A gene GmHB21 involved in soybean nodule vascular bundle development and its application

Abstract

The present invention relates to a gene GmHB21 involved in soybean nodule vascular bundle development and its use. Specifically, the present invention relates to an isolated gene involved in soybean nodule vascular bundle development or regulating the number of soybean nodules, wherein the coding region sequence of the gene is shown in SEQ ID NO: 1 or a homologous sequence thereof. The present invention also provides a method for regulating the number of plant nodules, comprising introducing the gene described above, or a sequence that inhibits the expression of the gene described above, into target plant cells or tissues to obtain a transgenic plant, wherein the number of nodules in the transgenic plant is altered compared to the target plant, and the plant is a legume, preferably soybean. In addition, the present invention also provides the use of the gene described above, or the sequence that inhibits the expression of the gene described above, in cultivating legumes, such as soybeans, with altered nodule numbers.

Description

Technical Field

[0001] The present invention belongs to the fields of biotechnology and botany, and in particular relates to a gene GmHB21 that participates in soybean nodule vascular bundle development and thus regulates nodule symbiotic nitrogen fixation, and an application thereof. Background Art

[0002] Root nodulation refers to the symbiotic relationship between the roots of legumes and rhizobia. Rhizobia form nodules within the plant roots and convert atmospheric nitrogen into plant-usable ammonia (NH3). This process, known as nitrogen fixation, is crucial for plant growth and the nitrogen cycle in ecosystems. Vascular formation is not only crucial for plant transport and structural support, but also plays a key role in root nodulation. Vascular bundles participate in nutrient transport in root nodule symbiosis. The phloem within the vascular bundles transports photosynthetic products (such as sucrose) from leaves to nodules. These photosynthetic products are the primary source of energy for nitrogen fixation by rhizobia. Xylem transports minerals and water from the roots to other parts of the plant, including the nodules. Nitrogen fixation requires water and minerals, so xylem functions are also crucial to root nodulation. Vascular bundles provide essential structural support for nodules, enabling their normal development and maintenance. The combination of lignin and cellulose gives nodules the strength they need to support nitrogen fixation. The vascular system is also involved in the transport of plant hormones, such as auxin and cytokinin, which play a key role in regulating the formation and development of root nodules. For example, auxin promotes nodule formation, while cytokinin promotes cell division and nodule growth. The vascular system also participates in the plant's immune response. Once rhizobia enter the root system, the plant needs to recognize them and establish a mutually beneficial symbiotic relationship. The vascular system helps transmit immune signals during this process, ensuring that the rhizobia are not recognized as potential pathogens.

[0003] The root nodule vascular bundle plays an indispensable role in the symbiotic relationship between legumes and rhizobia. Its diverse functions ensure that legumes can efficiently utilize nitrogen resources and maintain a mutually beneficial symbiotic relationship with rhizobia. Research on the root nodule vascular bundle can help improve legume productivity, optimize the symbiotic relationship, increase nitrogen fixation efficiency, and reduce dependence on chemical fertilizers. Furthermore, by studying the functions of the root nodule vascular bundle, novel biological nitrogen fixation technologies can be developed for application in non-legume crops, further promoting sustainable agricultural development. Summary of the Invention

[0004] In-depth research on the symbiotic mechanism between legumes and rhizobia is crucial for improving nitrogen fixation efficiency and expanding its scope of application. For example, non-legumes can be modified through genetic engineering so that they can establish a similar symbiotic relationship with rhizobia, thereby achieving a wider range of agricultural applications. The application prospects of nodule nitrogen fixation technology in agricultural production are broad. Through continuous basic research and technological innovation, it is expected to achieve a more efficient nitrogen cycle and more sustainable agricultural development in the future. This knowledge provides a theoretical basis for the transformation of non-legumes. The purpose of the present invention is to provide a gene GmHB21 that participates in the development of soybean nodule vascular bundles and thus regulates nodule symbiotic nitrogen fixation and its application.

[0005] Using molecular biology and transcriptomics, the inventors cloned a gene (referred to herein as GmHB21) that regulates vascular development in soybean (Glycine max) from the Chinese soybean line Zhonghuang 13. The GmHB21 encoding gene is located at Chr11: 4910619-4913061 in the sequenced genome of Gmax_ZH13_V2.0. GmHB21 is specifically expressed in the vascular bundles of nodules. The cloning of GmHB21 provides a theoretical basis and genetic resources for the subsequent genetic engineering of non-legume plants to form nodules.

