INKT-TCR molecule targeting lipid antigen and CD1d compound, TCR-T cell and preparation and application of iNKT-TCR molecule and TCR-T cell

Abstract

The invention relates to an iNKT-TCR molecule of a targeted lipid antigen and CD1d compound, a TCR-T cell and preparation and application, and belongs to the technical field of genetic engineering and immunity. According to the invention, the specific iNKT amplification technology is utilized to amplify and sort the iNKT cells, and the TCR enriched with the iNKT cells is obtained by sequencing analysis. According to the research, iNKT cells are amplified through an iNKT cell specific activator, high-purity iNKT cells are obtained through magnetic bead sorting, TCRs enriched with the iNKT cells are accurately screened out according to sequencing analysis, and the accuracy and specificity of the TCRs are guaranteed. The NKT38 provided by the invention has a higher killing effect on tumor cells expressing CD1d and presenting endogenous lipid antigens, and has very strong specificity: in-vitro experiments show that the iNKT-TCR transfected NKT38 cells have a stronger killing effect on tumor cell lines expressing CD1d and presenting endogenous lipid antigens, and prompt that the iNKT-TCR transfected NKT38 cells have a specific killing effect on tumors.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering and immunotechnology, and more specifically, to an iNKT-TCR molecule and TCR-T cell targeting a lipid antigen and a CD1d complex, and their preparation and application. Background Art

[0002] Natural killer T cells (NKT) are an important group of innate immune-like T lymphocytes in the human body. They have both T cell and NK cell phenotypes and functional characteristics, and play a role in connecting innate immunity with adaptive immunity. Among them, NKT cells (iNKT) with relatively constant T cell receptor (TCR) composition are the main NKT cell population in existing research. iNKT cells recognize lipid or glycolipid antigens presented by non-classical MHC-I class molecule CD1d through TCR, and after activation, they can secrete a large amount of anti-tumor factors to exert anti-tumor effects. In addition, iNKT cells can also recognize lipid antigens presented by CD1d on the surface of tumor cells to directly exert anti-tumor effects.

[0003] Since iNKT cells have a relatively constant TCR, their cytotoxicity is dependent on lipid antigen and CD1d complex, and CD1d molecules are relatively conservative, iNKT cells have good application prospects in chimeric antigen receptor T cell immunotherapy (CAR-T) and TCR-modified T cell therapy (TCR-T). iNKT cells are differentially distributed in various tissues, but the number of iNKT cells in the human body is limited, and they only account for 1% of T cells in the enriched liver. Therefore, the research and application of human iNKT cells is currently difficult.

[0004] Therefore, screening out characteristic iNKT cell TCRs and constructing iNKT-TCR-modified T cell lines (NKT38) for killing tumor cells that express CD1d and present endogenous lipid antigens has good application prospects in the direction of anti-tumor immunotherapy. For studying the characteristics of human iNKT cells and the effects of TCR stimulation on T cells, this type of cell has unique advantages in constant TCR composition and stimulation of specific lipid antigens and CD1d complexes. Based on the above analysis, iNKT cell-specific amplification can be used to analyze the TCR enriched in human iNKT cells and prepare iNKT cell lines, and their effectiveness in killing tumor cell lines that express CD1d and present endogenous lipid antigens and TCR stimulation can be verified in vitro. Summary of the invention

[0005] The present invention uses sequencing to obtain iNKT cell-enriched TCR sequences (iNKT-TCR), and prepares an iNKT-TCR-modified T cell line (NKT38) through a lentiviral overexpression system. The cell line can specifically kill tumor cells that express CD1d and present endogenous lipid antigens.

[0006] According to a first aspect of the present invention, an iNKT cell TCR molecule is provided, wherein the iNKT cell TCR molecule comprises an α chain and a β chain, wherein the sequence of the α chain is shown in SEQ ID NO: 1, and the sequence of the β chain is shown in SEQ ID NO: 2;

[0007] The iNKT cell TCR molecule can specifically recognize and bind to the lipid antigen and CD1d complex.

[0008] According to another aspect of the present invention, a TCR-T cell is provided, wherein the TCR-T cell contains the iNKT cell TCR molecule.

