Gene osmyb1 and its application in negative regulation of anthocyanin synthesis
By knocking out the rice OsMYB1 gene using CRISPR/Cas9 technology, binding to the OsDFR promoter region and forming the MBW complex, the problem of slow progress in the study of rice anthocyanin synthesis regulation was solved, the anthocyanin content of purple rice was increased, and its nutritional value was enhanced.
Patent Information
- Application Number
- CN202510080496.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-18
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2045-01-18
AI Technical Summary
Research on transcriptional regulation of anthocyanin synthesis in rice is progressing slowly in the current technology, and there is a lack of genes and methods for negatively regulating anthocyanin synthesis, resulting in insufficient anthocyanin content in purple rice.
The OsMYB1 gene in rice was knocked out or knocked down using CRISPR/Cas9 gene editing technology. By binding to the promoter region of OsDFR, a key structural gene for anthocyanin synthesis, OsMYB1 inhibited the expression of OsDFR and formed an MBW ternary complex with OsB2 and OsPAC1 to competitively inhibit anthocyanin synthesis.
It significantly increased the anthocyanin content in rice leaves, providing a theoretical basis for cultivating high-quality purple rice with high anthocyanin content and improving the nutritional value of purple rice.
Smart Images

Figure CN119614592B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a gene OsMYB1 and application thereof in negative regulation of anthocyanin synthesis. BACKGROUND
[0002] Purple rice is an ancient and precious special rice in China, which is purple or black due to the accumulation of anthocyanin in pericarp and seed coat (Chen et al., 2016). Studies have found that the nutritional value of purple rice is higher than that of white rice, and it also contains anthocyanin, vitamin D, alkaloids and phytosterols and other bioactive substances. Anthocyanin is a phenolic compound synthesized in the cytoplasm of plant cells (Saigo et al., 2020). The intermediates of the pentose phosphate and glycolysis pathways are catalyzed by multiple enzymes to form phenylalanine, which then enters the phenylpropanoid biosynthesis pathway and the flavonoid biosynthesis pathway to synthesize various phenolic compounds including anthocyanin. The structural genes of anthocyanin synthesis have been well studied in rice, but the transcriptional regulation has been slow.
[0003] Therefore, it is necessary to develop a gene and a method capable of negatively regulating anthocyanin synthesis. SUMMARY
[0004] The present application aims to overcome the defects of the prior art, and provides a gene OsMYB1 and application thereof in negative regulation of anthocyanin synthesis. The negative regulation of the gene OsMYB1 in the regulation of anthocyanin synthesis in rice can increase the content of anthocyanin in rice, and provides a certain theoretical basis for breeding high-quality purple rice with high anthocyanin content.
[0005] To achieve the above-mentioned purpose, the present application is realized as follows:
[0006] In the first aspect of the present application, a gene OsMYB1 is provided, and the nucleotide sequence of the gene OsMYB1 is shown in SEQ ID NO: 1.
[0007] Further, the gene OsMYB1 has a nucleotide sequence with 80% or more homology, which is generated by adding, substituting, inserting or deleting one or more nucleotides to the nucleotide sequence shown in SEQ ID NO: 1.
[0008] In the second aspect of the present application, a protein encoded by the gene OsMYB1 is provided, and the protein has an amino acid sequence shown in SEQ ID NO: 2.
[0009] Further, the protein has an amino acid sequence with at least 90% homology to the amino acid sequence shown in SEQ ID NO. 2.
[0010] In a third aspect of the present application, a gene knockout or knockdown expression vector targeting the gene OsMYB1 is provided.
[0011] In a fourth aspect of the present application, a method for constructing a gene knockout or knockdown vector of the gene OsMYB1 is provided, the method comprising:
[0012] recombining the gRNA targeting the gene OsMYB1 into a CRISPR / Cas9 gene editing vector to obtain the knockout or knockdown vector.
[0013] Further, the nucleotide sequence of the gRNA targeting the gene OsMYB1 is shown in SEQ ID NO: 3.
