Construction method and application of four-resistance animal

Abstract

The invention belongs to the technical field of biology, and particularly relates to a construction method and application of a four-resistance animal. The invention provides a nucleic acid molecule. The nucleic acid molecule comprises a resistance gene PuroR, a first connexon, a resistance gene NeoR / KanR, a second connexon, a resistance gene HygR, a third connexon, a resistance gene BSD and an EF1 alpha promoter, the success rate of the nucleic acid molecule for constructing four-resistance animals can reach 55%; in addition, an embryo in a gestational animal in the constructed tetra-resistant animal or a cell prepared from the constructed tetra-resistant animal has good resistance to four drugs of Puro, BSD, Hygro and G418.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a construction method of a quad-resistant animal and an application thereof. Background Art

[0002] Primary cultured mouse embryonic fibroblasts (MEFs) can effectively maintain the growth of human embryonic stem cells as feeder cells, and feeder cells such as MEFs have been widely used in the culture of totipotent / pluripotent stem cells. Studies have shown that feeder cells play an important role in maintaining the long-term stability of ESC telomeres and the unlimited self-renewal and developmental pluripotency of ESCs.

[0003] With the increase of transgenic totipotent / pluripotent stem cells carrying various resistance gene vectors, feeder cells resistant to several types of selective drugs are needed. However, it is usually difficult to obtain a large number of MEFs transfected with exogenous DNA (i.e., resistance gene expression vectors). Therefore, it is necessary to construct quadruple-resistant animals and their cell lines, and the quadruple-resistant animals can be used to isolate quadruple-resistant MEF cells to support the editing of ESC multi-resistance gene vectors, or for the isolation of other quadruple-resistant primary cells. Summary of the invention

[0004] The first aspect of the present invention aims to provide a nucleic acid molecule.

[0005] The second aspect of the present invention aims to provide biological materials related to the nucleic acid molecules of the first aspect of the present invention.

[0006] The third aspect of the present invention aims to provide applications of the nucleic acid molecule of the first aspect of the present invention or the biomaterial of the second aspect of the present invention.

[0007] The fourth aspect of the present invention aims to provide a method for constructing a quad-resistant animal.

[0008] The fifth aspect of the present invention aims to provide a product.

[0009] The sixth aspect of the present invention aims to provide a somatic cell, tissue or organ.

[0010] The seventh aspect of the present invention aims to provide a method for culturing stem cells.

[0011] In order to achieve the above object, the technical solution adopted by the present invention is:

[0012] The first aspect of the present invention provides a nucleic acid molecule, which comprises: a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter.

[0013] In some embodiments, the nucleic acid molecule comprises from the 5' end to the 3' end: a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter.

[0014] In some embodiments, the first linker, the second linker, and the third linker are each independently selected from one or more of a 2A peptide and an internal ribosome entry site (IRES).

[0015] In some embodiments, the 2A peptide comprises one or more of a P2A peptide, a T2A peptide, a F2A peptide, and an E2A peptide; and further comprises one or more of a P2A peptide and a T2A peptide.

[0016] In some embodiments, the internal ribosome entry site (IRES) comprises one or more of Kaposi's sarcoma-associated herpesvirus (KSHV) IRES, hepatitis virus IRES, pestivirus IRES, cricket paralysis virus IRES, Rhopalosiphum padi virus IRES, fibroblast growth factor IRES, platelet-derived growth factor IRES, vascular endothelial growth factor IRES, insulin-like growth factor IRES, picornavirus IRES, encephalomyocarditis virus (EMCV) IRES, Pim-1 IRES, p53 IRES, Apaf-1 IRES, TDP2 IRES, L-myc IRES, and c-myc IRES.

[0017] In some embodiments, the nucleotide sequence of the resistance gene PuroR comprises:

[0018] a0) a coding sequence of a PuroR protein, wherein the amino acid sequence of the PuroR protein is the amino acid sequence encoded by nucleotides 1756-2355 of SEQ ID NO: 17; or

[0019] a1) nucleotides 1756-2355 of SEQ ID NO: 17; or

[0020] a2) a nucleotide sequence of a1) with the same function as the nucleic acid molecule shown in a1) after one or more nucleotides are substituted, deleted and / or added; or

[0021] a3) is a nucleotide sequence that has at least 99%, 98%, 97%, 96%, or 95% homology with a1) and has the same function as the nucleic acid molecule shown in a1).

[0022] In some embodiments, the first linker is an internal ribosome entry site (IRES).

[0023] In some embodiments, the nucleotide sequence of the first linker comprises:

[0024] b1) nucleotides 2382-2949 of SEQ ID NO: 17; or

[0025] b2) a nucleotide sequence of b1) which has the same function as the nucleic acid molecule shown in b1) after one or more nucleotides are substituted, deleted and / or added; or

[0026] b3) is a nucleotide sequence that has at least 99%, 98%, 97%, 96%, or 95% homology with b1) and has the same function as the nucleic acid molecule shown in b1).

[0027] In some embodiments, the nucleotide sequence of the resistance gene NeoR / KanR comprises:

[0028] c0) a coding sequence of a NeoR / KanR protein, wherein the amino acid sequence of the NeoR / KanR protein is the amino acid sequence encoded by nucleotides 2950-3744 of SEQ ID NO: 17; or

[0029] c1) nucleotides 2950-3744 of SEQ ID NO: 17; or

[0030] c2) a nucleotide sequence in which c1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in c1); or

[0031] c3) has at least 99%, 98%, 97%, 96%, 95% homology with c1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in c1).

[0032] In some embodiments, the second linker is a T2A peptide.

[0033] In some embodiments, the nucleotide sequence of the second linker comprises:

[0034] d0) a coding sequence of a T2A peptide, wherein the amino acid sequence of the T2A peptide is the amino acid sequence encoded by nucleotides 3745-3813 of SEQ ID NO: 17; or

[0035] d1) nucleotides 3745-3813 of SEQ ID NO: 17; or

[0036] d2) a nucleotide sequence in which one or more nucleotides in d1) are substituted, deleted and / or added and which has the same function as the nucleic acid molecule shown in d1); or

[0037] d3) is a nucleotide sequence that has at least 99%, 98%, 97%, 96%, or 95% homology with d1) and has the same function as the nucleic acid molecule shown in d1).