[0006] In a specific embodiment of the present invention, the coding region sequence of the GmHB21 gene is shown in SEQ ID NO: 1. In a specific embodiment of the present invention, the amino acid sequence of the GmHB21 gene is shown in SEQ ID NO: 2.

[0007] The inventors discovered that the GmHB21 promoter contains multiple sites (CTCTT and AAAGAT) recognized by rhizobia within its 2000-bp sequence. Further GUS staining experiments driven by the GmHB21 promoter demonstrated that the GmHB21 gene is primarily expressed in the vascular cells of the nodules. When the GmHB21 protein is expressed via RNAi using plant expression vectors such as Agrobacterium rhizogenes, the number of nodules in the resulting transgenic roots is significantly reduced compared to the source strain. Further USDA110 GUS infection experiments using transgenic and control roots revealed that the reduction in nodule number is due to the blockage of the early FOCI infection process by rhizobia, indicating that the proper expression of genes involved in vascular bundle establishment after rhizobium infection is crucial for nodule formation. This effect was unexpected based on existing techniques. Therefore, the present application provides an isolated protein associated with soybean nodule vascular development and, for the first time, annotates the function of its coding sequence in the soybean genome.

[0008] In the present invention, existing plant expression vectors can be used to construct recombinant vectors containing the target gene. These include binary Agrobacterium vectors and vectors suitable for plant microprojectile bombardment. To facilitate identification and screening of transgenic plant cells or plants, the plant expression vectors can be modified, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants and produce color changes, antibiotic resistance markers, or chemical resistance marker genes. For safety reasons, the transgenic plants can be screened directly for transformed plants using stress without the addition of any selectable marker genes. The plant expression vectors can also contain enhancers to increase expression of the inserted nucleotide fragments.

[0009] To achieve the above objectives, the present invention also provides a method for obtaining transgenic hairy roots, which comprises introducing the aforementioned gene or a vector or host cell containing the aforementioned gene into target soybeans, thereby obtaining a legume plant, such as soybean hairy roots, that exhibits an altered number of nodules compared to the target plant, soybean.

[0010] To achieve the above objectives, the present invention also provides a use of the aforementioned protein or gene or a vector or host cell comprising the aforementioned gene in genetic engineering of leguminous plants such as soybeans.

[0011] The soybean nodule vascular bundle development-related protein and its encoding nucleic acid provided by the present invention are both newly discovered by the applicants to regulate soybean nodule number. Phenotypic analysis of transgenic hairy roots and vector-transfected hairy roots has demonstrated that inhibiting the expression of the soybean nodule vascular bundle development-related protein can reduce the number of nodules in transgenic soybean hairy roots. This invention will have significant theoretical and applied value for the study of soybean nodule development and related applications.

[0012] Specifically, the present invention provides the following technical solutions:

[0013] In one aspect, the present invention provides an isolated gene involved in soybean nodule vascular bundle development or regulating soybean nodule number, wherein the coding region sequence of the gene is shown in SEQ ID NO: 1 or a homologous sequence thereof.

[0014] In another aspect, the present invention provides a protein involved in soybean nodule vascular bundle development or regulating soybean nodule number, wherein the amino acid sequence of the protein is shown in SEQ ID NO: 2 or a homologous sequence thereof.

[0015] On the other hand, the present invention provides an expression vector comprising the gene as described above or the nucleotide sequence encoding the protein as described above, or comprising a sequence that inhibits the expression of the gene or protein as described above, such as an interfering sequence of the gene or an interfering sequence of the nucleotide sequence encoding the protein.

[0016] In some embodiments, the interfering sequence is shown as SEQ ID NO:3.

[0017] In some embodiments, the expression vector comprises a marker, optionally, the marker is selected from a luminescent marker, an antibiotic marker and a chemical resistance marker, optionally, the luminescent marker is selected from a red fluorescent protein and a green fluorescent protein, the antibiotic marker is selected from an ampicillin marker, a chloramphenicol marker, a kanamycin marker, a neomycin marker, a rifampicin marker, a spectinomycin marker, a hygromycin marker, a streptomycin marker and a tetracycline marker, and the chemical resistance marker is a herbicide resistance marker.

[0018] In another aspect, the present invention provides a host cell comprising the expression vector described above.

[0019] On the other hand, the present invention provides a method for obtaining soybean hairy roots, which comprises transforming the gene as described above or the nucleotide sequence encoding the protein as described above, or the sequence that inhibits the expression of the gene or protein as described above, or the expression vector or host cell as described above into a legume plant such as soybean cells or tissues and cultivating transgenic hairy roots, optionally, the number of nodules of the transgenic hairy roots is changed.