[0009] According to another aspect of the present invention, a method for screening iNKT cell TCR molecules is provided, comprising the following steps:

[0010] (1) Using lymphocyte separation fluid, peripheral blood mononuclear cells are separated by density gradient centrifugation;

[0011] (2) using the peripheral blood mononuclear cells separated in step (1), using interleukin 2 and galactosylceramide to amplify iNKT cells in the peripheral blood mononuclear cells;

[0012] (3) staining the iNKT cells amplified in step (2) with APC fluorescently labeled tetramers to label the iNKT cell TCR; then washing with a buffer, incubating with anti-APC magnetic beads after washing, and then sorting the iNKT cells using a magnetic column;

[0013] (4) Collect the iNKT cells sorted in step (3), extract RNA, and then reverse transcribe to obtain cDNA; design corresponding primers according to the constant TCRα chain TRAV10 and β chain TRBV25-1 of the iNKT cells for PCR amplification, the sequence of the forward primer of the TCRα chain is shown in SEQ ID NO:3, the sequence of the reverse primer of the TCRα chain is shown in SEQ ID NO:4, the sequence of the forward primer of the TCRβ chain is shown in SEQ ID NO:5, and the sequence of the reverse primer of the TCRβ chain is shown in SEQ ID NO:6, connect the amplified PCR sequence with the vector to construct a plasmid, transform the plasmid into tool bacteria, and after amplification, plate it on a bacterial culture plate to form a monoclonal colony, select multiple monoclonal colonies for sequencing, and obtain the complete sequence of the iNKT cell TCRα chain and β chain; then splice the TCRα chain and β chain into a TCR sequence, and add a self-cleaving polypeptide 2A sequence between the light and heavy chains, the 2A sequence is shown in SEQ ID As shown in NO:7, the obtained gene sequence is subjected to gene synthesis to obtain the iNKT cell TCR molecule.

[0014] Preferably, the tetramer is a tetramer of PBS57 and hCD1d.

[0015] Preferably, the buffer is sterile phosphate buffered saline.

[0016] According to another aspect of the present invention, a method for preparing the TCR-T cell is provided, comprising the following steps:

[0017] S1: loading the iNKT cell TCR molecule into a tool vector to generate a plasmid through homologous recombination, and transforming the plasmid into competent cells;

[0018] S2: co-transfecting the plasmid obtained in step S1 and the lentivirus packaging helper plasmid into the tool cells using a liposome transfection reagent, collecting the virus supernatant after culture, filtering through a filter membrane, and concentrating the virus supernatant by ultrafiltration centrifugation to obtain concentrated lentivirus;

[0019] S3: The concentrated lentivirus obtained in step S2 is transfected into the target cells, and the target cell lines are infected with the control virus and the iNKT-TCR virus respectively, and the target cells are detected by flow cytometry to determine whether CD3 is expressed and whether they can bind to tetramers, so as to identify whether the virus infection is successful;

[0020] S4: The cells successfully transfected in step S3 are screened with antibiotics to obtain successfully transfected cell strains, and monoclonal cells are selected for amplification to obtain TCR-T cells that co-express iNKT-TCR and CD3 molecules.

[0021] According to another aspect of the present invention, there is provided the use of the iNKT cell TCR molecule in the preparation of anti-tumor drugs.

[0022] According to another aspect of the present invention, there is provided the use of the TCR-T cells in the preparation of anti-tumor drugs.

[0023] In general, the above technical solution conceived by the present invention has the following technical advantages compared with the prior art:

[0024] (1) The present invention utilizes specific iNKT amplification technology to amplify and sort iNKT cells, and uses sequencing analysis to obtain iNKT cell-enriched TCRs to ensure the representativeness of the screening results: In this study, iNKT cells were amplified by iNKT cell-specific activators, high-purity iNKT cells were obtained by magnetic bead sorting, and iNKT cell-enriched TCRs were accurately screened out based on sequencing analysis to ensure their accuracy and specificity.

[0025] (2) The NKT38 of the present invention has a higher killing effect on tumor cells that express CD1d and present endogenous lipid antigens, and has strong specificity: in vitro experiments show that NKT38 cells transfected with iNKT-TCR have a stronger killing effect on tumor cell lines that express CD1d and present endogenous lipid antigens, suggesting that it has a specific killing effect on tumors and has clinical application prospects.

[0026] (3) The present invention establishes a precision treatment based on the expression of CD1d and presentation of endogenous lipid antigens by the patient's tumor cells: the specific iNKT cells screened out have a constant TCR sequence, which specifically recognizes the complex of lipid antigen and CD1d, and provides specific killing for different tumors that express CD1d molecules and present endogenous lipid antigens for precision treatment.