[0014] In a fifth aspect of the present application, a transformant of the expression vector is provided.
[0015] In some embodiments, the transformant is Agrobacterium tumefaciens, and / or a plant cell (or organism); the organism is a transgenic plant, which is one of tomato, rice, corn, wheat, barley, tobacco, soybean, sorghum, cotton, hemp, peanut, oilseed rape, sugarcane, or sugar beet.
[0016] In a sixth aspect of the present application, a method for increasing the content of anthocyanin in plants is provided, the vector is used to mediate genetic transformation of plants by means of genetic engineering, and a transgenic plant is obtained to increase the content of anthocyanin in plants.
[0017] In a seventh aspect of the present application, the gene OsMYB1 or the protein is used in the negative regulation of anthocyanin synthesis.
[0018] In an eighth aspect of the present application, the expression vector or the expression vector prepared by the method or the transformant is used to increase the content of anthocyanin in plants.
[0019] The plant is at least one selected from tomato, rice, corn, wheat, barley, tobacco, soybean, sorghum, cotton, hemp, peanut, oilseed rape, sugarcane, or sugar beet.
[0020] The present application has the following beneficial effects:
[0021] The application proves by systematic molecular biology experiments that OsMYB1 inhibits the expression of OsDFR by binding to the promoter region of the key structural gene OsDFR of anthocyanin synthesis, thereby inhibiting the synthesis of anthocyanin. Meanwhile, OsMYB1 can also form an MBW ternary complex with OsB2 and OsPAC1 to competitively inhibit the synthesis of anthocyanin, indicating that the transcription factor OsMYB1 is a negative regulatory factor of rice anthocyanin synthesis, and knocking out the same can increase the content of rice anthocyanin, thereby providing a certain theoretical basis for cultivating high-quality purple rice with high anthocyanin content. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 OsMYB1 spatiotemporal specific expression analysis.
[0023] Figure 2 Two gene editing forms of homozygous mutant lines of OsMYB1.
[0024] Figure 3 Expression amount identification results of OsMYB1 in WT, KO-1 and KO-2.
[0025] Figure 4 Anthocyanin content determination of leaves of WT, KO-1 and KO-2, wherein A is the phenotype of leaves after OsMYB1 gene knockout, and B is the comparison of anthocyanin content of leaves after OsMYB1 gene knockout
[0026] Figure 5 Subcellular localization of OsMYB1.
[0027] Figure 6 Interaction relationship of OsMYB1, OsB2 and OsPAC1.
[0028] Figure 7 Dual luciferase reporter gene experiment verifies the negative regulation of OsMYB1 on the promoter of OsDFR. DETAILED DESCRIPTION
[0029] The advantages and various effects of the present application will be more clearly presented by the following specific embodiments and examples. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present application, not to limit the present application.
[0030] Throughout this specification, unless otherwise specifically indicated otherwise, the terms used herein are to be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which the present application belongs. If there is a contradiction, the present specification is preferred.
[0031] Unless otherwise specifically indicated, all materials, reagents, solvents, and the like used in the present application are commercially available or are readily prepared by known methods.
[0032] The technical solution of the embodiments of the present application is to solve the above technical problems, and the general idea is as follows:
[0033] The present application first identifies the OsMYB1 gene in rice and conducts systematic expression pattern analysis and functional research on the gene, and determines the negative regulation of the OsMYB1 gene in the regulation of anthocyanin synthesis in rice.
[0034] The results of real-time fluorescent quantitative PCR show that the gene is expressed in each tissue of rice at the seedling stage, tillering stage, heading stage and filling stage, and the relative expression level is the highest at the heading stage, and the expression level gradually increases at different periods after flowering, and then decreases at 30 days after flowering, which shows that the gene is closely related to the development process of the grain.