[0020] In some embodiments, the vector is a plant expression vector, including a binary Agrobacterium rhizogenes vector and / or a vector that can be used for plant microprojectile bombardment.

[0021] In some embodiments, the host cell is selected from the group consisting of an Escherichia coli cell, an Agrobacterium cell (eg, an Agrobacterium rhizogenes cell), and a plant cell.

[0022] In some embodiments, the Agrobacterium rhizogenes is selected from K599, AR1193, C58cl, Arqual, MSU440, LBA9402, and R1601.

[0023] On the other hand, the present invention provides the use of the gene as described above or the nucleotide sequence encoding the protein as described above, or the sequence that inhibits the expression of the gene or protein as described above, or the expression vector or host cell as described above in cultivating legumes such as soybeans with altered nodule number.

[0024] In some embodiments, the change in nodule number is manifested as an increase in the number of nodules and / or the number of individual nodules.

[0025] In some embodiments, the change in nodule number is manifested as a decrease in the number of nodules and / or the number of individual nodules.

[0026] On the other hand, the present invention provides a method for regulating the number of plant nodules, which comprises introducing the gene as described above or the nucleotide sequence encoding the protein as described above, or the sequence inhibiting the expression of the gene or protein as described above, or the expression vector or host cell as described above into the target plant cell or tissue to obtain a transgenic plant, wherein the number of nodules of the transgenic plant is changed compared with the target plant, and the plant is a leguminous plant, preferably soybean, and optionally, the change in the number of nodules is manifested as an increase in the number of nodules and / or the number of nodules per root, and optionally, the change in the number of nodules is manifested as a decrease in the number of nodules and / or the number of nodules per root.

[0027] definition

[0028] Coding region sequence: The coding region is the portion of the transcript that is actually translated into protein, namely the sequence of exons. It represents the sequence within the gene that encodes amino acids and serves as the direct template for protein synthesis. Coding regions typically do not include introns, as introns are spliced ​​out during post-transcriptional processing, leaving only the protein-encoding exon sequence. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The functional analysis and verification of the gene GmHB21 involved in soybean nodule vascular development are shown.

[0030] A: Location of two Rhizobium consensus motifs in the GmHB21 promoter. The 2,000 bp sequence preceding the gene's transcription start site is identified as the promoter.

[0031] B: Expression pattern of GmHB21 pro::GUS during nodule formation. Transverse sections of roots infected with rhizobia are shown. Bar = 100 µm.

[0032] C: USDA110-GUS staining reveals four infection events, representing the infection stages. Foci: focus of infection; IT: infection filament that has completely penetrated the root hair; cIT: infection filament that has penetrated the root hair and branched into the cortex; NP: nodule primordium. Bar = 50 µm.

[0033] Comparison of the number of four infection events in the control group, the GmHB21 RNAi strain, and the GmHB21 RNAi strain. Phenotypes were scored on day 5 after inoculation with USDA110-GUS. The three lines in the violin plot represent the 75th percentile, median, and 25th percentile, respectively. Unpaired two-tailed t-test; ns, not significant; ****p < 0.0001.

[0034] D: Nodulation phenotypes of the control group and the GmHB21 RNAi line.

[0035] E: Comparison of root nodule numbers between the control group and the GmHB21 RNAi line. Data are presented as mean ± standard error. Unpaired two-tailed t-test; ns, not significant; ****p < 0.0001.

[0036] F: Expression values ​​of GmHB21 gene in the control group and GmHB21 RNAi strain. DETAILED DESCRIPTION

[0037] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0038] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods or are selected according to the product specifications. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all repeated at least three times, and the results were averaged.

[0039] In the following examples, the soybean hairy root transformation recipient was Zhonghuang 13. Zhonghuang 13 was bred using pedigree methods through sexual hybridization using Yudou No. 8 as the female parent and Zhongzuo 90052-76 as the male parent, both from the Chinese Academy of Agricultural Sciences. This variety has a growing period of 100-105 days, 125-127 days after spring sowing. It has a determinate pod-setting habit, purple flowers with gray hairs, oval leaves, 3-5 effective branches, a 100-kernel weight of 24-26 grams, oval seeds with a yellow color and brown navel, high protein content, lodging resistance, strong disease resistance, and good commercial suitability. pDonor221 vector, pK7GWⅡRR vector, pKGWFS7-GUS-DsRed vector, Agrobacterium rhizogenes strain K599, and Bradyrhizobium diazoefficiens strain USDA110 were purchased from China Plasmid Vector, Strain, and Cell Gene Collection Center (Biovector Science Lab, Inc.).

