A kind of Thraustochytrium pooliae and its application
Spore suspension was prepared by JSAFC 2261, which was applied to the control of American white moth and patina beetle, achieving efficient and environmentally friendly biological control effects, and solving the drug resistance and environmental pollution problems of chemical control.
Patent Information
- Application Number
- CN202510042362.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-10
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2045-01-10
AI Technical Summary
The existing technology lacks efficient and green prevention and control methods for American white moths and patina beetles. Chemical control leads to increased drug resistance, serious environmental pollution, and insufficient biological control technology, making it difficult to achieve continuous prevention and control.
The spore suspension was prepared and sprayed on the pests by using Lunasporanigiospora chienii strain JSAFC 2261. The spore suspension concentration was 107/ml. The spore suspension preparation method included culturing the mycelium under sterile conditions and filtering the spores.
Chiennephrodisiac has a high mortality rate, rapid insecticidal effect, environmentally friendly and non-toxic, solving the environmental pollution problem of chemical control and providing an effective way to biological control.
Smart Images

Figure CN119614395B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microbiology and relates to a Cladophialophora cheonii and its application. Background Art
[0002] Agriculture is the foundation of China's national economy, and pest damage is one of the important restrictive factors for the sustainable and stable development of agricultural production. In terms of species, there are more than 800 kinds of pests in crops, among which more than 20 are major epidemic and migratory pests and diseases. Among them, the fall webworm (Hyphantria cunea) and the green June beetle (Anomala corpulenta) both belong to the pests that need to be focused on.
[0003] The fall webworm is native to North America. Since it was first discovered in China in 1979, in just 30 years, from the northeastern border to the central plains, from just a few to tens of thousands, they have captured 8 provinces and cities in Liaoning all the way. Wherever they go, the leaves are eaten up, leaving only the veins, causing the trees to be unable to carry out photosynthesis and eventually die. The fall webworm has a miscellaneous diet and is a serious quarantine pest that endangers the world. At present, the comprehensive management technology system for the fall webworm is not yet perfect. The main control technology means is chemical control, and the promotion and application of new sustainable biological control technologies are relatively few, which is not conducive to China's action of reducing pesticide use and controlling pests.
[0004] Although the green June beetle has a beautiful appearance, it is a very headache-causing insect in agriculture. Despite its delicate and magnificent appearance, the green June beetle never makes agricultural practitioners worry-free. Among them, the larvae of the green June beetle (white grubs) are one of the main underground pests, distributed in most parts of China, and are also one of the main pests in the grain and cotton areas of the Huang-Huai-Hai Plain, resulting in damage and disasters in many areas across the country. However, due to the long-term reliance on highly toxic, extremely toxic, and high-residue chemical pesticides, problems such as the enhanced drug resistance of scarab beetles, the sharp reduction in the number of natural enemy populations, and environmental pollution have become increasingly prominent. In the situation of developing pollution-free ecological agriculture and organic agriculture, people's management of pests has turned to their ecological relationship. For special groups of underground pests such as the green June beetle, the control is difficult, and using biocontrol agents with relatively good environmental safety and compatibility is undoubtedly the main means.
[0005] Therefore, it is urgent to find a green prevention and control technology with good and lasting control effects on the fall webworm and the green June beetle. And biological control has become a hot topic in current research. Exploring and screening strains with strong pertinence is a key link that must be overcome in the process of biological control. However, the existing technology still lacks a green and efficient probiotic for controlling such polyphagous and severely harmful pests. Screening out such microbial resources can provide an effective way for the efficient, green, and sustainable control of major pests. Summary of the Invention
[0006] Objective of the Invention: The objective of the present invention is to provide Lunasporangiospora chienii, and its application in controlling Hyphantria cunea and Anomala corpulenta Motschulsky.
[0007] Technical Solution: The present invention provides a Lunasporangiospora chienii, and the strain number of the Lunasporangiospora chienii is JSAFC 2261, which was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on September 23, 2024, and the deposit number is CGMCC No. 41524.
[0008] Furthermore, the nucleotide sequence of the ITS gene of the Lunasporangiospora chienii is as shown in SEQ ID NO.1.
