CrRNA and application thereof in molecular feature detection of gene editing pig

Abstract

The invention discloses crRNA and application of the crRNA in molecular feature detection of a gene editing pig. The first aspect of the invention provides a crRNA group, which comprises crRNA1; the nucleotide sequence of the crRNA1 is as shown in SEQ ID NO. 1; the crRNA group also comprises crRNA2 (ribonucleic acid 2); the nucleotide sequence of the crRNA2 is as shown in SEQ ID NO. 2. The crRNA group provided by the invention can be used for detecting the AE26-CAAS gene edited pig or nucleic acid of the AE26-CAAS gene edited pig, and the detection method is high in sensitivity, strong in specificity, simple, convenient and feasible, and convenient for on-site rapid detection.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a crRNA and its application in molecular feature detection of gene-edited pigs. Background Art

[0002] The porcine APN protein is a key receptor for transmissible gastroenteritis virus (TGEV) to enter cells. Knocking out or performing targeted gene editing on the pAPN gene can make pigs completely resistant to TGEV.

[0003] At present, several teams at home and abroad have successfully prepared pAPN gene-edited pigs, and the virus challenge experiment has confirmed that pAPN gene editing can completely resist TGEV infection. At present, the AE26-CAAS gene-edited pig has been obtained through gene editing technology. After genetic modification, the pAPN gene of this pig has a 26 bp base deletion in the second exon, which makes the pAPN gene terminate prematurely during translation and cannot generate functional APN protein, thereby achieving resistance to the porcine transmissible gastroenteritis TGEV virus.

[0004] Nucleic acid testing of gene-edited animals is a prerequisite for supervising and managing gene-edited animals and their products, so it is necessary to study methods to accurately detect gene-edited animals. Summary of the invention

[0005] The technical problem solved by the present invention is how to quickly and accurately detect AE26-CAAS gene-edited disease-resistant pigs.

[0006] In order to solve the above technical problems, the present invention provides a crRNA group in a first aspect, which includes crRNA1, The nucleotide sequence of the crRNA1 binding target is SEQ ID NO.3.

[0007] The above crRNA group targets the pAPN gene.

[0008] The crRNA1 is obtained by in vitro transcription from the transcription template 1; The transcription template 1 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.5 and the single-stranded DNA molecule shown in SEQ ID NO.7.

[0009] In the above crRNA group, the nucleotide sequence of crRNA1 is SEQ ID NO.1.

[0010] In the above crRNA group, the crRNA group also includes crRNA2, The nucleotide sequence of the crRNA2 binding target is SEQ ID NO.4.

[0011] In the above crRNA group, the crRNA2 is obtained by in vitro transcription from transcription template 2; The transcription template 2 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.6 and the single-stranded DNA molecule shown in SEQ ID NO.8.

[0012] In the above crRNA group, the nucleotide sequence of crRNA2 is SEQ ID NO.2.

[0013] In a second aspect, the present invention provides a product, comprising the crRNA1, Cas12a protein, a primer pair for specifically amplifying each binding target, and a single-stranded DNA probe described in the first aspect; Or, the product includes the crRNA1 and crRNA2 described in the first aspect, Cas12a protein, a primer pair for specific amplification of each binding target, and a single-stranded DNA probe; And / or, the two ends of the single-stranded DNA probe are respectively labeled with different groups; And / or, the group is a fluorescent group, a quenching group and / or biotin.

[0014] In the product described above, the primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO.9 and a single-stranded DNA molecule shown in SEQ ID NO.10; The products described above are test kits, test strips or fluorescence detection systems.

[0015] The single-stranded DNA probe is a single-stranded DNA rich in AT bases with a length of 10-50 nt.

[0016] The above-mentioned single-stranded DNA probe can be specifically as follows: The two ends of the single-stranded DNA probe used for fluorescence detection are labeled with a fluorescent group and a quenching group respectively; The single-stranded DNA probe used for test strip detection is labeled with a fluorescent group and biotin at both ends.

[0017] The product has any of the following functions: B1) Identify or assist in identifying AE26-CAAS gene-edited pigs; B2) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence; B3) Identify or assist in identifying the genotype of AE26-CAAS gene-edited pigs.

[0018] In a third aspect, the present invention provides any of the following substances: A1) the Cas12a protein and the crRNA described in the second aspect, or a complex formed by the two; A2) the Cas12a protein, the crRNA1 and the crRNA2 described in the second aspect, or a complex group formed by each of them and the Cas12a protein; A2) The primer pair described in the second aspect.