[0040] Gateway, recovery kits and other consumables were purchased from Thermo Fisher Scientific and Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0041] Table 1 Gene name and gene number

[0042]

[0043] Example 1 Localization of the GmHB21 gene

[0044] 1. Construction of pKGWFS7-GUS-DsRed recombinant plasmid

[0045] 1. Separate the leaf tissue from soybean variety Zhonghuang 13 and extract DNA.

[0046] 2. Using the DNA extracted in step 1 as a template, perform PCR amplification using the primer pair consisting of F2 and R2 to obtain a PCR amplification product (SEQ ID NO: 4).

[0047] F2: 5'-caaaatcctctctcctctagaGGACAGGGTGAGAGAAAGTTGT-3' (SEQ ID NO: 5);

[0048] R2: 5'-gcccttgctcaccatccgcggAGTGTATGCATCAGCAGGGAAT-3' (SEQ ID NO: 6).

[0049] 3. Recover PCR products from gel.

[0050] 4. The PCR product from step 3 was ligated with pKGWFS7-GUS-DsRed (linearized by double digestion with XbaI and BsPTI) using the pEASY-Uni Seamless Cloning and Assembly Kit (TRAN CU101-03) to generate the recombinant plasmid GmHB21-pro-pKGWFS7-GUS-DsRed. Sequencing results confirmed that the recombinant plasmid GmHB21-pro-pKGWFS7-GUS-DsRed vector contained the double-stranded DNA molecule shown in SEQ ID NO: 4 in the sequence listing. Based on the sequencing results, the structure of the recombinant plasmid GmHB21-pro-pKGWFS7-GUS-DsRed was described as follows: the double-stranded DNA molecule shown in SEQ ID NO: 4 in the sequence listing was inserted between the XbaI and BsPTI residues of the pK7GWⅡRR vector, confirming that the expression cassette was constructed.

[0051] 2. Obtaining transgenic hairy roots of GmHB21-pro-pKGWFS7-GUS-DsRed

[0052] 1. The recombinant plasmid GmHB21-pro-pKGWFS7-GUS-DsRed was introduced into Agrobacterium rhizogenes strain K599 to obtain recombinant Agrobacterium, which was frozen at -80°C and stored in glycerol.

[0053] 2. The Agrobacterium rhizogenes obtained in step 1 was used to transform the recipient plant Zhonghuang 13 using the hairy root transformation method. The specific steps are as follows:

[0054] (1) Select large, plump, and spot-free Zhonghuang 13 soybean seeds.

[0055] (2) The selected seeds were sown in vermiculite and germinated in a greenhouse for 3 days. The soybean cotyledons were transformed when they were about to open.

[0056] (4) When sowing seeds, streak Agrobacterium rhizogenes K599 containing the target vector on solid LB medium and culture in a 28°C incubator for about 2 days. One day before infection, pick a single colony and inoculate it into 3-5 mL of LB liquid medium containing rifampicin (50 μg / mL), streptomycin (10 μg / mL), and spectinomycin (100 μg / mL), and culture it in a shaking incubator at 28°C overnight.

[0057] (5) When the OD600 of the bacterial solution was about 0.8, the cells were collected by centrifugation at 5000 rpm for 6 min and resuspended in infection solution (10 MM MES (2-morpholinoethanesulfonic acid) and 10 MM MgCl2) to infect soybean hypocotyls.

[0058] (6) Use the puncture injection method to infect the hypocotyl of the seedling. The injection site is selected to penetrate the middle of the hypocotyl below the cotyledon and leave two drops of injection solution on both sides of the stem.

[0059] (7) After the injection is complete, fill the black tray with water, cover it with a transparent lid, and secure it with tape (rooting in a high humidity environment). Incubate at 28°C for 9-14 days to induce transgenic hairy roots on the hypocotyl. Cut the hairy roots and soak them in a disposable plastic cup filled with water to continue incubation until the roots elongate.

[0060] (8) dsRED screening label, observe with green fluorescence, and screen positive roots.

[0061] (9) Transplant the positive plants into pure vermiculite for cultivation.