[0027] (4) The present invention is scalable: the cell has a killing effect on tumor cells that express CD1d molecules and present endogenous lipid antigens, and the TCR and CD1d molecules are highly conservative. The recognition between iNKT-TCR and lipid antigen and CD1d complex is specific and stable, and has a strong killing effect on tumor cell lines that express CD1d molecules and present endogenous lipid antigens. In addition, the establishment of this stable TCR-specific stimulation system can provide a stable tool for in vitro research on TCR pathways. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 For iNKT cell expansion and sorting.

[0029] Figure 2 This is a flow cytometric identification diagram of in vitro transduction of iNKT-TCR into T cells.

[0030] Figure 3 The results of in vitro killing by flow cytometry of iNKT-TCR-T cells (NKT38). DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0032] The present invention provides a specific iNKT-TCR molecule and TCR-T cell targeting a lipid antigen and CD1d complex, and its preparation and application comprises the following steps:

[0033] 1. Expand peripheral blood mononuclear cells from healthy individuals and sort iNKT cells for DNA sequencing.

[0034] Peripheral blood was collected from healthy individuals and peripheral blood mononuclear cells were isolated. iNKT cells were amplified and sorted, and then DNA sequencing was performed to detect the TCR sequences enriched in iNKT cells.

[0035] 1.1 Isolation of peripheral blood mononuclear cells;

[0036] 1.2 Expand peripheral blood iNKT cells;

[0037] 1.3iNKT cell sorting;

[0038] 1.4DNA sequencing and analysis of iNKT cell-enriched TCR sequences.

[0039] 2. In vitro transduction of iNKT cell-specific TCR into T cells for screening to obtain iNKT-TCR-modified TCR-T cell line (NKT38).

[0040] 2.1iNKT-TCR light chain, heavy chain splicing and gene synthesis;

[0041] 2.2 Lentivirus packaging and identification;

[0042] 2.3 Lentiviral transduction and TCR expression identification;

[0043] 3. In vitro validation experiment of NKT38 cell killing specific to lipid antigen and CD1d complex.

[0044] 3.1 CD1d molecule transduction and identification of tumor cell lines;

[0045] 3.2 Target cell Cell Trace Violet labeling and staining;

[0046] 3.3 Verification of NKT38 cell killing experiment in vitro.

[0047] The present invention provides a specific iNKT-TCR molecule and TCR-T cell targeting a lipid antigen and CD1d complex, and its preparation and application specifically include the following steps:

[0048] 1. Peripheral blood mononuclear cells from healthy individuals were expanded and iNKT cells were sorted for transcriptome sequencing.

[0049] 1.1 Isolation of peripheral blood mononuclear cells;

[0050] Peripheral blood from healthy donors was used to separate sufficient peripheral blood mononuclear cells using lymphocyte separation fluid and density gradient centrifugation for subsequent expansion experiments.

[0051] 1.2 Expand peripheral blood iNKT cells;

[0052] Using the isolated peripheral blood mononuclear cells, iNKT cells in human peripheral blood mononuclear cells were expanded by combined stimulation with interleukin 2 and galactosylceramide (α-GalCer), a specific agonist of iNKT cells. The expansion system was: the concentration of interleukin 2 was 50UI / ml, the concentration of α-GalCer was 200ng / ml, the culture system was 200μl, and the number of peripheral blood mononuclear cells per well was 5×10 5 The cells were mixed thoroughly and placed in a 37°C, 5% carbon dioxide incubator for culture. On the third day of culture, 100 μl of supernatant was discarded and 100 μl of fresh culture medium containing 50 UI / ml interleukin 2 was added. On the seventh day of culture, the cells were collected and the iNKT cell expansion ratio was detected.

[0053] 1.3iNKT cell sorting;

[0054] The amplified cells were stained with APC fluorescently labeled PBS57 and hCD1d tetramer to mark iNKT cell TCR, incubated in a 4°C refrigerator for 40 minutes, washed with sterile phosphate buffer, and incubated with anti-APC magnetic beads after washing. The system was 100ul, the amount of magnetic beads used was 20ul, and the cells were incubated in a 4°C refrigerator for 40 minutes before washing. The iNKT cells were then sorted using magnetic columns. After sorting, the purity of the sorting was detected by detecting the fluorescence positivity rate of the APC channel. The purity of the iNKT cells obtained was about 95%.