[0035] A CRISPR / Cas9 gene editing recombinant vector is constructed, and is introduced into purple rice 'Dianzixinu' through an Agrobacterium tumefaciens mediated method, and two homozygous mutants KO-1 and KO-2 are screened in the T1 generation. Compared with the wild type plant, the expression level of the OsMYB1 gene in the two homozygous mutant plants is significantly down-regulated. Compared with the wild type, the anthocyanin content in the leaves of the mutant plants is significantly increased, and the results show that the expression level of the gene affects the content of anthocyanin in the leaves of rice.
[0036] Through systematic molecular biology experiments, it is confirmed that OsMYB1 can inhibit the expression of OsDFR by combining the promoter region of the key structure gene OsDFR of anthocyanin synthesis, so as to inhibit the synthesis of anthocyanin. At the same time, OsMYB1 can also form an MBW ternary complex with OsB2 and OsPAC1, and competitively inhibit the synthesis of anthocyanin.
[0037] The present application clones the R2R3-MYB transcription factor OsMYB1 which negatively regulates anthocyanin synthesis from purple rice 'Dianzixinu'. OsMYB1 is edited in purple rice 'Dianzixinu' by using CRISPR / Cas9 technology, and the anthocyanin content of the leaves of the OsMYB1 gene edited plant and the wild type plant is compared. It is found that the anthocyanin content of the OsMYB1 gene edited plant is significantly higher than that of the wild type plant, which shows that the transcription factor OsMYB1 is a negative regulatory factor of anthocyanin synthesis in rice, and its knockout can increase the content of anthocyanin in rice, thereby providing a certain theoretical basis for breeding high-quality purple rice with high anthocyanin content.
[0038] The gene OsMYB1 and its application in the negative regulation of anthocyanin synthesis will be described in detail in combination with the embodiments.
[0039] Example 1, Spatiotemporal expression pattern analysis of OsMYB1
[0040] (1) Collection of tissue samples:
[0041] Purple rice 'Yunnan purple glutinous rice' was used as experimental material. Leaf and root were collected at seedling stage, leaf, leaf sheath and root were collected at tillering stage, pre-anthesis flag leaf, post-anthesis flag leaf, pre-anthesis spikelet and post-anthesis spikelet were collected at heading stage. The day of flowering was labeled, and the glume was collected at 7 days, 14 days, 21 days and 30 days after flowering. After sampling, the samples were immediately frozen with liquid nitrogen and stored in a -80°C refrigerator.
[0042] (2) RT-qPCR:
[0043] The above samples were ground into powder with liquid nitrogen, and total RNA was extracted using Takara total RNA extraction kit (9108). The specific method was operated according to the instruction manual. Then, Takara PrimeScript TM RT reagent Kit with gDNAEraser (RR047A) kit was used for cDNA synthesis, and the synthesis method was according to the instruction manual.
[0044] The primer sequence of OsMYB1 quantitative qPCR was:
[0045] F: 5'- ATCAGTTCTGTGCCGAGGATGC-3';
[0046] R: 5'- CGCCTAACTGCTCGTCGTTGA-3',
[0047] OsGAPDH was used as the internal reference gene, and the primer sequence was:
[0048] F: 5'- GCCTCCTCCTTGATTGC-3';
[0049] R: 5'- CTTTCCGTGTTCCCACA-3';
[0050] The reaction system and qPCR program of Takara TB Premix Ex Taq TM II (RR820A) were used, and the results were analyzed by 2 –△△Ct value method.
[0051] The spatiotemporal expression pattern of OsMYB1 gene was analyzed by RT-qPCR, and the results were shown in Figure 1The results show that the expression amount of the gene in the leaf is higher than that in the root in the seedling stage; the expression amount in the leaf and the root is lower and the expression amount in the sheath is higher in the tillering stage; the expression amount of the post-flowering flag leaf and the post-flowering spikelet is higher in the heading stage; the expression amount shows an upward trend at 14 days and 21 days after flowering and shows a downward trend at 30 days after flowering in the grain filling stage. In the whole development period, the expression amount of the OsMYB1 gene is the highest in the heading stage, and the expression amount shows a trend of first increasing and then decreasing in the development process of the glume and grain.