[0062] 3. GUS staining of GmHB21-pro-pKGWFS7-GUS-DsRed transgenic positive roots

[0063] 1. Rhizobium inoculation treatment

[0064] (1) 1 mL of Bradyrhizobium diazoefficiens strain USDA110 stored at -80°C was added to 200 mL of TY liquid medium (5 g / L tryptone, 3 g / L yeast extract, 0.7 g / L CaCl2·2H2O) containing 50 mg / L spectinomycin. The culture was shaken at 28°C and 200 rpm for about 4 days until the OD600 was between 0.8 and 1.

[0065] (2) Collect the bacterial suspension in a 500 mL centrifuge bottle and centrifuge at 6000 rpm for 10 min. Resuspend the bacterial cells in sterilized ddH2O to an OD600 of approximately 0.04 for inoculation.

[0066] (3) Each seedling was inoculated with 50 mL of resuspended bacterial solution.

[0067] (4) The roots were stained with GUS 5 days after inoculation.

[0068] 2. GUS staining

[0069] (1) Place the positive roots in 90% acetone and vacuum fix for 30 minutes (acetone has strong penetrating power and can precipitate and solidify proteins, but does not affect the functional groups of proteins and preserves the activity of proteins. It is effective in fixing phosphatases and oxidases, so it can be used for fixation before GUS staining to prevent the spread of GUS signals. It is characterized by fast fixation, strong penetrating power, and easy to cause tissue cells to shrink; but its ability to maintain cell structure is poor).

[0070] (2) Add GUS solution to wash away the acetone and wash twice.

[0071] (3) Add GUS staining solution (a solution of 0.5 mM potassium ferrocyanide, 0.5 mM potassium ferrocyanide, 0.5 mg / mL 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-glucose), 0.1% (v / v) Triton X-100, and 0.1 M sodium phosphate buffer (pH = 7.0)) and vacuum on ice for 15-20 min.

[0072] (4) Place at 37°C overnight and observe the staining.

[0073] (5) Aspirate the staining solution and add 1 mL of 70% ethanol to stop the staining reaction and decolorization.

[0074] (6) Replace the ethanol several times until the decolorization is complete.

[0075] (7) Embed with 4% agarose, vibrate and slice, collect the nodule slices and observe and photograph them under an optical microscope. The GUS staining showed that the gene promoter is expressed in the nodule vascular bundle ( Figure 1 B).

[0076] Example 2 Establishment of GmHB21 gene-silenced transgenic plants

[0077] Based on extensive sequence analysis and functional validation, a transcription factor, HD-ZIP I, was discovered in the soybean variety Zhonghuang 13 and named GmHB21, which regulates nodule development. The coding sequence is shown in SEQ ID NO:1, and the encoded protein sequence is shown in SEQ ID NO:2. Given that soybean plants possess the GmHB21 gene, the present invention investigated its function through gene silencing.

[0078] 1. Construction of GmHB21-pK7GWⅡRR recombinant plasmid

[0079] 1. The nodule tissue of soybean variety Zhonghuang 13 was separated from the root, RNA was extracted and reverse transcribed to obtain cDNA of the nodule tissue of soybean variety Zhonghuang 13.

[0080] 2. Using the cDNA synthesized in step 1 as a template, PCR amplification was performed using a primer pair consisting of F1 and R1 to obtain a PCR amplification product (SEQ ID NO: 3).

[0081] F1: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATTGGACCCACCATTCTTTGGG-3' (SEQID NO: 7);

[0082] R1: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTACACGGCACACTATTGGTCT-3' (SEQ ID NO: 8).

[0083] 3. Recover PCR products from gel.

[0084] 4. The PCR product from step 3 was ligated with the intermediate vector pDonor221 using BP Clonase™ II enzyme mix (Invitrogen 11789-020) to generate the recombinant plasmid GmHB21-pDonor221. Sequencing results confirmed that the recombinant plasmid GmHB21-pDonor221 contained a double-stranded DNA molecule (SEQ ID NO: 3) inserted into the pDonor221 vector.

[0085] 5. The plasmid GmHB21-pDonor221 obtained in step 4 was ligated with the final vector pK7GWⅡRR using LR CLONASEII ENZYME MIX (Invitrogen 11791-020) to generate the recombinant plasmid GmHB21-pK7GWⅡRR. Based on sequencing results, the structure of the recombinant plasmid GmHB21-pK7GWⅡRR was described as follows: a double-stranded DNA molecule (SEQ ID NO: 3) was inserted between attR1 and attR2 of the pK7GWⅡRR vector, confirming that the expression cassette was constructed.