[0055] 1.4 Sequencing and analyzing iNKT cell-enriched TCR sequences;

[0056] The sorted iNKT cells were collected, and RNA was extracted using Trizol. After RNA was obtained, reverse transcription was performed using a reverse transcription kit to obtain cDNA. According to the constant TCRα chain (TRAV10) and β chain (TRBV25-1) of iNKT cells, corresponding primers were designed for PCR amplification. The amplified PCR sequence was connected to the pcDNA3.1 vector to construct a plasmid, which was transformed into E. coli tool bacteria. After the bacteria were amplified, they were plated on bacterial culture plates to form monoclonal colonies. On the second day, multiple monoclonal colonies were selected for sequencing to obtain the complete sequence of the iNKT cell TCRα chain and β chain. The sequencing results showed that the CDR3 region of the iNKT cell TCRα chain sequence was completely consistent, and the most enriched TCRβ chain sequence was selected for subsequent transfection experiments. The primer sequences and TCRα chain and β chain sequences are shown below:

[0057]

[0058]

[0059] TCR α-chain sequence (SEQ ID NO:1):

[0060] ATGAAAAAGCATCTGACGACCTTCTTGGTGATTTTGTGGCTTTATTTTTATAGGGGGAATGGCAAAAACCAAGTGGAGCAGAGTCCTCAGTCCCTGATCATCCTGGAGGGAAAGAACTGCACTCTTCAATGCAATTATACAGTGAGCCCCTTCAGCAACTTAAGGTGGTATAAGCAAGATACTGGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAAGTCGAACGGAAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCACATCACAGCCTCCCAGCTCAGCGATTCAGCCTCCTACATCTGTGTGGTGAGCGACAGAGGCTCAACCCTGGGGAGGCTATACTTTGGAAGAGGAACTCAGTTGACTGTCTGGCCTGATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGCTGA

[0061] TCR β-chain sequence (SEQ ID NO:2):

[0062] ATGACTATCAGGCTCCTCTGCTACATGGGCTTTTATTTTCTGGGGGCAGGCCTCATGGAAGCTGACATCTACCAGACCCCAAGATACCTTGTTATAGGGACAGGAAAGAAGATCACTCTGGAATGTTCTCAAACCATGGGCCATGACAAAATGTACTGGTATCAACAAGATCCAGGAATGGAACTACACCTCATCCACTATTCCTATGGAGTTAATTCCACAGAGAAGGGAGATCTTTCCTCTGAGTCAACAGTCTCCAGAATAAGGACGGAGCATTTTCCCCTGACCCTGGAGTCTGCCAGGCCCTCACATACCTCTCAGTACCTCTGTGCCAGCAGTGAAATTGTAGGACAGGACGGGTCAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGAAGCAGAGATCTCCCACACCCAAAAGGCCACACTGGTATGCCTGGCCACAGGCTTCTACCCCGACCACGTGGAGCTGAGCTGGTGGGTGAATGGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGAGCAGCCCGCCCTCAATGACTCCAGATACTGCCTGAGCAGCCGCCTGAGGGTCTCGGCCACCTTCTGGCAGAACCCCCGCAACCACTTCCGCTGTCAAGTCCAGTTCTACGGGCTCTCGGAGAATGACGAGTGGACCCAGGATAGGGCCAAACCCGTCACCCAGATCGTCAGCGCCGAGGCCTGGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGCAAGGGGTCCTGTCTGCCACCATCCTCTATGAGATCTTGCTAGGGAAGGCCACCTTGTATGCCGTGCTGGTCAGTGCCCTCGTGCTGATGGCCATGGTCAAGAGAAAGGATTCCAGAGGCTAG

[0063] 2. In vitro transduction of iNKT cell-specific TCR into T cells for screening to obtain iNKT-TCR-modified TCR-T cell line (NKT38).