[0038] In some embodiments, the nucleotide sequence of the resistance gene HygR comprises:

[0039] e0) a coding sequence of a HygR protein, wherein the amino acid sequence of the HygR protein is the amino acid sequence encoded by nucleotides 3814 to 4836 of SEQ ID NO: 17; or

[0040] e1) nucleotides 3814-4836 of SEQ ID NO: 17; or

[0041] e2) a nucleotide sequence of e1) which has the same function as the nucleic acid molecule shown in e1) after one or more nucleotides are substituted, deleted and / or added; or

[0042] e3) has at least 99%, 98%, 97%, 96%, 95% homology with e1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in e1).

[0043] In some embodiments, the third linker is a P2A peptide.

[0044] In some embodiments, the nucleotide sequence of the third linker comprises:

[0045] f0) a coding sequence of a P2A peptide, wherein the amino acid sequence of the P2A peptide is the amino acid sequence encoded by nucleotides 4837-4902 of SEQ ID NO: 17; or

[0046] f1) nucleotides 4837-4902 of SEQ ID NO: 17; or

[0047] f2) a nucleotide sequence in which one or more nucleotides in f1) are substituted, deleted and / or added and which has the same function as the nucleic acid molecule shown in f1); or

[0048] f3) has at least 99%, 98%, 97%, 96%, or 95% homology with f1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in f1).

[0049] In some embodiments, the nucleotide sequence of the resistance gene BSD comprises:

[0050] g0) a coding sequence of a BSD protein, wherein the amino acid sequence of the BSD protein is the amino acid sequence encoded by nucleotides 4912-5307 of SEQ ID NO: 17; or

[0051] g1) nucleotides 4912-5307 of SEQ ID NO: 17; or

[0052] g2) a nucleotide sequence having the same function as the nucleic acid molecule shown in g1) after one or more nucleotides are substituted, deleted and / or added; or

[0053] g3) has at least 99%, 98%, 97%, 96%, 95% homology with g1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in g1).

[0054] In some embodiments, the nucleotide sequence of the EF1α promoter comprises:

[0055] h1) nucleotides 5341-6599 of SEQ ID NO: 17; or

[0056] h2) a nucleotide sequence in which one or more nucleotides in h1) are substituted, deleted and / or added and which has the same function as the nucleic acid molecule shown in h1); or

[0057] h3) has at least 99%, 98%, 97%, 96%, 95% homology with h1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in h1).

[0058] In some embodiments, the 5' end of the resistance gene PuroR further comprises: a post-transcriptional regulatory element.

[0059] In some embodiments, the post-transcriptional regulatory element is a Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0060] In some embodiments, the 5' end of the post-transcriptional regulatory element further comprises: a polyadenylation signal.

[0061] In some embodiments, the polyadenylation signal is selected from one or more of SV40 polyA, human growth hormone (HGH) polyA, bovine growth hormone (BGH) polyA, β-globin polyA, α-globin polyA, ovalbumin polyA, κ-light chain polyA, and synthetic polyA; further SV40 polyA.

[0062] In some embodiments, the nucleotide sequence of the polyadenylation signal comprises:

[0063] j1) nucleotides 1013-1134 of SEQ ID NO: 17; or

[0064] j2) a nucleotide sequence in which j1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in j1); or

[0065] j3) has at least 99%, 98%, 97%, 96%, 95% homology with j1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in j1).

[0066] In some embodiments, the nucleotide sequence of the post-transcriptional regulatory element comprises:

[0067] k1) nucleotides 1170-1755 of SEQ ID NO: 17; or

[0068] k2) a nucleotide sequence in which k1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in k1); or

[0069] k3) has at least 99%, 98%, 97%, 96%, 95% homology with k1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in k1).

[0070] In some embodiments, the Kozak sequence (nucleotides 5304-5313 of SEQ ID NO: 17) is further included between the EF1α promoter and the resistance gene BSD.

[0071] In some embodiments, the 3' end of the EF1α promoter further comprises: a 3' homology arm.

[0072] In some embodiments, the nucleotide sequence of the 3' homology arm comprises:

[0073] 11) nucleotides 6644-8143 of SEQ ID NO: 17; or

[0074] l2) a nucleotide sequence in which l1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in l1); or

[0075] l3) has at least 99%, 98%, 97%, 96%, 95% homology with l1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in l1).

[0076] In some embodiments, the 5' end of the polyadenylation signal further comprises: a 5' homology arm.

[0077] In some embodiments, the nucleotide sequence of the 5' homology arm comprises:

[0078] m1) nucleotides 7 to 1006 of SEQ ID NO: 17; or

[0079] m2) a nucleotide sequence in which m1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in m1); or

[0080] m3) has at least 99%, 98%, 97%, 96%, 95% homology with m1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in m1).

[0081] In some embodiments, the nucleic acid molecule comprises from the 5' end to the 3' end: a 5' homology arm, a polyadenylation signal, a post-transcriptional regulatory element, a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, a Kozak sequence, an EF1α promoter, and a 3' homology arm.

[0082] In some embodiments, the nucleotide sequence of the nucleic acid molecule comprises:

[0083] n1) nucleotides 7-8143 of SEQ ID NO: 17; or

[0084] n2) a nucleotide sequence in which n1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in n1); or

[0085] n3) has at least 99%, 98%, 97%, 96%, 95% homology with n1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in n1).

[0086] The second aspect of the present invention provides a biological material related to the nucleic acid molecule of the first aspect of the present invention, wherein the biological material comprises any one of o1)-o7):

[0087] o1) an expression cassette comprising the nucleic acid molecule of the first aspect of the present invention;

[0088] o2) a plasmid comprising the nucleic acid molecule of the first aspect of the present invention;

[0089] o3) a plasmid comprising the expression cassette described in o1);

[0090] o4) a cell comprising the nucleic acid molecule of the first aspect of the invention;

[0091] o5) a cell comprising the expression cassette described in o1);

[0092] o6) a cell comprising the plasmid described in o2);

[0093] o7) A cell comprising the plasmid described in o3).

[0094] In some embodiments, the cells of o4)-o7) do not contain propagation material.

[0095] In some embodiments, the plasmid in o2)-o3) is a homologous recombination plasmid.

[0096] In some embodiments, the plasmid in o2)-o3) further comprises a basic plasmid (preferably Rosa26 plasmid).

[0097] In some embodiments, the nucleotide sequence of the plasmid in o2)-o3) comprises:

[0098] p1) SEQ ID NO: 17; or

[0099] p2) a nucleotide sequence in which p1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in p1); or

[0100] p3) has at least 99%, 98%, 97%, 96%, 95% homology with p1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in p1).