[0086] 2. Obtaining GmHB21 gene-silenced transgenic hairy roots

[0087] 1. The recombinant plasmid GmHB21-pK7GWⅡRR was introduced into Agrobacterium rhizogenes strain K599 to obtain recombinant Agrobacterium, which was frozen at -80°C and stored in glycerol.

[0088] 2. The Agrobacterium rhizogenes obtained in step 1 was used to transform the recipient plant Zhonghuang 13 using the hairy root transformation method. The specific steps are as follows:

[0089] (1) Select large, plump, and spot-free Zhonghuang 13 soybean seeds.

[0090] (2) The selected seeds were sown in vermiculite and germinated in a greenhouse for 3 days. The soybean cotyledons were transformed when they were about to open.

[0091] (4) When sowing seeds, streak Agrobacterium rhizogenes K599 containing the target vector on solid LB medium and culture in a 28°C incubator for about 2 days. One day before infection, pick a single colony and inoculate it into 3-5 mL of LB liquid medium containing rifampicin (50 μg / mL), streptomycin (10 μg / mL), and spectinomycin (100 μg / mL), and culture it in a shaking incubator at 28°C overnight.

[0092] (5) When the OD600 of the bacterial solution was about 0.8, the cells were collected by centrifugation at 5000 rpm for 6 min and resuspended in infection solution (10 MM MES and 10 MM MgCl2) for infection of soybean hypocotyls.

[0093] (6) Use the puncture injection method to infect the hypocotyl of the seedling. The injection site is selected to penetrate the middle of the hypocotyl below the cotyledon and leave two drops of injection solution on both sides of the stem.

[0094] (7) After the injection is complete, fill the black tray with water, cover it with a transparent lid, and secure it with tape (rooting in a high humidity environment). Incubate at 28°C for 9-14 days to induce transgenic hairy roots on the hypocotyl. Cut the hairy roots and soak them in a disposable plastic cup filled with water to continue incubation until the roots elongate.

[0095] (8) dsRED screening label, observe with green fluorescence, and screen positive roots.

[0096] (9) Transplant the positive plants into pure vermiculite for cultivation.

[0097] Example 3 Changes in the number of nodules during GmHB21 gene silencing

[0098] 1. Rhizobium inoculation treatment

[0099] (1) 1 mL of Bradyrhizobium diazoefficiens strain USDA110 stored at -80°C was added to 200 mL of TY liquid medium (5 g / L tryptone, 3 g / L yeast extract, 0.7 g / L CaCl2·2H2O) containing 50 mg / L spectinomycin. The culture was shaken at 28°C and 200 rpm for about 4 days until the OD600 was between 0.8 and 1.

[0100] (2) Collect the bacterial suspension in a 500 mL centrifuge bottle and centrifuge at 6000 rpm for 10 min. Resuspend the bacterial cells in sterilized ddH2O to an OD600 of approximately 0.04 for inoculation.

[0101] (3) Each seedling was inoculated with 50 mL of resuspended bacterial solution.

[0102] (4) GUS staining was performed 5 days after inoculation, and nodulation phenotype was observed 21 days after inoculation.

[0103] 2 GUS staining

[0104] (1) Place the positive roots in 90% acetone and vacuum fix for 30 minutes (acetone has strong penetrating power and can precipitate and solidify proteins, but does not affect the functional groups of proteins and preserves the activity of proteins. It is effective in fixing phosphatases and oxidases, so it can be used for fixation before GUS staining to prevent the spread of GUS signals. It is characterized by fast fixation, strong penetrating power, and easy to cause tissue cells to shrink; but its ability to maintain cell structure is poor).

[0105] (2) Add GUS solution to wash away the acetone and wash twice.

[0106] (3) Add GUS staining solution (a solution of 0.5 mM potassium ferrocyanide, 0.5 mM potassium ferrocyanide, 0.5 mg / mL 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-glucose), 0.1% (v / v) Triton X-100, and 0.1 M sodium phosphate buffer (pH = 7.0)) and vacuum on ice for 15-20 min.

[0107] (4) Place at 37°C overnight and observe the staining.

[0108] (5) Aspirate the staining solution and add 1 mL of 70% ethanol to stop the staining reaction and decolorization.

[0109] (6) Replace the ethanol several times until the decolorization is complete.