[0064] 2.1iNKT-TCR light chain, heavy chain splicing and gene synthesis, plasmid construction;

[0065] According to the selected TCR base fragments, the light chain and heavy chain of TCR are spliced ​​into a complete TCR sequence, and the self-cleavage polypeptide 2A sequence (GGCAGCGGCGCCACCAACTTCAGCCTGCTGAAGCAGGCCGGTGACGTGGAGGAGAATCCCGGCCCT) (SEQ ID NO: 7) is added between the light and heavy chains, and the resulting gene sequence is subjected to gene synthesis. The synthesized sequence is loaded into the tool vector GV208 by homologous recombination to generate a plasmid. The plasmid is added to 100 μL competent cells through the exchange reaction product, flicked the tube wall several times to mix, and placed on ice for 30 minutes. Heat shock at 42°C for 90 seconds and incubate in an ice water bath for 2 minutes. Add 500 μL LB culture medium and place it in a 37°C shaker for 1 hour. Take an appropriate amount of bacterial solution and evenly spread it on a plate containing the corresponding antibiotics, and invert and culture it in a constant temperature incubator for 12-16 hours. Select a single clone and identify the correct sequence. The correctly sequenced bacterial solution was transferred to 10 ml of LB liquid culture medium containing the corresponding antibiotics, cultured at 37°C overnight, and the plasmid was extracted using a plasmid extraction kit to detect the concentration.

[0066] 2.2 Lentivirus packaging and concentration;

[0067] The core plasmid loaded with the full sequence of iNKT-TCR and two lentiviral packaging auxiliary plasmids (PMD2.0G and PSPAX2) were transfected into 293T tool cells using liposome transfection reagents. According to the cell status, the 293T cell supernatant was collected after 3 days of culture. The supernatant was centrifuged at 4°C, 4000g for 10 minutes to remove cell debris; the supernatant was then filtered through a 0.45μm filter into an ultracentrifuge tube. The viral supernatant was subsequently concentrated by ultracentrifugation and stored in a -80°C refrigerator for later use.

[0068] 2.3 Lentiviral transduction and TCR expression identification;

[0069] Jurkat 76 cell line was used as the target cell for virus transduction. The control virus and iNKT-TCR virus were used to infect Jurkat 76 cell line, respectively, and the virus infection gradient was set to obtain the optimal infection system. Three days after infection, flow cytometry was used to detect whether the target cells expressed CD3 and whether they could bind to PBS57 and hCD1d tetramers to identify whether the virus infection was successful. The negative control was the Jurkat 76 cell line transfected with the control virus.

[0070] 2.4 Screening and expansion of monoclonal iNKT-TCR expressing cells;

[0071] The cells successfully transfected with lentivirus have puromycin resistance. The transfected cells were cultured in a medium containing puromycin for 2 weeks to screen the successfully transfected cell lines. After 2 weeks, the surviving cells were selected for monoclonal cells to be cultured and expanded in 96-well flat-bottom plates, and the expression of iNKT-TCR in different monoclonal cells was detected. The highly expressed monoclonal cells were selected for expansion culture to obtain the cell line NKT38 that co-expressed iNKT-TCR and CD3 molecules.

[0072] 3. In vitro validation experiment of NKT38 cell killing specific to lipid antigen and CD1d complex.

[0073] CD1d molecules were transfected into tumor cell lines, and the killing level of iNKT38 on the cell lines was detected.

[0074] 3.1 CD1d molecular identification of tumor cell lines;

[0075] In the early stage, CD1d molecules were transfected into tumor cell lines, and the expression of CD1d molecules on the surface of tumor cell line 721.221-CD1d and control cell line 721.221 transfected with CD1d molecules was detected to facilitate the subsequent NKT38 cell-specific detection. The results showed that 721.221 had significantly increased CD1d molecule expression.

[0076] 3.2 Target cell Cell Trace Violet labeling and staining;

[0077] In order to distinguish tumor cell lines from NKT38 cells in subsequent killing experiments, tumor cell lines were stained with Cell Trace Violet before killing. Cell Trace Violet stock solution was added to PBS at a ratio of 1:1000 to prepare a staining solution, and two tumor cell lines (i.e., target cells) were resuspended with 1 ml of staining solution, placed in a 37°C cell culture incubator for staining for 20 minutes, and fetal bovine serum with half the volume of the suspension was added to terminate the staining for 5 minutes. After washing with PBS twice, the cells were resuspended in 10% FBS 1640 medium and counted to prepare for subsequent killing experiments.