[0101] The third aspect of the present invention provides the use of the nucleic acid molecule of the first aspect of the present invention, or the biomaterial of the second aspect of the present invention in any one of q1)-q2):

[0102] q1) Construction of quad-resistant animals;

[0103] q2) Preparation of products for the construction of quad-resistant animals.

[0104] In some embodiments, the animal is a non-human mammal.

[0105] In some embodiments, the non-human mammal is a rodent.

[0106] In some embodiments, the rodent is a rat or a mouse.

[0107] In some embodiments, the product is a kit.

[0108] The fourth aspect of the present invention provides a method for constructing a quad-resistant animal, comprising introducing the nucleic acid molecule of the first aspect of the present invention into the fertilized egg or somatic cell of the animal.

[0109] In some embodiments, the method for constructing the quad-resistant animal further comprises the following steps:

[0110] Transplanting a fertilized egg into which the nucleic acid molecule of the first aspect of the present invention has been introduced into the oviduct of a surrogate animal to obtain a tetra-resistant animal; or

[0111] The nucleus of a somatic cell into which the nucleic acid molecule of the first aspect of the present invention has been introduced is transplanted into an enucleated oocyte, and the enucleated oocyte after the nuclear transplantation is then transplanted into the oviduct of a surrogate animal to obtain a quadruple-resistant animal.

[0112] In some embodiments, the method for introducing the nucleic acid molecule of the first aspect of the present invention into the fertilized egg or somatic cell of the animal is: microinjecting the plasmid of the second aspect of the present invention into the fertilized egg or somatic cell of the animal.

[0113] In some embodiments, the microinjection system further comprises: Cas protein and sgRNA.

[0114] In some embodiments, the Cas protein is a Cas9 protein.

[0115] In some embodiments, the sgRNA is sgRNA-Rosa26 (sgRNA targeting Rosa26).

[0116] In some embodiments, the animal is the animal in the third aspect of the present invention.

[0117] The fifth aspect of the present invention provides a product, which comprises: the nucleic acid molecule of the first aspect of the present invention or the biological material of the second aspect of the present invention.

[0118] In some embodiments, the product comprises: the plasmid in the second aspect of the present invention.

[0119] In some embodiments, the product further comprises: Cas protein and sgRNA.

[0120] In some embodiments, the Cas protein is a Cas9 protein.

[0121] In some embodiments, the sgRNA is sgRNA-Rosa26.

[0122] In some embodiments, the products are used to construct quad-resistant animals.

[0123] In some embodiments, the animal is the animal in the third aspect of the present invention.

[0124] In some embodiments, the product is a kit.

[0125] The sixth aspect of the present invention provides a somatic cell, tissue or organ prepared by the quadri-resistant animal obtained by the construction method of the fourth aspect of the present invention.

[0126] In some embodiments, the somatic cells, tissues or organs are prepared from embryos of animals pregnant after the quad-resistant animals obtained by the construction method of the fourth aspect of the present invention are co-housed.

[0127] In some embodiments, the somatic cell, tissue or organ is not an embryo.

[0128] In some embodiments, the somatic cells are feeder cells.

[0129] In some embodiments, the feeder layer cells are fibroblasts; further, they are mouse embryonic fibroblasts.

[0130] The seventh aspect of the present invention provides a method for culturing stem cells, comprising the step of using the feeder layer cells according to the sixth aspect of the present invention.

[0131] In some embodiments, the method comprises the step of: seeding the stem cells onto the feeder layer cells of the sixth aspect of the present invention for culture.

[0132] In some embodiments, the stem cells are mouse embryonic stem cells.

[0133] The beneficial effects of the present invention are:

[0134] The present invention provides a nucleic acid molecule, which comprises: a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter; the success rate of using the nucleic acid molecule to construct a quadruple-resistant animal can reach 55%; and cells prepared from embryos in surrogate animals used to construct the quadruple-resistant animal or from the constructed quadruple-resistant animal have good resistance to the four drugs of Puro, BSD, Hygro, and G418. BRIEF DESCRIPTION OF THE DRAWINGS

[0135] Figure 1 The spectrum of fragment 1 in Example 1 is shown.

[0136] Figure 2 The plasmid maps and detection results of the four antibodies in Example 1 are shown.

[0137] Figure 3 The results of 5' homology arm directional insertion identification in the genotype identification of quadruple-resistant mice in Example 1 are shown (WT is the wild-type mouse genome control).

[0138] Figure 4 The results of directional insertion of the 3' homology arm in the genotype identification of the quadruple-resistant mice in Example 1 are shown (WT is the wild-type mouse genome control).

[0139] Figure 5 The results of the targeted insertion identification of the resistance gene in the genotype identification of the four resistant mice in Example 1 are shown (WT is the wild-type mouse genome control).

[0140] Figure 6 The results of the test of resistance of four resistant feeders in Example 1 are shown.

[0141] Figure 7 The test results of mES cells seeded on quad-resistant feeders in Example 1 are shown.

[0142] Figure 8 The plasmid maps and detection results of the four antibodies in Comparative Example 1 are shown.

[0143] Fig. 9 The results of directional insertion of the 3' homology arm in the genotype identification of the quadruple-resistant mice in Comparative Example 1 are shown (WT is the wild-type mouse genome control).

[0144] Fig.10 The test results of the resistance of the four-resistant feeders in Comparative Example 1 are shown.

[0145] Fig.11 The four-antibody plasmid map and detection results in Comparative Example 2 are shown.

[0146] Fig.12 The results of 5' homology arm directional insertion identification in the genotype identification of quadruple-resistant mice in Comparative Example 2 are shown (WT is the wild-type mouse genome control).

[0147] Fig.13 The test results of the resistance of the four-resistant feeders in Comparative Example 2 are shown. DETAILED DESCRIPTION

[0148] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0149] The present invention is further described in detail below through specific examples.

[0150] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0151] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. The materials and reagents used in the examples are commercially available unless otherwise specified. The manufacturers of the reagents used are indicated, and similar products from other manufacturers are substitutes.

[0152] Example 1 Preparation of IV-resistant mice and MEF cells

[0153] 1. Construction of four-antibody plasmids

[0154] 1.1. Enzyme digestion of plasmid backbone: The plasmid Rosa-EF1a-rtTA-2A-puro was digested by two restriction sites, NheⅠ and PacⅠ. After the correct digestion was confirmed by agarose gel electrophoresis, the target fragment was purified and recovered using a gel recovery kit (HiPure Gel PureDNA Mini Kit) to obtain fragment 1 (map as shown in Figure 1 The sequence of fragment 1 is shown in SEQ ID NO: 1), and the enzyme digestion system and reaction procedure are shown in Tables 1 and 2.