[0009] The present invention also provides a biocontrol bacterial agent, and the active ingredient of the biocontrol bacterial agent is the above-mentioned Lunasporangiospora chienii, its mycelium or spore suspension.
[0010] The present invention also provides the application of the above-mentioned Lunasporangiospora chienii and biocontrol bacterial agent in controlling Hyphantria cunea and / or Anomala corpulenta Motschulsky.
[0011] Furthermore, the application specifically is to spray the spore suspension of the above-mentioned Lunasporangiospora chienii on the larvae of Hyphantria cunea and / or Anomala corpulenta Motschulsky.
[0012] Furthermore, the preparation method of the spore suspension is: (1) Take the biocontrol bacterial strain of Lunasporangiospora chienii. Under sterile conditions, pick the mycelium with an inoculation needle and inoculate it into the sterilized PDA medium, and culture for 5 days; (2) Under sterile conditions, scrape the mycelium, rinse the mycelium with sterile water and filter it with a gauze.
[0013] Furthermore, the culture conditions in step (1) are 25°C, 75% humidity, and dark culture.
[0014] Furthermore, the concentration of the spore suspension is 10 7 / ml.
[0015] Beneficial effects: Compared with the prior art, the present invention has the following prominent and remarkable advantages: One strain of Lunasporangiospora chienii was obtained through isolation and purification of the soil from Tianmenshan, Yongtai County, Fujian Province. This strain can be used as a biocontrol strain and has a relatively high lethality rate against Hyphantria cunea and Anomala corpulenta, and is environmentally friendly, non-toxic, and can significantly inhibit the survival activity of Hyphantria cunea and Anomala corpulenta, which has great significance for the future development of biocontrol agents against Hyphantria cunea and Anomala corpulenta. Brief Description of the Drawings
[0016] Figure 1 : Colony morphology diagram of Lunasporangiospora chienii JSAFC 2261.
[0017] Figure 2 : Phylogenetic tree of Lunasporangiospora chienii JSAFC 2261.
[0018] Figure 3 : Effects of Lunasporangiospora chienii JSAFC 2261 on the growth of larvae of Hyphantria cunea and Anomala corpulenta. Detailed Embodiments
[0019] The technical solutions of the present invention will be further described below with reference to the accompanying drawings.
[0020] As used in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly including bacteria, fungi, and actinomycetes.
[0021] Example 1: Isolation and Identification of Lunasporangiospora chienii JSAFC 2261
[0022] 1. Isolation of Lunasporangiospora chienii JSAFC 2261
[0023] Take the soil from Tianmenshan, Yongtai County, Fujian Province, and isolate JSAFC 2261 therefrom. The colony characteristics are as follows: When cultured on a PDA plate medium, the colony grows rapidly, is flocculent, and the color of its surface is white ( Figure 1 ).
[0024] 2. Molecular Biological Identification of Lunasporangiospora chienii JSAFC 2261
[0025] (1) Use the kit of TIANGEN Company to extract the genomic DNA of strain JSAFC 2261.
[0026] (2) Amplify the ITS gene of genomic DNA. The DNA amplification uses a reaction volume of 30 μL, which contains 15 μL of 2× EasyTaq PCR SuperMix (+dye), 1 μL (10 μM) each of primer pairs ITS1 (SEQ ID NO.2: 5’-CTTGGTCATTTAGAGGAAGTAA-3’) & ITS4 (SEQ ID NO.3: 5’-TCCTCCGCTTATTGATATGC-3’), 2 μL of template DNA and 11 μL of ddH2O. The PCR amplification program conditions are as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 54 °C for 45 s, extension at 72 °C for 60 s, for a total of 35 cycles; finally, extension at 72 °C for 10 min.