[0052] Example 2, anthocyanin content significantly increases after OsMYB1 knockout
[0053] 1. Construction of CRISPR / Cas9 recombination knockout vector
[0054] According to the sequence of the OsMYB1 gene in the rice genome, a target point is designed, and the gRNA sequence is
[0055] CCACAGCCTCCTCGGCAACA (SEQ ID NO. 3), primers F: 5'-cagtGGTCTCatgcaatcgcgtacatcagggcgcag'; R: 5'-cagtGGTCTCaaaacccacagcctcctcggcaac-3' are used for PCR amplification, and then gel recovery and purification; the gene editing vector is double enzyme digested by BsaI / Eco31I
[0056] pYL-HU-U3-CCDB-tRNA(K1) (purchased from Wuhan Boyuan Bioproducts Co., Ltd.), to obtain a linearized vector, and then the fragment is recombined and connected with the linearized vector by the Infusion recombinase of Takara Co., Ltd., to construct a CRISPR / Cas9 recombination knockout vector.
[0057] 2. Obtaining of OsMYB1 homozygous mutant
[0058] The recombination knockout vector obtained in the above step is used for agrobacterium infection of rice 'Yunnan purple glutinous' callus, genetic transformation is carried out, T0 generation gene editing plants are obtained, genomic DNA of the gene editing plants is extracted, primers F: 5'-GGCAGATTGGACAATCGCTCG'; R: 5'-GCTTGATGTGCGTGTTCCAG-3' are used for PCR amplification, and a fragment containing the target point is amplified and sent to Chengdu Biosynth for sequencing.
[0059] Single plant seed collection, the seeds of the homozygous mutant KO-1 and KO-2 plants are propagated, T1 generation is continuously sequenced and identified, and all are homozygous mutant plants. Due to the deletion of 1 / 2 bases in the target point region of the KO-1 and KO-2 plants, the stop codon appears in advance, the translation is terminated, and the function of the mutant OsMYB1 gene is changed.
[0060] Two homozygous mutants KO-1 and KO-2 were screened in T1 generation, and the edited forms are shown in Figure 2 Compared with wild type plants, the expression level of OsMYB1 gene in two homozygous mutant plants was significantly down-regulated Figure 3
[0061] 3. Anthocyanin content detection
[0062] The tillering stage leaves of WT, KO-1 and KO-2 were ground into powder with a mortar and added with liquid nitrogen, weighed, and then hydrolyzed with 1% hydrochloric acid solution, extracted at 70°C for 1 hour, centrifuged at 6000r / min for 10 min, and the supernatant was taken to determine the absorbance value at 525nm, and the anthocyanin content was calculated, C = 1 / 958 x v / 100 x 1 / m x ABS x 100000 (v: constant volume ABS: absorbance value).
[0063] The anthocyanin content in T1 generation leaves was detected by hydrochloric acid extraction method, and the results are shown in Figure 4 Compared with wild type, the anthocyanin content of mutant plants was significantly increased, and the results showed that the expression level of the gene affected the content of anthocyanin in rice leaves.
[0064] Example 3, Subcellular localization of OsMYB1
[0065] The cDNA sequence of OsMYB1 (without stop codon) was obtained by PCR amplification (as shown in SEQ ID NO. 1), and the vector pSuper1300-GFP (purchased from Point Biotechnology Co., Ltd., item number 5518) was linearized by HindIII and SalI double enzyme digestion, and the recombinant plasmid was obtained by homologous recombination enzyme ligation and fusion of GFP.
[0066] The constructed recombinant vector pSuper1300-OsMYB1-GFP was transformed into rice protoplast, and the GFP fluorescence signal was observed by laser confocal microscope.
[0067] The results are shown in Figure 5 It was found that OsMYB1 was located in the nucleus.