[0155] Table 1 Enzyme digestion system

[0156]

[0157] Table 2 Enzyme digestion reaction procedures

[0158]

[0159] 1.2. Primers were designed according to the sequences, and the following fragments were amplified by PCR: WPRE+PolyA, Puro, IRES, NeoR / KanR, Hygr, BSD+P2A. The primer sequences are shown in Table 3.

[0160] Table 3 Primer sequences

[0161]

[0162] 1.3. BSD+P2A, HygR, NeoR / KanR were connected by Overlap PCR, and T2A was introduced between HygR and NeoR / KanR to form Fragment 2 (the sequence of Fragment 2 is shown in SEQ ID NO: 14); IRES, PuroR, WPRE+PolyA were connected by Overlap PCR to form Fragment 3 (the sequence of Fragment 3 is shown in SEQ ID NO: 15). The Overlap PCR system is shown in Tables 4 and 5. The PCR program is shown in Table 7.

[0163] Table 4 Fragment 2 Overlap PCR System

[0164]

[0165]

[0166] Table 5 Fragment 3 Overlap PCR System

[0167]

[0168] 1.4. Fragment 2 and fragment 3 were connected by Overlap PCR to form fragment 4 (the sequence of fragment 4 is shown in SEQ ID NO: 16). The Overlap PCR system is shown in Table 6, and the PCR program is shown in Table 7.

[0169] Table 6 Fragment 4 Overlap PCR System

[0170]

[0171] Table 7 Overlap PCR program

[0172]

[0173] 1.5. Fragment 1 and fragment 4 are used to construct a quadruple-antibody plasmid by homologous recombination. The specific steps of the homologous recombination reaction are as follows:

[0174] The optimal amount of linearized vector (fragment 1) used in the recombination reaction is 0.03 pmol, and the optimal molar ratio of vector to insert fragment is 1:2 or 1:3. Taking 1:2 as an example:

[0175] The optimal amount of linearized vector used (0.03 pmol) = [0.02 × number of base pairs] ng;

[0176] The optimal amount of insert fragment used (0.06 pmol) = [0.02 × number of base pairs × 2] ng;

[0177] Transformation and identification of assembly products:

[0178] Thaw competent cells for cloning (e.g. DH5α) on ice;

[0179] Take 5 μL of the assembled product and add it to 100 μL of competent cells (the volume of the recombinant product should not exceed 10% of the volume of the competent cells), flick the tube wall to mix (do not oscillate to mix), and let it stand on ice for 30 minutes;

[0180] After heat shock in a 42°C water bath for 45 seconds, immediately cool on ice for 2-3 minutes;

[0181] Add 900 μL LB medium (without antibiotics) and shake at 37°C for 1 h (speed 200-250 rpm);

[0182] Centrifuge at 4000 rpm for 3 min, discard 800 μL, resuspend with the remaining 200 μL liquid, and plate on a plate containing the correct resistance;

[0183] After overnight culture at 37°C, hundreds of single clones can be formed on the plate. Several single clones are picked for colony PCR identification.

[0184] The bacterial liquid corresponding to the correctly identified monoclonal clone was extracted with the Tiangen small extraction kit for plasmid extraction and subsequent restriction enzyme digestion and sequencing identification.

[0185] The final constructed four-antibody plasmid (C009-4KX-ROSA_EF1α-BSD-Hgy-Neo-Puro) map and test results are as follows Figure 2 shown.

[0186] The sequence of the quadruple-antibody plasmid is shown in SEQ ID NO: 17, wherein nucleotides 07-1006 are the 5' homology arm (5'arm); nucleotides 1013-1134 are the SV40 ploy(A)signal; nucleotides 1170-1755 are WPRE; nucleotides 1756-2355 are PuroR; nucleotides 2382-2949 are IRES; nucleotides 2950-3744 are NeoR / KanR; nucleotides 3745-3813 are T2A; nucleotides 3814-4836 are HygR; nucleotides 4837-4902 are P2A; nucleotides 4912-5307 are BSD; nucleotides 5304-5313 are Kozak sequences; nucleotides 5341-6599 are EF-1α promoter; nucleotides 6644-8143 are 3' homology arms (3'arm).

[0187] 2. In situ Microinjection

[0188] 3-5 week old ICR female mice were selected as superovulation donors and 5 IU pregnant mare serum (PMSG) was injected intraperitoneally. 48 hours later, 5 IU human chorionic gonadotropin (HCG) was injected again. After HCG injection, each female mouse was placed in a cage of a normal ICR male mouse raised alone, and the vaginal plug was checked the next morning. The donor female mice were then killed by cervical dislocation, and the intact fallopian tubes were cut off and placed in M2 culture medium containing 0.3 mg / mL hyaluronidase. Under the dissecting microscope, the raised ampulla was found and torn with forceps. The fertilized eggs with granulosa cells removed were transferred to M16 culture medium and then cultured in an incubator at 37°C and 5% CO2.

[0189] The zygotes with binuclei and good morphology were selected, and 90 pmol of the highly efficient sgRNA-Rosa26 (GenScript), 1 ug of the corresponding four-antibody plasmid, and 30 pmol of Cas9 protein (NEB0646) available in the laboratory were injected into the nucleus of the ICR fertilized egg.

[0190] After weighing the surrogate female mice, anesthetics were injected intraperitoneally according to the concentration of anesthetics. The mice were placed on the lid of a 9mm plastic culture dish and waited for the mice to be completely anesthetized. The fertilized eggs to be transported were sucked into the transplant tube. Before sucking the fertilized eggs, a small bubble was sucked into the transplant tube, and then the M2 culture medium (M7167, Sigma-Aldrich) and the fertilized eggs were sucked, and a small bubble was sucked at the end. The transplant tube was hung on the stereoscope for use. The anesthetized female mice were disinfected, and a small incision was made on the skin along the midline of the back starting from the last rib with scissors. The wound and hair were wiped with 70% ethanol. The fallopian tubes and ovaries on both sides could be accessed through a dorsal incision parallel or perpendicular to the spine. An opening was made on the body wall near the fallopian tube with micromanipulator forceps, and the fat pad was clamped out with forceps to expose the fallopian tubes and ovaries outside the body cavity and fixed with a small spring clip. Under the stereoscope, the fallopian tube opening (fimbria) was found, the position of the mouse and the fallopian tube was adjusted, and the ovarian capsule was torn open. Lift the fallopian tube with one hand and the opening of the fallopian tube with another hand. Insert the transplant tube into the opening of the fallopian tube with the other hand and send the fertilized egg in. If bubbles are seen in the fallopian tube, the transplantation is successful. Release the spring clamp and send the fallopian tube and ovary into the body, and suture the body wall and skin wounds. After the operation, place the mouse in a clean cage and keep it warm until it is fully awake and put it back on the cage. Wait for the surrogate female mouse to give birth.