[0019] In a fourth aspect, the present invention provides the use of the crRNA group described in the first aspect and the product described in the second aspect in any of the following: B1) Identify or assist in identifying AE26-CAAS gene-edited pigs; B2) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence; B3) Identify or assist in identifying the genotype of AE26-CAAS gene-edited pigs; B4) Prepare products to identify or assist in identifying AE26-CAAS gene-edited pigs; B5) Prepare products for identification or auxiliary identification of whether the sample to be tested contains the AE26-CAAS gene editing sequence; B6) Prepare products for identifying or assisting in identifying the genotype of AE26-CAAS gene-edited pigs.

[0020] In a fifth aspect, the present invention provides a method for identifying or assisting in identifying AE26-CAAS gene-edited pigs, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification using the primer pair described in the second aspect to obtain an RPA amplification product; C2) preparing a CRISPR-Cas12a detection system containing the following components: the PCR product, the Cas12a protein described in the second aspect, the crRNA1 in the crRNA described in the second aspect, and the single-stranded DNA probe described in the second aspect; C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the AE26-CAAS gene-edited pig; The above detection reaction products are used to identify or assist in identifying the AE26-CAAS gene-edited pigs as follows: The fluorescence intensity of each reaction product is detected by a fluorescence detection instrument such as an enzyme marker, a fluorescence quantitative PCR instrument, etc.: If the fluorescence intensity of the reaction product of the detection system is significantly higher than that of the reaction product of the negative control system, the sample to be tested is derived from or may be derived from the AE26-CAAS gene-edited pig; if the fluorescence intensity of the reaction product of the detection system is not significantly higher than that of the reaction product of the negative control system, the sample to be tested is not derived from or may be not derived from the AE26-CAAS gene-edited pig; the negative control system is different from the detection system only in that crRNA1 is not added.

[0021] In a sixth aspect, the present invention provides a method for identifying or assisting in identifying the genotype of an AE26-CAAS gene-edited pig, comprising the following steps: D1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification with the primer pair described in the second aspect to obtain an RPA amplification product; D2) preparing CRISPR-Cas12a detection system 1 and CRISPR-Cas12a detection system 2 containing the following components; The CRISPR-Cas12a detection system 1 includes the PCR product, the Cas12a protein described in the second aspect, the crRNA1 in the crRNA described in the second aspect, and the single-stranded DNA probe in the second aspect; The CRISPR-Cas12a detection system 2 includes the PCR product, the Cas12a protein described in the second aspect, the crRNA2 in the crRNA described in the second aspect, and the single-stranded DNA probe in the second aspect; D3) The CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 are reacted separately, and the reaction products of the two systems are detected to identify or assist in identifying the genotype of the AE26-CAAS gene-edited pig.

[0022] In the above, according to the reaction products of the two systems, the genotype of the AE26-CAAS gene-edited pig can be identified or assisted in identification by using fluorescence detection instruments such as an ELISA reader and a fluorescence quantitative PCR instrument to detect the fluorescence intensity. The specific judgment is as follows: If the fluorescence intensity of the reaction product of the detection system 1 is extremely significant ( P <0.01) is higher than the reaction product of the negative control system, and the fluorescence intensity of the reaction product of the detection system 2 is not significant ( P >0.05) is higher than the reaction product of the negative control system, then the sample to be tested is derived from or may be derived from the homozygous AE26-CAAS gene-edited pig; If the fluorescence intensity of the reaction product of the detection system 1 is extremely significant ( P <0.01) is higher than the reaction product of the negative control system, and the fluorescence intensity of the reaction product of the detection system 2 is extremely significant (P <0.01) is higher than the reaction product of the negative control system, then the sample to be tested is derived from or may be derived from the AE26-CAAS gene-edited pig heterozygote.

[0023] In the above, the sample to be tested is the ear or other tissue of the pig to be tested.

[0024] In the above, the method is for non-disease diagnosis and treatment purposes.

[0025] The crRNA group provided by the present invention can be used to detect AE26-CAAS gene-edited pigs or their nucleic acids. The detection method has high sensitivity, strong specificity, is simple and easy to use, and is convenient for rapid on-site detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 These are the standard plasmid sequencing results for AE26-CAAS gene-edited pigs and pAPN gene wild-type pigs (wild type, WT).

[0027] Figure 2 The results of RPA primer amplification are shown in Figure 2.