[0027] (3) After the amplified PCR product is electrophoresed on a 1% agarose gel and observed under ultraviolet light, the PCR product with the target band is sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing result is: The ITS gene sequence of strain JSAFC 2261 is SEQ ID NO.1 (ACGAAAAATCCATTCCCACCTTGTGTGCATCGTAACAAACAACCTATTTCACAGA ATATGATTTTTAGCAAGACCGTCTGAATGCATCTCATTAGCCGATCTGCGAAAGCGGAAAGGAAAAAAAAATGAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGAGAACCTATCTCGAACCCTTTTTTTTTTTGAAAGAGGGATCGAGGAACTGAGTAATTCCGGTTCTCGTCAACTGGGTTACTTGAAATGAGGGTGCATCAATCTCCCTTGGGTTCGAATTCCTTGGCCTGAAAGCATATCTATTTAGTCCCGTCAAAAGGATTATTACTTTGCTGAAAGCGCTATAGGGGAGCCTGAGA).
[0028] (4) Align the SEQ ID NO.1 sequence on the NCBI database website and construct a phylogenetic tree, see Figure 2。The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacterium JSAFC 2261 of the present invention is Lunasporangiospora chienii, named Lunasporangiospora chienii JSAFC 2261. The strain was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on September 23, 2024, with the deposit number CGMCC No. 41524, and the taxonomic name is Lunasporangiospora chienii JSAFC 2261. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen, Chaoyang District, Beijing.
[0029] Table 1 Sequence alignment results of SEQ ID NO.1
[0030]
[0031] Example 2: Determination of the pathogenicity of Lunasporangiospora chienii JSAFC 2261 to the larvae of Hyphantria cunea
[0032] 1. Preparation of spore suspension
[0033] (1) Use a punch to take a mycelium block with a diameter of 5 mm of the strain Lunasporangiospora chienii JSAFC 2261 and inoculate it into a petri dish with a diameter of 9 cm (containing 15 ml of PDA medium), and culture it in the dark at 25 °C and 75% humidity for 7 days.
[0034] (2) Under sterile conditions, scrape the mycelium of Lunasporangiospora chienii JSAFC 2261 cultured for 7 days, rinse the mycelium with sterile water and filter it with gauze, and then adjust the spore concentration to 10 7 / mL.
[0035] 2. Inoculation of test insects
[0036] (1) The test Hyphantria cunea larvae are 2-3 instar larvae, purchased from the Research Institute of Forest Ecology, Environment and Protection, Chinese Academy of Forestry. If they are less than 3 instars, they are reared in an artificial climate chamber (temperature 25 °C, humidity 60-70%, light-dark ratio 14:10 light) until they reach 3 instars, and surface-sterilized mulberry leaves are provided every day. When the Hyphantria cunea larvae reach 3 instars, they are used for bioassay.
[0037] (2) Using sterilized ultrapure water as the negative control, the insecticidal activity of JSAFC 2261 against Hyphantria cunea was determined.
[0038] (3) Inoculate the 3rd instar larvae of Hyphantria cunea with the JSAFC 2261 spore suspension with adjusted spore concentration (10 7 / mL).
[0039] Take 10 mL of the spore suspension and place it in a petri dish. When inoculating, immerse the test insect source in the spore suspension for 30 s and then take it out. The inoculated insects are transferred to a transparent plastic box and placed in an artificial climate chamber (temperature 25 °C, humidity 60 - 70%, light - dark ratio 14∶10 light) and fed with sterilized mulberry leaves. Replace the leaves every day and observe and record the death of the larvae. Observe once a day starting from the 2nd day, and investigate and record for 7 days in total. Each group has 30 test insect source larvae, with 3 replicates.
[0040] The experimental results are shown in Table 2.
[0041] Table 2 Mortality rate of Hyphantria cunea larvae after inoculation with JSAFC 2261 (%)
[0042]
[0043] As can be seen from the data in Table 2, the mortality rate of the Hyphantria cunea larvae in the treatment group is significantly higher than that in the control group. The strain JSAFC 2261 of the present invention has a good lethal effect on Hyphantria cunea. The lethal rate of the strain spore suspension with a concentration of 10 7 spores / mL on Hyphantria cunea after 7 days is 100%. It can be seen that JSAFC 2261 has a control effect on Hyphantria cunea larvae.