[0191] 3. Identification of the genotypes of the four resistant mice

[0192] After the surrogate female mice gave birth, when the pups grew to two weeks old, the mouse toes of about 0.5 cm were cut for genome extraction and identification. PCR analysis was used for HDR with 5' homology arms, 3' homology arms and resistance insertion fragments that were inserted into the mouse Rosa26 site.

[0193] The upstream of the primer for identifying the 5' homology arm directional insertion is located outside the 5' homology arm (Rosa-5KI-F1: gccaataatcaaattactctttaagcactgg (SEQ ID NO: 18)), and the downstream is located on the WPRE+PolyA fragment (WPRE-F1: cctccttgtataaatcctggctgtct (SEQ ID NO: 19)). The upstream of the primer for identifying the 3' homology arm directional insertion is located on the EF1-alpha fragment (EF1a-R1: acacgacatcactttcccagtt tacc (SEQ ID NO: 20)), and the downstream is located on the outside of the 3' homology arm (Rosa-3KI-R1: ttctgagaccattctcagtggctcaac (SEQ ID NO: 21)); the upstream and downstream of the resistance insertion identification are located on the WPRE+PolyA and Puro fragments, respectively (PolyA-F2: TAGATACATTGATGAGTTTGGACAAACC (SEQ ID NO: 22); Puro-R2: GTGCCCGCCTTCCTGGAG (SEQ ID NO: 23)).

[0194] If the recombinant vector is inserted into the correct position, a band of 1875 bp should appear at the 5' homology arm directional insertion site, a band of 2133 bp should appear at the 3' homology arm directional insertion site, and the fragment size for resistance insertion identification is 878 bp.

[0195] PCR identification results are shown in Figure 3 , 4 , 5: Four resistant mice (2#, 3#, 4#, 5#, 11#, 12#, 13#, 15#, 17#, 18#, 20#) were successfully constructed (genotypes are shown in Table 8), and the construction success rate reached 55%.

[0196] Table 8 Results of identification of genotypes of four resistant mice

[0197]

[0198] 4. Isolation of IV-resistant MEFs

[0199] 4.1. The four-resistance positive mice obtained in 3 above were killed by cervical dislocation at E13.5-14.5 days after being caged together (the body surface was disinfected by immersing in 75% medical alcohol).

[0200] 4.2. Spread clean plastic wrap in the intercellular biosafety cabinet, and place the sterilized pregnant mouse on its back on the sterile plastic wrap. Wipe the abdomen with iodine tincture 3 times, and then wipe it with 75% alcohol 3 times.

[0201] 4.3. Use sterilized ophthalmic scissors to make a small incision above the mouse urethra and pull it open by hand to expose the peritoneum.

[0202] 4.4. Use new scissors to cut the peritoneum to expose the enlarged uterus. Use ophthalmic forceps to lift one uterine horn and use scissors to remove the connective tissue. Cut the uterus and place it in a 100mm culture dish with DPBS containing double antibody (100x).

[0203] 4.5. Wash three times with DPBS containing double antibodies, carefully cut the uterine wall with ophthalmic scissors, separate the embryos one by one, count them, and transfer the embryos to a new 100mm culture dish.

[0204] 4.6. Use forceps to pull open the uterine wall of the pregnant mouse to separate the E13.5-14.5 day embryo wrapped in amniotic fluid, then tear open the amniotic membrane and transfer the embryo to a new culture dish containing DPBS.

[0205] 4.7. Use scissors and forceps to remove the head, tail, limbs and darker internal organs of the embryo, and wash the remaining parts three times with DPBS.

[0206] 4.8. Remove the embryo and place it in a clean 100 mm culture dish. Use ophthalmic scissors to cut the tissue for 5-10 minutes. Add 2 mL of 0.15% pancreatic enzyme (0.05% and 0.25% mixed in equal proportions) and continue cutting for 2 minutes.

[0207] 4.9. Add 3 mL of trypsin to each embryo, add new 15% trypsin, place in a 37°C cell culture incubator for digestion for 15 minutes, during which time take out the pipette and blow for about 1 minute, for a total of three times.

[0208] 4.10. Add an equal volume of 15% FBS medium containing dual antibodies to terminate digestion, transfer to a 50 mL centrifuge tube by blowing evenly, centrifuge at 250 g for 5 minutes, discard the supernatant, and the precipitate contains MEF cells.

[0209] 4.11. Resuspend the cells in 10% FBS medium, and seed the cells in three 15 cm culture dishes according to the amount of one embryo, and culture them at 37°C overnight. Observe the cell morphology under a microscope the next day. Replace the culture medium with fresh one every day, and freeze the cells when the cell density reaches 90%.

[0210] 4.12. When freezing, first remove the culture medium, wash the cells once with 5 mL DPBS, wash off the DPBS, add 3 mL 0.05% trypsin, and digest at 37°C for 3-5 minutes. When most of the cells are digested, add an equal volume of 10% FBS culture medium, gently and repeatedly blow the cells evenly, then transfer to a 50 mL centrifuge tube, and centrifuge at 250g for 5 minutes.

[0211] 4.13. Count the cells under the microscope and calculate the number of cells to be 2-3×10 6 Add 500 μL of freezing solution to the cells, resuspend the cells with freezing solution, and dispense 500 μL into each cryotube. Quickly transfer the cells to a freezing box, place in a -80°C refrigerator overnight, and transfer to a liquid nitrogen tank for long-term storage the next day.

[0212] 5. Preparation of Four-resistance Feeder

[0213] 5.1 Take out a tube of the above-obtained four-resistant MEF from the liquid nitrogen tank, place the cryotube in a 37°C water bath, and shake it gently, making sure that the water does not pass through the bottle cap. Stop the water bath when only small ice cubes remain.

[0214] 5.2. Wipe the cryovial with 75% ethanol, transfer to a 15 mL centrifuge tube, slowly add high-glucose DMEM medium containing 10% FBS, and shake gently.

[0215] 5. Centrifuge at 3.250 g for 5 min, discard the supernatant, and add 5 mL of culture medium to resuspend the cells.