[0078] 3.3 NKT38 cell killing experiment verification in vitro;

[0079] The target cells stained with Cell Trace Violet and the prepared NKT38 cell line were added to a 96-well plate at a ratio of 1:10, and the killing system was 300μl. After 24 hours of co-culture, the cells were collected, washed, and stained with propidium iodide at room temperature for 10 minutes. The target cell death ratio was immediately detected by flow cytometry to determine the tumor killing effect of NKT38 cells. The results showed that compared with 721.221 that did not express CD1d molecules, NKT38 had a higher killing effect on the 721.221-CD1d cell line that expressed CD1d and presented endogenous lipid antigens, showing the specific tumor killing effect of the NKT38 cell line.

[0080] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An iNKT cell TCR molecule, characterized in that: The iNKT cell TCR molecule contains an α chain and a β chain, the sequence of the α chain is shown in SEQ ID NO: 1, and the sequence of the β chain is shown in SEQ ID NO: 2; The iNKT cell TCR molecule can specifically recognize and bind to the lipid antigen and CD1d complex.

2. A TCR-T cell, characterized in that: The TCR-T cell contains the iNKT cell TCR molecule according to claim 1.

3. The method for screening iNKT cell TCR molecules according to claim 1, characterized in that: The following steps are involved: (1) Using lymphocyte separation fluid, peripheral blood mononuclear cells are separated by density gradient centrifugation; (2) using the peripheral blood mononuclear cells separated in step (1), using interleukin 2 and galactosylceramide to amplify iNKT cells in the peripheral blood mononuclear cells; (3) staining the iNKT cells amplified in step (2) with APC fluorescently labeled tetramers to label the iNKT cell TCR; then washing with a buffer, incubating with anti-APC magnetic beads after washing, and then sorting the iNKT cells using a magnetic column; (4) Collect the iNKT cells sorted in step (3), extract RNA, and then reverse transcribe to obtain cDNA; design corresponding primers according to the constant TCRα chain TRAV10 and β chain TRBV25-1 of the iNKT cells for PCR amplification, the sequence of the forward primer of the TCRα chain is shown in SEQ ID NO:3, the sequence of the reverse primer of the TCRα chain is shown in SEQ ID NO:4, the sequence of the forward primer of the TCRβ chain is shown in SEQ ID NO:5, and the sequence of the reverse primer of the TCRβ chain is shown in SEQ ID NO:6, connect the amplified PCR sequence with the vector to construct a plasmid, transform the plasmid into tool bacteria, and after amplification, plate it on a bacterial culture plate to form a monoclonal colony, select multiple monoclonal colonies for sequencing, and obtain the complete sequence of the iNKT cell TCRα chain and β chain; then splice the TCRα chain and β chain into a TCR sequence, and add a self-cleaving polypeptide 2A sequence between the light and heavy chains, the 2A sequence is shown in SEQ ID NO:6 As shown in IDNO:7, the obtained gene sequence is subjected to gene synthesis to obtain the iNKT cell TCR molecule.

4. The method for screening iNKT cell TCR molecules according to claim 3, characterized in that: The tetramer is a tetramer of PBS57 and hCD1d.

5. The method for screening iNKT cell TCR molecules according to claim 3, characterized in that: The buffer is sterile phosphate buffered saline.

6. The method for preparing TCR-T cells according to claim 2, characterized in that: The following steps are involved: S1: loading the iNKT cell TCR molecule of claim 1 into a tool vector to generate a plasmid through homologous recombination, and transforming the plasmid into competent cells; S2: co-transfecting the plasmid obtained in step S1 and the lentivirus packaging helper plasmid into the tool cells using a liposome transfection reagent, collecting the virus supernatant after culture, filtering through a filter membrane, and concentrating the virus supernatant by ultrafiltration centrifugation to obtain concentrated lentivirus; S3: The concentrated lentivirus obtained in step S2 is transfected into the target cells, and the target cell lines are infected with the control virus and the iNKT-TCR virus respectively, and the target cells are detected by flow cytometry to determine whether CD3 is expressed and whether they can bind to tetramers, so as to identify whether the virus infection is successful; S4: The cells successfully transfected in step S3 are screened with antibiotics to obtain successfully transfected cell strains, and monoclonal cells are selected for amplification to obtain TCR-T cells that co-express iNKT-TCR and CD3 molecules.

7. Use of the iNKT cell TCR molecule according to claim 1 in the preparation of anti-tumor drugs.

8. Use of the TCR-T cell according to claim 2 in the preparation of anti-tumor drugs.

Images