[0028] Figure 3 The results of crRNA activity detection targeting AE26-CAAS gene editing of pig pAPN gene sequence. ** indicates a significant difference compared with the negative control group ( P <0.01), ns means there is no significant difference compared with the negative control group ( P >0.05).

[0029] Figure 4 The results of crRNA activity detection targeting the WT pig pAPN gene sequence. ** indicates a very significant difference compared with the negative control group ( P <0.01), ns means there is no significant difference compared with the negative control group ( P >0.05).

[0030] Figure 5 This is the result of the AE26crRNA-F1 system testing pig nucleic acid samples. ** indicates a significant difference compared with the negative control group ( P <0.01), ns means there is no significant difference compared with the negative control group ( P >0.05).

[0031] Figure 6 This is the result of the WT26crRNA-F1 system testing pig nucleic acid samples. ** indicates a significant difference compared with the negative control group ( P <0.01), ns means there is no significant difference compared with the negative control group ( P >0.05).

[0032] Figure 7 The results of the combined detection and analysis of pig nucleic acid samples using the AE26crRNA-F1 system and the WT26crRNA-F1 system. ** indicates a very significant difference compared with the negative control group ( P <0.01), ns means there is no significant difference compared with the negative control group ( P >0.05). DETAILED DESCRIPTION

[0033] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0034] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0035] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0036] The present invention is described below in conjunction with specific examples, which are merely examples and are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0037] The main reagents used in the following examples are: LbCas12a protein (EDE0005-2000) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; 10×LbCas12a Cleavage Buffer (EDE0005-B) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; tissue DNA extraction kit (DP304-03) was purchased from Tiangen Biochemical Technology Co., Ltd.; EX Taq enzyme (RR001Q) was purchased from Takara; CloneSmarter TOPO cloning vector kit (C5865-50) was purchased from Sino-US Taihe Biotechnology (Beijing) Co., Ltd.; Escherichia coli DH5α competent cells (B528413-0100) were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.; T7 in vitro transcription kit (AM1354) was produced by Invitrogen; single-stranded DNA fluorescent probe was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.; Cas12 / 13-specific nucleic acid detection test strips (JY0301) were purchased from Beijing Libo Taiye Technology Co., Ltd.; TWistAmp Basic kit (TABS03KIT) was purchased from Beijing Libo Taiye Technology Co., Ltd.

[0038] The main instruments are as follows: PCR instrument (C1000 TouchTM, BIO-RAD); desktop high-speed refrigerated centrifuge (Heraeus Multifuge X1R, Thermo); bacterial incubator (MIR-254, SANYO); vortex shaker (SA8, Stuart-equipment); electronic weighing balance (Sartorius SQP, Sartorius Scientific Instrument Co., Ltd.); gel imaging system (BIO-RID, Universal HoodⅡ); constant temperature water bath (HHS-21-4, Changzhou Noki Instrument Co., Ltd.); fluorescence quantitative PCR instrument (QuantStudio™5, Thermo Scientific).

[0039] The AE26-CAAS gene-edited pigs in the following examples were prepared as follows: DKO pigs were bred with wild-type Large White pigs (from the Ninghe original breeding farm in Tianjin, hereinafter referred to as pAPN gene wild-type pigs (WT)) to produce offspring pigs, and genotype testing was performed on the offspring pigs, and offspring pigs with only the 26bp deletion of the pAPN gene were selected, namely AE26-CAAS pigs.

[0040] The method of the above genotype detection is as follows: The genomic DNA of the ear skin or tail skin tissue of the offspring pigs was extracted, and PCR amplification was performed using primers pAPN-PCR-F (5`-TACCCAGTTCAGTGACCTTCGTC-3`) and pAPN-PCR-R (5`-TGCTCGGCATTCTTGTTCTTCT-3`), and then detected by gel electrophoresis.

[0041] Electrophoresis detection showed that the sample with a single band of 260 bp in length was a genotype with single pAPN gene editing on two homologous chromosomes and a 26 bp deletion, and was named AE26-CAAS gene-edited pig homozygote.

[0042] Electrophoresis detection showed that the sample with two bands of 286 bp and 260 bp in length was a genotype with a single pAPN gene edited on one homologous chromosome and a 26bp deletion, and the other was a wild-type pAPN gene, named AE26-CAAS gene-edited pig heterozygote.