[0216] 5.4. Add 6 mL of 0.1% gelatin to the culture dish and incubate for 30 minutes. Discard the gelatin before use.

[0217] 5.5. Transfer the cell suspension to a 15 cm culture dish treated with gelatin, add 18 mL of culture medium, and place in a 37°C, carbon dioxide incubator.

[0218] 5.6. Generally, it will be fully grown after 2 days and can be passed on (generally, those that grow well can be passed on 1 to 3 or 1 to 4 to become the P2 generation).

[0219] 5.7. The cells can be subcultured again the next day, 1 to 4, which is the P3 generation. They can now be used to prepare feeder layer cells.

[0220] 5.8. Preparation of Mitomycin C working solution: Dilute the Mitomycin C stock solution (1 mg / mL) 100 times with culture medium to obtain the Mitomycin C working solution (working concentration is 10 μg / ml).

[0221] 5.9. Aspirate the culture medium in the P3 generation MEF culture dish, add 15 mL of mitogen-activated protein kinase C working solution to each 15 cm culture dish, and place it in a 37°C carbon dioxide incubator for 3 hours.

[0222] 5.10. Aspirate the culture medium, add 5 mL PBS to each 15 cm culture dish and wash three times, then aspirate the PBS.

[0223] 5.11. Add 3 mL of 0.05% trypsin, add culture medium to terminate digestion after digestion, blow off the cells and collect them into a 50 mL centrifuge tube, centrifuge at 250g for 5 minutes.

[0224] 5.12. Discard the supernatant and add culture medium to resuspend.

[0225] 5.13. Freeze 5×10 6 cell.

[0226] 5.14. Quickly transfer the cells to a cryopreservation box and store at -80℃ overnight.

[0227] 6. Detection of four-resistance feeders

[0228] The quad-resistant feeders and WT feeders (refer to "4. Isolation of quad-resistant MEFs") were directly isolated from embryos of E13.5 WT pregnant mice) and revived in 24-well plates. Each well was respectively tested for resistance using 1 μg / mL Puro (Puromycin dihydrochloride) in 10% FBS medium, 10 μg / mL BSD (Blasticidin S) in 10% FBS medium, 200 μg / mL Hygro (Hygromycin B) in 10% FBS medium, and 500 μg / mL G418 (neomycin) in 10% FBS medium. One well was left with 10% FBS medium containing corresponding concentrations of antibiotics as a control. The 24-well plates were placed in a 37°C, CO2 incubator for 3 days. The medium was changed and observed every day. The results of the four drug resistance tests on D3 were as follows: Figure 6 As shown: the cell death rate in the WT group was 100%, and the cell death rate in the four resistance groups was 0%.

[0229] mESC (mouse embryonic stem cells) were seeded on a four-resistance feeder for testing, as follows: one day in advance, the four-resistance feeder was revived to a 12-well plate, and the next day, 10,000 cells per well of mESC were revived on the four-resistance feeder, and the cells were shaken by the "cross method" and placed in a 37°C / CO2 incubator for 3 days. The medium was changed and observed every day. The status of the mESC cells on D3 was as follows: Figure 7 As shown, the MES is in good condition, with the clone raised and smooth around.

[0230] Comparative Example 1 Preparation of quadruple-resistant mice and MEF cells thereof

[0231] Compared with the four-resistance plasmid in Example 1, BSD, HygR, NeoR / KanR are driven by EF-1α promoter and connected with P2A and T2A respectively, while PuroR is driven by PGK promoter alone. At the same time, in order to avoid the influence of Rosa26 forward promoter, the four resistance genes in Comparative Example 1 are reversely inserted into Rosa26 site.

[0232] 1. Enzyme digestion of plasmid backbone: The four-resistance plasmid constructed in point 1 of Example 1 was digested by the two restriction sites of NheⅠ and NotI. After correct digestion was confirmed by agarose gel electrophoresis, the target fragment was purified and recovered using a gel recovery kit (HiPure GelPure DNA Mini Kit) to obtain fragment 5 (the sequence of fragment 5 is shown in SEQ ID NO: 24). The enzyme digestion system and reaction procedure were the same as those in Tables 1 and 2.

[0233] 2. Design PCR primers (specific primer sequences are shown in Table 9), and amplify fragment 6 (the sequence of fragment 6 is shown in SEQ ID NO: 25), WPRE+PolyA and PGK promoter+PuroR sequences by PCR. The primer sequences are shown in Table 9.

[0234] Table 9 PCR primer sequences

[0235]

[0236]

[0237] 3. The above three fragments (fragment 6, WPRE+PolyA and PGK promoter+PuroR) were connected into fragment 7 (the sequence of fragment 7 is shown in SEQ ID NO: 32) by Overlap PCR. The Overlap PCR system is shown in Table 10, and the PCR program is shown in Table 7.

[0238] Table 10 Fragment 7 Overlap PCR System

[0239]

[0240] 4. The fragments 5 and 7 obtained by restriction digestion of the vector were used to construct a quadruple resistance plasmid by homologous recombination (the sequence of the quadruple resistance plasmid is shown in SE Q ID NO: 33). The plasmid map is shown in Figure 8 The homologous recombination reaction is the same as in Example 1.

[0241] 5. The method of in situ microinjection is the same as that of Example 1, except that the tetra-antibody plasmid prepared in point 4 of this comparative example is used.

[0242] 6. The identification of the genotype of the quadruple-resistant mice was the same as in Example 1, except that the identification primers were 3' homology arm directional insertion primers (3KI-F1: AACCTCCCCTTCTACGAGCG, SEQ ID NO: 50; 3KI-R1: tggagtagttactccactttcaagttcc, SEQ ID NO: 51). If the insertion was correct, the PCR band size was close to 2000 bp. Fig. 9 As shown, 16# and 20# were positive mice, and the construction success rate was 5.5%.

[0243] 7. According to the methods of "4. Isolation of quadruple-resistance MEF", "5. Preparation of quadruple-resistance feeder", and "6. Detection of quadruple-resistance feeder" in Example 1, the quadruple-resistance feeder was isolated, prepared, and detected. The results are as follows: Fig.10 As shown: in the WT group, the mortality rates of PURO, BSD, and Hygro groups were 100%, and that of G418 group was 99%; in the four-resistance groups, the mortality rates of PURO, BSD, and Hygro groups were 0%, and that of G418 group was 99%.

[0244] Comparative Example 2 Preparation of quadruple-resistant mice and MEF cells thereof

[0245] Compared with the four-resistance plasmid in Example 1, the EF-1α promoter of the four-resistance plasmid in this comparative example is replaced with the strongly expressed CAG promoter, and the order of the resistance genes is changed to BSD, PuroR, NeoR / KanR, HygR, and the last resistance is changed to use E2A connection.

