgagcatcatgatgaaaaaacctggaacgtgggcagcagcaaccgcaacaaagcggaaaacctgctgcgcggcaaacgcgatggcacctttctggtgcgcgaaagcagcaaacagggctgctatgcgtgcagcgtggtggtggatggcgaagtgaaacattgcgtgattaacaaaaccgcgaccggctatggctttgcggaaccgtataacctgtatagcagcctgaaagaactggtgctgcattatcagcataccagcctggtgcagcataacgatagcctgaacgtgaccctggcgtatccggtgtatgcgcagcagcgccgc 2

[0056] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A truncated expression construct of p85α, characterized in that: The amino acid sequence of the truncated expression construct is shown in SEQ ID NO:

1.

2. Biomaterial, characterized in that The biological material includes any of the following: (a) a nucleic acid encoding the truncated expression construct of claim 1; (b) a recombinant vector comprising the nucleic acid described in (a); (c) A recombinant host cell, comprising the nucleic acid described in (a) or the recombinant vector described in (b).

3. The biomaterial according to claim 2, characterized in that The base sequence of the nucleic acid is as shown in SEQ ID NO:2 or has 80% or more identity with SEQ ID NO:2; Preferably, the recombinant vector includes an expression vector and a cloning vector; Preferably, the cloning vector comprises a plasmid vector, a phage vector, or a phage-plasmid hybrid vector; Preferably, the expression vector includes a plasmid expression vector, a viral expression vector, or a large fragment expression vector; preferably, the recombinant host cell includes a eukaryotic cell or a prokaryotic cell.

4. The truncated expression construct of claim 1 or the derivative of the biomaterial of any one of claims 2 to 3, characterized in that: The derivative is formed by modifying, encapsulating and / or covalently combining the truncated expression construct of claim 1 or the biological material of any one of claims 2 to 3 with other substances.

5. The derivative according to claim 4, characterized in that The modification includes one or more of phosphorylation, acetylation, methylation, ubiquitination, glycosylation, hydroxylation, sulfation, and fatty acylation; Preferably, the encapsulation includes liposome encapsulation, exosome encapsulation, metal nanoparticle encapsulation, silica encapsulation, polysaccharide nanocarrier encapsulation, synthetic polymer nanocarrier encapsulation, cell penetrating peptide encapsulation, protein cage encapsulation, and virus-like particle encapsulation; Preferably, the other substances include one or more components selected from the group consisting of a detectable label, a free adjuvant, a stabilizer, a buffer, a surfactant, a salt and a preservative.

6. A set of primers capable of amplifying the nucleic acid according to claim 2, characterized in that: The primers include the base sequences shown in SEQ ID NO: 3-4.

7. A product for preventing UVB-induced skin photodamage, characterized in that: It comprises the truncated expression construct according to claim 1, the biological material according to any one of claims 2-3, the derivative according to any one of claims 4-5 and / or the primer according to claim 6.

8. The product according to claim 7, characterized in that The product is selected from the group consisting of pharmaceutical compositions, probe sets, primer sets, kits, chips, test strips, high-throughput sequencing, systems, equipment, and devices; Preferably, the pharmaceutical composition further comprises pharmaceutical excipients.

9. Use of the truncated expression construct of claim 1, the biomaterial of any one of claims 2-3, the derivative of any one of claims 4-5 and / or the primer of claim 6 in the preparation of a product for preventing UVB-induced skin photodamage.

10. A method for preparing the truncated expression construct of claim 1, characterized in that: The method includes genetic engineering technology and artificial synthesis; Preferably, the steps of the genetic engineering technology include: culturing the recombinant host cell described in any one of claims 2-3 to express the truncated expression construct described in claim 1; or, transfecting the host cell with the recombinant vector described in any one of claims 2-3 to express the truncated expression construct described in claim 1; or, transforming the host cell with the nucleic acid described in any one of claims 2-3 to express the truncated expression construct described in claim 1.

Images