[0043] Electrophoresis detection showed that the sample with a single band of 286 bp in length contained the wild-type pAPN gene on two homologous chromosomes, and was named pAPN gene wild-type pig or wild-type pig.

[0044] Compared with wild-type pigs with the pAPN gene, the homozygous AE26-CAAS gene-edited pigs have only the 82-107th position of the second exon of the pAPN gene (genbank number: NM_214277, submitted on 2024-6-2) in the two homologous chromosomes (82-107th position of the nucleotide sequence of the pAPN gene shown in genbank number NM_214277) missing (26bp bases), while other genes remain unchanged.

[0045] Compared with wild-type pigs with the pAPN gene, the AE26-CAAS gene-edited heterozygous pigs have only the 82-107th position of the second exon of the pAPN gene (genbank number: NM_214277, submitted on 2024-6-2) in one homologous chromosome (82-107th position of the nucleotide sequence of the pAPN gene shown in genbank number: NM_214277) missing (26bp bases), and other genes remain unchanged; the other homologous chromosome is the same as the wild-type pig with the pAPN gene.

[0046] The above-mentioned DKO pigs are gene-edited pigs in which both CD163 and pAPN genes are knocked out simultaneously, and the pAPN gene has two genotypes: 5bp deletion and 26bp deletion. After genetic modification, the pAPN gene has a 26 bp base deletion in the second exon, which causes the pAPN gene to terminate translation prematurely and cannot generate functional APN protein, thereby achieving resistance to transmissible gastroenteritis of swine virus (TGEV).

[0047] DKO pigs are described in the following literature, in which the names are double-gene-knockout (DKO) pigs. The literature is Xu K, Zhou Y, Mu Y, Liu Z, Hou S, Xiong Y, Fang L, Ge C, Wei Y, Zhang X, Xu C, Che J, Fan Z, Xiang G, Guo J, Shang H, Li H, Xiao S, Li J, LiK. CD163 and pAPN double-knockout pigs are resistant to PRRSV and TGEV and exhibit decreased susceptibility to PDCoV while maintaining normal production performance. Elife. 2020 Sep 2;9:e57132. doi: 10.7554 / eLife.57132. Example 1. Design and implementation of the RPA-CRISPR / Cas12a nucleic acid detection system for pAPN gene-edited disease-resistant pigs 1. Acquisition of crRNA 1. Standard plasmid construction A tissue DNA extraction kit was used to extract the ear tissue DNA of homozygous AE26-CAAS gene-edited pigs and wild-type pigs (WT) with the pAPN gene, and the primers shown in Table 1 were used to amplify the upstream and downstream sequences of the target site of the second exon of the pAPN gene to obtain PCR products.

[0048] Table 1 shows the primers for amplifying the pAPN gene

[0049] The PCR reaction system is as shown in Table 2: Table 2 shows the PCR reaction system

[0050] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 1 min, 36 cycles; 72°C for 5 min.

[0051] The PCR products were gel-recovered and purified, and the purified products were connected to the pClone-EZ-TOPO vector (China-US Taihe Biotechnology (Beijing) Co., Ltd., C5865-50). After sequencing verification, the gene-edited pig pAPN gene standard plasmid pClone-EZ-TOPO-AE26 and the wild-type pig pAPN gene standard plasmid pClone-EZ-TOPO-WT were obtained.

[0052] pClone-EZ-TOPO-AE26 is a vector obtained by replacing the AE26-CAAS gene editing sequence (SEQ ID NO.11) between the TOPO I sites of the pClone-EZ-TOPO vector.

[0053] pClone-EZ-TOPO-WT is a vector obtained by replacing the wild-type sequence (SEQ ID NO. 12) between the TOPO I sites of the pClone-EZ-TOPO vector.

[0054] Compared with the wild-type sequence, the above gene editing sequence is a sequence obtained by deleting positions 487-512 of the wild-type sequence.

[0055] The sequencing results of the two plasmids are as follows Figure 1 As shown, Figure 1 A is the sequencing result of the standard plasmid of AE26-CAAS gene-edited pig pAPN gene. Figure 1 B is the sequencing result of the standard plasmid of wild-type pig pAPN gene.