[0246] 1. Design primers and amplify six fragments including CAG promoter, BSD, PuroR, NeoR / KanR, Hygr and WPRE+PolyA by PCR. The primer sequences are shown in Table 11.

[0247] Table 11 Primer sequences

[0248]

[0249]

[0250] 2. The above six fragments (CAG promoter, BSD, PuroR, NeoR / KanR, Hygr and WPRE+PolyA) were connected by Overlap PCR, and P2A, T2A and E2A sequences were introduced between BSD and Puro, Puro and NeoR / KanR, NeoR / KanR and Hygr, respectively, to form fragment 8 (the sequence of fragment 8 is shown in SEQ ID NO: 46). The Overlap PCR system is shown in Table 12, and the PCR program is shown in Table 7.

[0251] Table 12 Fragment 7 Overlap PCR System

[0252]

[0253]

[0254] 3. The restriction vector fragment 5 and fragment 8 obtained in Comparative Example 1 were homologously recombined to construct a quadruple-resistance plasmid (the sequence of the quadruple-resistance plasmid is shown in SEQ ID NO: 47). The plasmid map is shown in Fig.11 The homologous recombination reaction is the same as in Example 1.

[0255] 4. The method of in situ microinjection is the same as that of Example 1, except that the tetra-antibody plasmid prepared in point 3 of this comparative example is used.

[0256] 5. The identification of the genotype of the quadruple-resistant mice was the same as in Example 1, except that the identification primers were (5KI-F2: tgcagacttgtgggatacaga agacc, SEQ ID NO: 48; 5KI-R2: tggcgttactatgggaacatacgtc, SEQ ID NO: 49), and the size of the positive band was 1345 bp. The identification results were as follows: Fig.12 As shown, 3# and 8# were positive mice, and the construction success rate was 11.1%.

[0257] 6. According to the methods of "4. Isolation of quadruple-resistance MEF", "5. Preparation of quadruple-resistance feeder", and "6. Detection of quadruple-resistance feeder" in Example 1, the quadruple-resistance feeder was isolated, prepared, and detected. The results are as follows: Fig.13 As shown: in the WT group, the mortality rates of PURO, BSD, Hygro, and G418 groups were 100%; in the four resistance groups, the mortality rates of PURO and BSD groups were 0%, while the mortality rates of Hygro group were 100%, and those of G418 group were 90%.

[0258] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A nucleic acid molecule, comprising: a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter.

2. The nucleic acid molecule according to claim 1, characterized in that The nucleic acid molecule comprises from the 5' end to the 3' end: a resistance gene PuroR, a first linker, a resistance gene NeoR / Kan R, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, and an EF1α promoter; Preferably, the first linker, the second linker, and the third linker are each independently selected from one or more of a 2A peptide and an internal ribosome entry site (IRES); Preferably, the 2A peptide comprises one or more of a P2A peptide, a T2A peptide, a F2A peptide, and an E2A peptide; Preferably, the internal ribosome entry site comprises one or more of Kaposi's sarcoma-associated herpesvirus IRES, hepatitis virus IRES, pestivirus IRES, cricket paralysis virus IRES, graminearum aphid virus IRES, fibroblast growth factor IRES, platelet-derived growth factor IRES, vascular endothelial growth factor IRES, insulin-like growth factor IRES, small RNA virus IRES, encephalomyocarditis virus IRES, Pim-1 IRES, p53 IRES, Apaf-1 IRES, TDP2 IRES, L-my c IRES and c-mycIRES.

3. The nucleic acid molecule according to any one of claims 1 to 2, characterized in that The nucleotide sequence of the resistance gene PuroR comprises: a0) a coding sequence of a PuroR protein, wherein the amino acid sequence of the PuroR protein is the amino acid sequence encoded by nucleotides 1756-2355 of SEQ ID NO: 17; or a1) nucleotides 1756-2355 of SEQ ID NO: 17; or a2) a nucleotide sequence of a1) with the same function as the nucleic acid molecule shown in a1) after one or more nucleotides are substituted, deleted and / or added; or a3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, or 95% homology with a1) and having the same function as the nucleic acid molecule shown in a1); Preferably, the first linker is an internal ribosome entry site; Preferably, the nucleotide sequence of the first linker comprises: b1) nucleotides 2382-2949 of SEQ ID NO: 17; or b2) a nucleotide sequence of b1) which has the same function as the nucleic acid molecule shown in b1) after one or more nucleotides are substituted, deleted and / or added; or b3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, or 95% homology with b1) and having the same function as the nucleic acid molecule shown in b1); Preferably, the nucleotide sequence of the resistance gene NeoR / KanR comprises: c0) a coding sequence of a NeoR / KanR protein, wherein the amino acid sequence of the NeoR / KanR protein is the amino acid sequence encoded by nucleotides 2950-3744 of SEQ ID NO: 17; or c1) nucleotides 2950-3744 of SEQ ID NO: 17; or c2) a nucleotide sequence in which c1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in c1); or c3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, or 95% homology with c1) and having the same function as the nucleic acid molecule shown in c1); Preferably, the second linker is a T2A peptide; Preferably, the nucleotide sequence of the second linker comprises: d0) a coding sequence of a T2A peptide, wherein the amino acid sequence of the T2A peptide is the amino acid sequence encoded by nucleotides 3745-3813 of SEQ ID NO: 17; or d1) nucleotides 3745-3813 of SEQ ID NO: 17; or d2) a nucleotide sequence in which d1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in d1); or d3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, or 95% homology with d1) and having the same function as the nucleic acid molecule shown in d1); Preferably, the nucleotide sequence of the resistance gene HygR comprises: e0) a coding sequence of a HygR protein, wherein the amino acid sequence of the HygR protein is the amino acid sequence encoded by nucleotides 3814 to 4836 of SEQ ID NO: 17; or e1) nucleotides 3814-4836 of SEQ ID NO: 17; or e2) a nucleotide sequence of e1) which has the same function as the nucleic acid molecule shown in e1) after one or more nucleotides are substituted, deleted and / or added; or e3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, or 95% homology with e1) and having the same function as the nucleic acid molecule shown in e1); Preferably, the third linker is a P2A peptide; Preferably, the nucleotide sequence of the third linker comprises: f0) a coding sequence of a P2A peptide, wherein the amino acid sequence of the P2A peptide is the amino acid sequence encoded by nucleotides 4837-4902 of SEQ ID NO: 17; or f1) nucleotides 4837-4902 of SEQ ID NO: 17; or f2) a nucleotide sequence in which one or more nucleotides in f1) are substituted, deleted and / or added and which has the same function as the nucleic acid molecule shown in f1); or f3) has at least 99%, 98%, 97%, 96%, 95% homology with f1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in f1); Preferably, the nucleotide sequence of the resistance gene BSD comprises: g0) a coding sequence of a BSD protein, wherein the amino acid sequence of the BSD protein is the amino acid sequence encoded by nucleotides 4912-5307 of SEQ ID NO: 17; or g1) nucleotides 4912-5307 of SEQ ID NO: 17; or g2) a nucleotide sequence having the same function as the nucleic acid molecule shown in g1) after one or more nucleotides are substituted, deleted and / or added; or g3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, or 95% homology with g1) and having the same function as the nucleic acid molecule shown in g1); Preferably, the nucleotide sequence of the EF1α promoter comprises: h1) nucleotides 5341-6599 of SEQ ID NO: 17; or h2) a nucleotide sequence in which one or more nucleotides in h1) are substituted, deleted and / or added and which has the same function as the nucleic acid molecule shown in h1); or h3) has at least 99%, 98%, 97%, 96%, 95% homology with h1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in h1).