[0044] Example 3: Determination of the pathogenicity of Lunasporangiospora chienii JSAFC 2261 to the larvae of Anomala corpulenta
[0045] 1. Preparation of spore suspension
[0046] Prepare the JSAFC 2261 spore suspension according to Example 2, and adjust the spore concentration to 10 7 / mL.
[0047] 2. Inoculation of test insects
[0048] (1) Raise the larvae of Anomala corpulenta (collected from the fields of Sizhuang Village, Houbai Town, Jurong City) in an artificial climate chamber (temperature 26 ± 1 °C, humidity 80%, light - dark ratio 14:10 light) until they reach the 2nd instar for standby.
[0049] (2) Use sterilized ultrapure water as the negative control to determine the insecticidal activity of JSAFC 2261 against Anomala corpulenta.
[0050] (3) Inoculate the 2nd instar larvae of Anomala corpulenta with the JSAFC 2261 spore suspension with adjusted spore concentration (10 7 / mL).
[0051] Take the larvae of Anomala corpulenta, set up 3 replicate areas in each group, with 20 larvae in each area. Dip each larva in the spore suspension for 30 s, place it on a sterile filter paper, let it crawl to dry the moisture on its body, and then put it into a feeding box filled with sterile soil. Feed the sterilized feed every day, observe and record the infection and death conditions of the larvae every day, and continuously observe for 28 days.
[0052] The experimental results are shown in Table 3.
[0053] Table 3 Mortality rate of Anomala corpulenta after inoculation with JSAFC 2261 (%)
[0054]
[0055] It can be seen from the data in Table 3 that after 28 days of inoculation, the larval mortality rate of the treatment group was significantly higher than that of the control group. The mortality rate of Anomala corpulenta caused by the JSAFC 2261 strain in the present invention reached more than 93%. The peak period of death was from 14 to 20 days, and dead insects appeared 3 days after inoculation. The above results indicate that the strain JSAFC 2261 of the present invention has a good lethal effect on the larvae of Anomala corpulenta.
[0056] In summary, JSAFC 2261 provided by the present invention provides a biological control resource for controlling the larvae of Hyphantria cunea and / or Anomala corpulenta, and has the characteristics of strong toxicity and fast insecticidal speed. At the same time, it solves the problems of pesticide residues and environmental pollution caused by using chemical pesticides to control pests, and has good development potential and production value.
Claims
1. A Thraustochytrium sp. Lunasporangiospora chienii ), characterized in that The strain number of the said Actinomucor lienmuensis Lunasporangiospora chienii is JSAFC 2261, and it was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on September 23, 2024, with the deposit number of CGMCC No. 41524.
2. A biocontrol bacterial agent, characterized in that, The active ingredient of the biocontrol bacterial agent is the Thielavia pooliae Lunasporangiospora chienii described in claim 1 or a spore suspension.
3. Use of the Thielavia biformis Lunasporangiospora chienii as described in claim 1, and the biocontrol agent described in claim 2 in controlling Hyphantria cunea and / or Anomala corpulenta.
4. The application according to claim 3, characterized in that, The application specifically uses a spore suspension of the Endomyces empusa Lunasporangiospora chienii described in claim 1 and sprays it on the larvae of Hyphantria cunea and / or Anomala corpulenta.
5. The application according to claim 4, characterized in that The preparation method of the spore suspension is as follows: (1) Take the biocontrol strain Lunasporangiospora chienii. Under aseptic conditions, pick hyphae with an inoculation needle and inoculate them into the sterilized PDA medium, and culture for 5 days; (2) Under aseptic conditions, scrape the hyphae, wash the hyphae with sterile water and filter with a gauze.
6. The application according to claim 5, characterized in that, The culture conditions in step (1) are 25°C, 75% humidity, and dark culture.
7. The application according to claim 4, wherein The concentration of the spore suspension is 10 7 / mL.
Citation Information
Patent Citations
Bacillus thuringiensis engineering bacterium for killing coleopteran pests as well as preparation method and application thereof
CN103396977A
Beauveria bassiana and application thereof in prevention and treatment of fall webworm larvae
CN116731873A