[0110] (7) After staining, observe the period of rhizobium infection under an optical microscope and make statistics. Figure 1 As shown in C. Figure 1 As shown in Figure C, the number of rhizobia in GmHB21-RNAi soybean hairy roots at the FOCI stage was significantly higher than that in the empty vector control roots, and the number at the NP stage was significantly lower than that in the empty vector control roots. This indicates that the GmHB21 gene is involved in the early formation of nodules.

[0111] 3. Nodule number phenotypic statistics and analysis

[0112] 21 days after inoculation, the vermiculite was washed off with tap water and dried with absorbent paper. Green fluorescent light was used to confirm the positive soybean hairy roots of empty vector and GmHB21-RNAi transfection. The number of nodules in the hairy roots of GmHB21-RNAi transfection was significantly lower than that in the control ( Figure 1 D) The inventors counted the number of nodules in the hairy roots transfected with GmHB21-RNAi and those transfected with an empty vector. Figure 1 As shown in E. Figure 1 D and Figure 1 As can be seen in E, the average number of hairy root nodules (number of nodules per root) of the GmHB21-RNAi transgenic line was only 28.3% of that of the empty vector control, indicating that the GmHB21 gene is involved in the development of soybean nodules.

[0113] 3. Identification of gene expression

[0114] The hairy roots of the empty vector and the hairy roots of the GmHB21 gene silenced were identified as follows:

[0115] (1) Roots and nodules were collected, total RNA was extracted, and reverse transcribed into cDNA.

[0116] (2) Using the cDNA extracted in step (1) as a template, the primer pair consisting of F and R was used to identify the expression level of the GmHB21 gene, and the primer pair F2 and R2 was used to identify the expression level of the internal reference gene (Actin gene).

[0117] Quantitative PCR amplification conditions were as follows: initial denaturation at 95°C for 5 min; amplification (45 cycles) at 95°C for 10 s, 59°C for 15 s, and 72°C for 20 s. Melting curve analysis was performed after the completion of the amplification cycle: 95°C for 5 s, 65°C for 1 min, and then 65-97°C (temperature increments at 0.11°C / s).

[0118] The expression levels of GmHB21 gene in different materials obtained by quantitative PCR amplification using the cDNA as a template and various specific primer pairs are shown in FIG. Figure 1 F. From Figure 1 As can be seen in Figure F, in the gene silencing strain GmHB21-RNAi, the gene expression level of GmHB21 was significantly reduced, with a P value of <0.0001.

[0119] Table 2 Quantitative identification primers:

[0120]

[0121] sequence

[0122] SEQ ID NO:1 GmHB21 coding region sequence

[0123] ATGAATCATCGACCACCTTTCCAAGACCACATGATGCTCATGTCTCAGTTATTCCCTGCTGATGCATACACTCAAATTATTTCTCAACAAGGAGAGACTAATAAGAAGCCAAGACGCCGTCGTAACAAGAAGAACAAAGGAGGAGAAAACGGTGCCTCGGAAGCCAACAAGAAGAGGAAGCTTAGTGAGGTGCAAGTTAATTTACTTGAACAAAACTTTGGAAATGAACGCAAACTTGACTCCGAAAGAAAGGATAGGCTGGCAATGGAGCTTGGTTTGGACCCTCGACAAGTTGCTGTGTGGTTTCAAAACAGAAGAGCCCGTTGGAAGAACAAAAAGTTGGAAGAAGAGTACTCCAGCCTTAAAAAAAATCATGAAGCCACCTTGCTTGAGAAATGTTGCCTGGAGAGTGAGGTGTTGAAGCTCAAAGAGCAACTTTCTGAGGCAGAGAAAGAGATTCAGAGGCTGCTAGAGAGTGCCGAGAGAGTCCCAAGCAACAGTTCTAGTTCGTCACAGTCACAATCAATGGAAGCGGTGGACCCACCATTCTTTGGGGAATTTGGAGTTGATGGATATGAGGATGATGTGTTTTACGTGCCTGAGACCCATTACATCAACGGCATGGAATGGATTAATCTGTATATGTAA

[0124] SEQ ID NO:2 Protein sequence encoded by GmHB21

[0125] MNHRPPFQDHMMLMSQLFPADAYTQIISQQGETNKKPRRRRNKKNKGGENGASEANKKRKLSEVQVNLLEQNFGNERKLDSERKDRLAMELGLDPRQVAVWFQNRRARWKNKKLEEEYSSLKKNHEATLLEKCCLESEVLKLKEQLSEAEKEIQRLLESAERVPSNSSSSSQSQSMEAVDPPFFGEFGVDGYEDDVFYVPETHYINGMEWINLYM