4. The nucleic acid molecule according to claim 3, characterized in that The 5' end of the resistance gene PuroR also includes: a post-transcriptional regulatory element; Preferably, the 5' end of the post-transcriptional regulatory element further comprises: a polyadenylation signal; Preferably, the post-transcriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element; Preferably, the polyadenylation signal is selected from one or more of SV40 polyA, human growth hormone polyA, bovine growth hormone polyA, β-globin polyA, α-globin polyA, ovalbumin polyA, κ-light chain polyA, and synthetic polyA; Preferably, the polyadenylation signal is SV40polyA; Preferably, the EF1α promoter and the resistance gene BSD further comprise: a Kozak sequence; Preferably, the 3' end of the EF1α promoter further comprises: a 3' homology arm; Preferably, the 5' end of the polyadenylation signal further comprises: a 5' homology arm; Preferably, the nucleic acid molecule comprises from the 5' end to the 3' end: a 5' homology arm, a polyadenylation signal, a post-transcriptional regulatory element, a resistance gene PuroR, a first linker, a resistance gene NeoR / KanR, a second linker, a resistance gene HygR, a third linker, a resistance gene BSD, a Kozak sequence, an EF1α promoter, and a 3' homology arm; Preferably, the nucleotide sequence of the nucleic acid molecule comprises: n1) nucleotides 7-8143 of SEQ ID NO: 17; or n2) a nucleotide sequence in which n1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in n1); or n3) has at least 99%, 98%, 97%, 96%, 95% homology with n1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in n1).

5. A biological material associated with the nucleic acid molecule according to any one of claims 1 to 4, wherein the biological material comprises any one of o1) to o7): o1) an expression cassette comprising the nucleic acid molecule according to any one of claims 1 to 4; o2) a plasmid comprising the nucleic acid molecule according to any one of claims 1 to 4; o3) a plasmid comprising the expression cassette described in o1); o4) a cell comprising the nucleic acid molecule according to any one of claims 1 to 4; o5) a cell comprising the expression cassette described in o1); o6) a cell comprising the plasmid described in o2); o7) a cell containing the plasmid described in o3); The cells described in o4)-o7) do not contain propagation material.

6. The biomaterial according to claim 5, characterized in that The plasmids described in o2)-o3) are homologous recombination plasmids; Preferably, the plasmid in o2)-o3) further comprises a basic plasmid; Preferably, the nucleotide sequence of the plasmid in o2)-o3) comprises: p1) SEQ ID NO: 17; or p2) a nucleotide sequence in which p1) is subjected to substitution, deletion and / or addition of one or more nucleotides and has the same function as the nucleic acid molecule shown in p1); or p3) has at least 99%, 98%, 97%, 96%, 95% homology with p1), and has a nucleotide sequence with the same function as the nucleic acid molecule shown in p1).

7. Use of the nucleic acid molecule according to any one of claims 1 to 4, or the biomaterial according to any one of claims 5 to 6 in any one of q1) to q2): q1) Construction of quad-resistant animals; q2) preparing products for constructing quad-resistant animals; Preferably, the animal is a non-human mammal; Preferably, the non-human mammal is a rodent; Preferably, the rodent is a rat or a mouse.

8. A method for constructing a quad-resistant animal, comprising introducing the nucleic acid molecule according to any one of claims 1 to 4 into a fertilized egg or somatic cell of the animal.

9. The construction method according to claim 8, characterized in that: The method for constructing the quadruple-resistant animal further comprises the following steps: Transplanting a fertilized egg introduced with the nucleic acid molecule of any one of claims 1 to 4 into the oviduct of a surrogate animal to obtain a tetra-resistant animal; or The nucleus of a somatic cell into which the nucleic acid molecule according to any one of claims 1 to 4 is introduced is transplanted into an enucleated oocyte, and then the enucleated oocyte after nuclear transplantation is transplanted into the oviduct of a surrogate animal to obtain a quadruple-resistant animal.

10. The construction method according to any one of claims 8 to 9, characterized in that: The method for introducing the nucleic acid molecule described in any one of claims 1 to 4 into the fertilized egg or somatic cell of the animal is: microinjecting the plasmid described in any one of claims 5 to 6 into the fertilized egg or somatic cell of the animal; Preferably, the microinjection system further comprises: Cas protein and sgRNA; Preferably, the animal is the animal described in claim 7.

11. A product comprising: the nucleic acid molecule according to any one of claims 1 to 4 or the biological material according to any one of claims 5 to 6.

12. The product according to claim 11, characterized in that: The product comprises: the plasmid described in any one of claims 5-6; Preferably, the product further comprises: Cas protein and sgRNA; Preferably, the product is used to construct quad-resistant animals; Preferably, the animal is the animal described in claim 7.

13. A somatic cell, tissue or organ prepared by a quadri-resistant animal obtained by the construction method according to any one of claims 8 to 10.

14. The somatic cell, tissue or organ according to claim 13, characterized in that: The somatic cell, tissue or organ is not an embryo; Preferably, the somatic cells are feeder cells; Preferably, the feeder layer cells are fibroblasts; further, they are mouse embryonic fibroblasts.

15. A method for culturing stem cells, comprising the step of using the feeder cells according to claim 14.

Images