[0056] 2. crRNA target design According to the DNA sequences within 40 bp upstream and downstream of the target site of the second exon of the pAPN gene in AE26-CAAS gene-edited pigs and pAPN gene wild-type pigs, the sequences that met the recognition requirements of LbCas12a were searched, and then three candidate target sites were screened out according to the rules of sequence GC content, sequence complementarity, etc. Among them, AE26crRNA-T1 to AE26crRNA-T2 were candidate target sites screened for gene-edited disease-resistant pigs AE26-CAAS, and WTcrRNA-T1 was a candidate target site screened for wild-type pigs (wildtype, WT, wild type) of the pAPN gene, as shown in Table 3.

[0057] Table 3 shows the crRNA of candidate target sites

[0058] 3. Preparation of specific crRNA in vitro transcription template According to the candidate target site sequence, the T7 promoter sequence (TAATACGACTCACTATAGGG) (Chen JS et al. Science, 2018, 360(6387):436-439.) and the crRNA repeat region template sequence (TAATTTCTACTAAGTGTAGAT) were added to form the specific crRNA in vitro transcription template positive-strand DNA sequence (SEQ ID NO.5-6) ​​shown in Table 4, and the negative-strand DNA sequence (SEQ ID NO.7-8) was formed according to the complementary pairing of the positive-strand DNA sequence.

[0059] Table 4 shows the positive and negative strands of the specific crRNA in vitro transcription templates.

[0060] The positive and negative DNA single strands were synthesized, and the specific crRNA in vitro transcription template was prepared by annealing. The annealing reaction system in Table 5 was prepared in a PCR tube as follows: Table 5 shows the annealing reaction system

[0061] Place the PCR tube in a PCR instrument and incubate at 95°C for 10 min, then immediately turn off the PCR instrument to allow the double-stranded strand to slowly cool down at room temperature, and incubate on ice for 5 min after 90 min. The annealed product is the crRNA in vitro transcription template and can be used for crRNA in vitro transcription.

[0062] 4. Specific crRNA in vitro transcription The T7 in vitro transcription kit (AM1354) produced by Invitrogen was used to configure the transcription system in the PCR tube as shown in Table 6: Table 6 is a specific crRNA in vitro transcription system

[0063] The transcription system was placed in a 37°C incubator for overnight incubation. The crRNA was recovered using an RNA purification and recovery kit produced by NEB.

[0064] The recovered crRNA sequences are shown in Table 7: Table 7 is the crRNA sequence name Sequence (5′-3′) length AE26crRNA-F1 (SEQ ID NO.1) UAAUUUCUACUAAGUGUAGAUCAAGGCCCUGGGCGGCCGUG 41 bp AE26crRNA-F2 UAAUUUCUACUAAGUGUAGAUUACAUUUCCAAGGCCCUGGGCGGC 45 bp WT26crRNA-F1 (SEQ ID NO.2) UAAUUUCUACUAAGUGUAGAUCAAGGCCCUGGGCAUCCUGG 41 bp 2. Design and Screen RPA Primers According to the upstream and downstream sequences of the second exon target site of the porcine pAPN gene, RPA amplification primers were designed. The candidate RPA primer sequences are shown in Table 8: Table 8 shows the RPA amplification primers

[0065] The RPA reaction system is as shown in Table 9: Table 9 shows the RPA reaction system

[0066] The RPA reaction conditions are as follows: Incubate at 37°C for 30 min.

[0067] 3.2×10 10 The standard plasmid pClone-EZ-TOPO-AE26 of AE26-CAAS gene-edited pig pAPN gene with a capacity of 100 copies / μL was used as a template, and RPA amplification was performed using the primer pairs (F and R) shown in Table 8, the system and RPA reaction conditions shown in Table 9 to obtain RPA amplification products.

[0068] The RPA amplification products of each primer pair were subjected to agarose gel electrophoresis. Figure 2 As shown, it can be seen that pAPN-RPA-4F / R has a good amplification effect.

[0069] Primers pAPN-RPA-4F (SEQ ID NO.9) and pAPN-RPA-4R (SEQ ID NO.10) with better amplification effects were selected as RPA amplification primers.

[0070] 3. Establishment of RPA-CRISPR / Cas12a nucleic acid detection system and screening of crRNA The DNA probe in Table 10 is a single-stranded DNA fluorescent probe double-labeled with a 6-FAM group and a BHQ1 group, and the sequence is 6-FAM-TTATT-BHQ1. The CRISPR / Cas12a fluorescence detection system is prepared according to the components shown in Table 10 below: Table 10 shows the CRISPR / Cas12a detection system

[0071] Among them, the RPA product was obtained by RPA amplification using standard plasmids pClone-EZ-TOPO-AE26 and pClone-EZ-TOPO-WT as DNA templates. According to the above system, the AE26crRNA-F1, AE26crRNA-F2 and WT26crRNA-F1 detection systems were prepared, and 3 technical replicates were set up for each detection system, and a negative control (NC) without crRNA was set up. The configured detection system was reacted at 37°C in a Q5 quantitative PCR instrument for 60 minutes, and the fluorescence intensity was set to be detected every 30 seconds.