[0126] SEQ ID NO:3 GmHB21 RNAi fragment

[0127] TGGACCCACCATTCTTTGGGGAATTTGGAGTTGATGGATATGAGGATGATGTGTTTTACGTGCCTGAGACCCATTACATCAACGGCATGGAATGGATTAATCTGTATATGTAAAACTACCAATAGGAATTTAGAATTTTGTAGATAATGTGAATGGTCCAATGTATATTAATTGTTCCTAGCTAGCTAGGTAGCTAAGTGTGTTTGTTTCACTATGGTTTGGAAATTGGAAAGTATCCATTAACATAATAATTTGCAATTTGACCCGAAATGGTAGTAGTATCTTCGTTTGTGTGCAATGTCAGCTTATGTCAGCTATGAAGACCAATAGTGTGCCGTGT

[0128] SEQ ID NO:4 GmHB21 promoter fragment

[0129]

[0130] SEQ ID NO:5 Primer F2

[0131] 5'-caaaatcctctctcctctagaGGACAGGGTGAGAGAAAGTTGT-3'

[0132] SEQ ID NO:6 Primer R2

[0133] 5'-gcccttgctcaccatccgcggAGTGTATGCATCAGCAGGGAAT-3'

[0134] SEQ ID NO:7 Primer F1

[0135] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATTGGACCCAC

[0136] CATTCTTTGGG-3'

[0137] SEQ ID NO:8 Primer R1

[0138] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTACACGGCAC

[0139] ACTATTGGTCT-3'

[0140] SEQ ID NO:9 Primer GmHB21-F

[0141] ATGGAGCTTGGTTTGGACCC

[0142] SEQ ID NO: 10 Primer GmHB21-R

[0143] CCTCACTCTCCAGGCAACATT

[0144] SEQ ID NO: 11 Primer GmActin11-F

[0145] GAGCTATGAATTGCCTGATGG

[0146] SEQ ID NO: 12 Primer GmActin11-R

[0147] CGTTTCATGAATTCCAGTAGC

[0148] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for reducing the number of soybean nodules, characterized in that: A sequence that inhibits the expression of the GmHB21 protein is introduced into soybean cells or tissues to obtain transgenic soybeans with reduced nodule numbers. The GmHB21 protein sequence is shown in SEQ ID NO:

2.

2. The method according to claim 1, characterized in that The gene sequence encoding the GmHB21 protein is shown in SEQ ID NO:

1.

3. A method for reducing the number of soybean nodules, characterized in that: An expression vector containing a sequence for inhibiting the expression of GmHB21 protein is introduced into soybean cells or tissues to obtain transgenic soybeans with reduced nodule number. The GmHB21 protein sequence is shown in SEQ ID NO:

2.

4. The method according to claim 3, characterized in that The sequence that inhibits the expression of GmHB21 protein is the interference sequence.

5. The method according to claim 3, characterized in that The expression vector comprises a marker.

6. The method according to claim 5, characterized in that The label is selected from the group consisting of a luminescent label, an antibiotic label and a chemical-resistant label.

7. The method according to claim 6, characterized in that The luminescent marker is selected from red fluorescent protein and green fluorescent protein.

8. The method according to claim 6, characterized in that The antibiotic label is selected from the group consisting of an ampicillin label, a chloramphenicol label, a kanamycin label, a neomycin label, a rifampicin label, a spectinomycin label, a hygromycin label, a streptomycin label and a tetracycline label.

9. The method according to claim 6, characterized in that The chemical resistance marker is a herbicide resistance marker.

10. The method according to any one of claims 3 to 9, characterized in that The vector is a plant expression vector, including a binary Agrobacterium rhizogenes vector and / or a vector that can be used for plant microprojectile bombardment.

11. A method for reducing the number of soybean nodules, characterized in that: The Escherichia coli cells or Agrobacterium cells containing the expression vector according to any one of claims 3 to 10 are introduced into soybean cells or tissues to obtain transgenic soybeans with reduced nodule number.

12. The method according to claim 11, characterized in that The Agrobacterium cells are Agrobacterium rhizogenes cells.

13. The method according to claim 12, characterized in that The Agrobacterium rhizogenes is selected from K599, AR1193, C58cl, Arqual, MSU440, LBA9402 and R1601.

14. Use of the GmHB21 protein shown in SEQ ID NO: 2 in cultivating soybeans with reduced nodulation number, characterized in that: Inhibit the expression of GmHB21 protein.

Images