[0072] The results are as follows Figure 3 As shown, AE26crRNA-F1 specifically targeted the cleavage of AE26-CAAS sequence, resulting in a significant difference compared with the NC group ( P <0.01), so AE26crRNA-F1 can specifically recognize the AE26-CAAS sequence and can be used to distinguish AE26-CAAS and WT samples. AE26crRNA-F2 has a cleavage effect on both the AE26-CAAS sequence and the WT sequence, stimulating trans-cleavage activity, and both have extremely significant differences from the NC group ( P <0.01), thus failing to specifically recognize the AE26-CAAS sequence.

[0073] Figure 4 It showed that WT26crRNA-F1 could specifically cut the WT sequence and stimulate trans-cutting activity, resulting in a significant difference from the NC group ( P <0.01) fluorescence, but cannot cut the AE26-CAAS sequence. Therefore, WT26crRNA-F1 can specifically recognize the WT sequence and can be used to distinguish AE26-CAAS and WT samples.

[0074] IV. Establishment of RPA-CRISPR / Cas12a nucleic acid detection system method 1. RPA amplification The DNA of the sample to be tested was extracted as a template, and RPA amplification was performed using pAPN-RPA-4F / pAPN-RPA-4R primers according to the system and RPA reaction conditions shown in Table 9 to obtain an RPA amplification product.

[0075] 2. CRISPR / Cas12a detection The above RPA amplification product and AE26crRNA-F1 are configured into a CRISPR / Cas12a detection system according to the system shown in Table 10 to obtain an AE26crRNA-F1 detection system; The above-mentioned RPA amplification product and WT26crRNA-F1 were configured with the CRISPR / Cas12a detection system according to the system shown in Table 10 to obtain the WT26crRNA-F1 detection system.

[0076] Three technical replicates were set up for each of the above detection systems, and a negative control (NC) without crRNA was set up.

[0077] The configured detection system was reacted in a Q5 quantitative PCR instrument at 37°C for 60 minutes.

[0078] 1) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence, or identify or assist in identifying whether the sample to be tested is derived from the AE26-CAAS gene-edited pig; After the above reaction was completed, the fluorescence intensity of the reaction products of each system was detected in real time using a Q5 quantitative PCR instrument.

[0079] If the fluorescence intensity of the reaction product of the AE26crRNA-F1 detection system is extremely significant ( P <0.01) is higher than the reaction product of the negative control system, then the sample to be tested contains or is a candidate to contain the AE26-CAAS gene editing sequence (SEQ ID NO.11), or the sample to be tested is derived from or is a candidate to be derived from the AE26-CAAS gene-edited pig; if the fluorescence intensity of the reaction product of the AE26crRNA-F1 reaction system is not significant ( P >0.05) is higher than the reaction product of the negative control system, then the sample to be tested does not contain or is not candidate for containing the AE26-CAAS gene editing sequence, or the sample to be tested does not originate from or is not candidate for originating from the AE26-CAAS gene-edited pig.

[0080] The above negative control system differs from the AE26crRNA-F2 detection system only in that no crRNA is added.

[0081] The above-mentioned AE26-CAAS gene-edited pigs are homozygous AE26-CAAS gene-edited pigs or heterozygous AE26-CAAS gene-edited pigs.

[0082] 2) Identify the genotype of the sample to be tested; After the above reaction was completed, the fluorescence intensity of the reaction products of each system was detected in real time using a Q5 quantitative PCR instrument.

[0083] If the AE26crRNA-F1 system test result is positive (the fluorescence intensity of the reaction product of the AE26crRNA-F1 detection system is extremely significant ( P<0.01) was higher than the reaction product of the negative control system), and the detection result of the WT26crRNA-F1 system was negative (the fluorescence intensity of the reaction product of the WT26crRNA-F1 detection system was not significant ( P >0.05) higher than the reaction product of the negative control system), the sample to be tested is derived from or is a candidate for being derived from a AE26-CAAS gene-edited homozygous pig; If the AE26crRNA-F1 system test result is positive (the fluorescence intensity of the reaction product of the AE26crRNA-F1 detection system is extremely significant ( P <0.01) was higher than the reaction product of the negative control system), and the detection result of the WT26crRNA-F1 system was also positive (the fluorescence intensity of the reaction product of the WT26crRNA-F1 detection system was extremely significant ( P <0.01) is higher than the reaction product of the negative control system), then the sample to be tested is derived from or is a candidate to be derived from an AE26-CAAS gene-edited heterozygous pig.

[0084] The above-mentioned AE26-CAAS gene-edited pig RPA-CRISPR / Cas12 detection system includes: AE26crRNA-F1 and / or WT26crRNA-F1, pAPN-RPA-4F primer, pAPN-RPA-4R primer, LbCas12a protein, and single-stranded DNA probe.

[0085] Example 2: Detection of pig nucleic acid samples using AE26crRNA-F1 and WT26crRNA-F1 gene-edited pig nucleic acid detection systems The AE26-CAAS gene-edited pig RPA-Cas12a detection system provided in Example 1 was used to analyze nucleic acid samples of wild-type pigs (sample numbers: 1352, 1356, 1362) and AE26-CAAS gene-edited pigs (homozygous samples: 1347, 1350, 1491; heterozygous samples: 1433, 1488, 1489) to verify whether the system can accurately identify AE26-CAAS gene-edited pig nucleic acid samples.

[0086] The above nucleic acid samples are all genomic DNA extracted from individual pig ear tissues.

[0087] The RPA amplification system was prepared according to the composition in Table 9, and the prepared detection system was reacted in a thermostat at 37° C. for 30 minutes.

[0088] A single-stranded DNA probe double-labeled with 6-FAM group and BHQ1 group was synthesized, and the sequence was 6-FAM-TTATT-BHQ1. AE26crRNA-F1 and WT26crRNA-F1 detection systems were prepared according to the components shown in Table 10, and a negative control (NC) without crRNA was set up.

[0089] The configured detection system was reacted in a Q5 quantitative PCR instrument at 37°C for 60 minutes, and the fluorescence intensity was detected every 30 seconds.

[0090] The analysis results are as follows Figure 5 and Figure 6 : Figure 5 In the test, when the RPA-Cas12a detection system with AE26crRNA-F1 as crRNA detected nucleic acid samples of wild-type pigs with pAPN gene and AE26-CAAS gene-edited pigs, the detection results of nucleic acid samples without AE26-CAAS gene editing sequence (wild-type pigs with pAPN gene) had no significant difference in fluorescence with the NC group ( P >0.05), showing a negative result. The nucleic acid samples containing the AE26-CAAS gene editing sequence (AE26-CAAS gene editing homozygous pigs and heterozygous pigs) produced extremely significant differences compared with the NC group ( P <0.01), indicating a positive result.

[0091] Figure 6 In the experiment, when the RPA-Cas12a detection system with WT26crRNA-F1 as crRNA detected nucleic acid samples of wild-type pigs and AE26-CAAS gene-edited pigs, the nucleic acid samples (AE26-CAAS gene-edited homozygous pigs) without the wild-type sequence of the pAPN gene (SEQ ID NO.12) produced fluorescence that was not significantly different from that of the NC group ( P >0.05), showing a negative result. The nucleic acid samples containing the wild-type sequence of the pAPN gene (pAPN gene wild-type pigs and AE26-CAAS gene-edited heterozygous pigs) produced extremely significant differences compared with the NC group ( P <0.01), indicating a positive result.

[0092] By jointly analyzing the detection results of the RPA-Cas12a detection system with AE26crRNA-F1 as crRNA and WT26crRNA-F1 as crRNA, the genotype of the pig nucleic acid sample can be accurately determined. Figure 7As shown, when the test result of the AE26crRNA-F1 system is positive and the test result of the WT26crRNA-F1 system is negative, it indicates that the nucleic acid sample only contains the AE26-CAAS genotype sequence, and is therefore an AE26-CAAS homozygous genotype sample; when the test result of the AE26crRNA-F1 system is positive and the test result of the WTcrRNA-F2 system is also positive, it indicates that the sample contains both the AE26-CAAS genotype and the pAPN gene wild-type sequence, and is therefore an AE26-CAAS heterozygous genotype sample; when the test result of the AE26crRNA-F1 system is negative and the test result of the WT26crRNA-F1 system is positive, it indicates that the nucleic acid sample only contains the pAPN gene wild-type sequence and is a pAPN gene wild-type sample.

[0093] Therefore, by using the crRNAs such as AE26crRNA-F1 and WT26crRNA-F1 and the detection method provided by the present invention, the genotype of AE26-CAAS gene-edited pigs can be quickly and highly specifically determined, which can be applied to the breeding, production, supervision and other aspects of AE26-CAAS gene-edited pigs.

[0094] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. a crRNA group, comprising crRNA1, The nucleotide sequence of the crRNA1 binding target is SEQ ID NO.

3.

2. The crRNA group according to claim 1, characterized in that: The crRNA1 is obtained by in vitro transcription from the transcription template 1; The transcription template 1 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.5 and the single-stranded DNA molecule shown in SEQ ID NO.

7.

3. The crRNA group according to claim 1 or 2, characterized in that: The nucleotide sequence of the crRNA1 is SEQ ID NO.

1.

4. The crRNA group according to any one of claims 1 to 3, characterized in that: The crRNA group also includes crRNA2, The nucleotide sequence of the crRNA2 binding target is SEQ ID NO.

4.

5. The crRNA group according to claim 4, characterized in that: The crRNA2 is obtained by in vitro transcription from the transcription template 2; The transcription template 2 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.6 and the single-stranded DNA molecule shown in SEQ ID NO.

8.

6. The crRNA group according to claim 4 or 5, characterized in that: The nucleotide sequence of the crRNA2 is SEQ ID NO.

2.

7. A product comprising the crRNA1, Cas12a protein, a primer pair for specific amplification of each binding target and a single-stranded DNA probe described in any one of claims 1 to 6; Or, the product comprises crRNA1 and crRNA2, Cas12a protein, primer pairs for specific amplification of each binding target, and single-stranded DNA probes as described in any one of claims 4-6; And / or, the two ends of the single-stranded DNA probe are respectively labeled with different groups; And / or, the group is a fluorescent group, a quenching group and / or biotin.

8. The product according to claim 7, characterized in that: The primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO.9 and a single-stranded DNA molecule shown in SEQ ID NO.10; Alternatively, the product is a test kit, a test strip or a fluorescence detection system.

9. Any of the following substances: A1) the Cas12a protein described in claim 7 and the crRNA1, or a complex formed by the two; A2) the Cas12a protein, the crRNA1 and the crRNA2 described in claim 7, or a complex group formed by each of them and the Cas12a protein; A3) The primer pair according to claim 7 or 8.

10. Use of the crRNA set according to any one of claims 1 to 6 or the product according to any one of claims 7 to 8 in any of the following: B1) Identify or assist in identifying AE26-CAAS gene-edited pigs; B2) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence; B3) Identify or assist in identifying the genotype of AE26-CAAS gene-edited pigs; B4) Prepare products to identify or assist in identifying AE26-CAAS gene-edited pigs; B5) Prepare products for identification or auxiliary identification of whether the sample to be tested contains the AE26-CAAS gene editing sequence; B6) Prepare products for identifying or assisting in identifying the genotype of AE26-CAAS gene-edited pigs; Or, a method for identifying or assisting in identifying AE26-CAAS gene-edited pigs, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, performing RPA amplification with the primer pair described in claim 7 or 8 to obtain an RPA amplification product; C2) preparing a CRISPR-Cas12a detection system containing the following components: the PCR product, the Cas12a protein described in claim 7, the crRNA1 in the crRNA described in claim 7, and the single-stranded DNA probe described in claim 7; C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the AE26-CAAS gene-edited pig; Or, a method for identifying or assisting in identifying the genotype of AE26-CAAS gene-edited pigs, comprising the following steps: D1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification with the primer pair described in claim 7 to obtain an RPA amplification product; D2) preparing CRISPR-Cas12a detection system 1 and CRISPR-Cas12a detection system 2 containing the following components; The CRISPR-Cas12a detection system 1 comprises the PCR product, the Cas12a protein described in claim 7, the crRNA1 in the crRNA described in claim 7, and the single-stranded DNA probe in claim 7; The CRISPR-Cas12a detection system 2 comprises the PCR product, the Cas12a protein described in claim 7, the crRNA2 in the crRNA described in claim 7, and the single-stranded DNA probe in claim 7; D3) The CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 are reacted separately, and the reaction products of the two systems are detected to identify or assist in identifying the genotype of the AE26-CAAS gene-edited pig.

Images