[0068] Example 4, Yeast two-hybrid experiment
[0069] 1. Vector construction
[0070] The CDS sequence of OsMYB1 was constructed into pGADT7 vector (commercially available, such as Youbao Biotechnology, product number VT1639) by homologous recombination to construct recombinant vector pGADT7-OsMYB1; the CDS sequences of OsPAC1 and OsB2 were homologously recombined into pGBKT7 vector (commercially available, such as Youbao Biotechnology, product number VT1638) to construct recombinant vectors pGBKT7-OsPAC1 and pGBKT7-OsB2, respectively.
[0071] The primer sequence of OsMYB1 is as follows:
[0072] F: 5'-GACGTACCAGATTACGCTCATATGatggggaggtcgccgtgc-3';
[0073] R: 5'-TCGATGCCCACCCGGGTGGAATTCtatgtactggccttgttccaac-3';
[0074] The primer sequence of OsPAC1 is as follows:
[0075] F: 5'-ATCTCAGAGGAGGACCTGCATATGatggagcagcccaagccg-3';
[0076] R: 5'-AGGTCGACGGATCCCCGGGAATTCtcagaccctgagaagctggac-3';
[0077] The primer sequence of OsB2 is as follows:
[0078] F: 5'-ATCTCAGAGGAGGACCTGCATATGatggcatctgctcctccagtt-3';
[0079] R: 5'-AGGTCGACGGATCCCCGGGAATTCttacggcgccttcccctgt-3'.
[0080] 2. Detection of self-activation activity of bait expression vector
[0081] The recombinant vectors pGBKT7-OsPAC1 and pGBKT7-OsB2 constructed in the previous step were co-transformed with pGADT7 empty vector into yeast Y2HGold, respectively, and were plated on SD / -Leu-Trp and SD / -Trp-Leu-His-Ade plates, respectively, and were incubated at 30°C for 3 days, and the growth of the yeast strains was observed.
[0082] 3. Protein interaction analysis
[0083] Different recombinant plasmids were co-transformed into yeast strain Y2HGold, and coated on SD / -Leu / -Trp medium, and after 3 days, positive clones were transferred to SD / -Leu / -Trp / -His / -Ade medium, and finally X-α-gal was added to the SD / -Leu / -Trp / -His / -Ade medium as a substrate for detecting β-galactosidase activity.
[0084] Results are shown in Figure 6 OsMYB1 can interact with OsB2 and OsPAC1 respectively to form a ternary complex to regulate the synthesis of rice anthocyanin.
[0085] Example 5, dual luciferase reporter gene experiment
[0086] 1. Vector construction
[0087] The CDS sequence of the transcription factor OsMYB1 (as shown in SEQ ID NO. 1) was recombined into the pGreenII 62-SK vector (purchased from Point Biotechnological Co., Ltd., item number 5239) by homologous recombination, and the primer sequences were F: 5'-GGCCGCTCTAGAACTAGTGGATCCATGGGGAGGTCGCCGTGC-3'; R: 5'-ATCGATAAGCTTGATATCGAATTCTATGTACTGGCCTTGTTCCAAC-3'.
[0088] The promoter sequence of the structural gene OsDFR is:
[0089]
[0090] The promoter sequence of OsDFR was recombined into pGreenII 0800-LUC vector (purchased from Pintech Bioengineering Co. Ltd, item No. 5240) with the primer sequences of
[0091] F: 5'-GAGGTCGACGGTATCGATAAGCTTACGTGCACGTAGCTCACA-3';
[0092] R: 5'-GGCCGCTCTAGAACTAGTGGATCCGCGTACCGTGCGTGATC-3'.
[0093] The recombinant vectors (pGreenII 62SK-OsMYB1 and pGreenII 0800-proOsDFR-LUC) and empty vector (pGreenII 62-SK) were transformed into Agrobacterium GV3101 respectively, and after dark culture at 28°C for 2-3 days, single colonies were picked and positive clones were identified by bacterial liquid PCR.
[0094] 2, Nicotiana benthamiana injection
[0095] The Agrobacterium containing the recombinant plasmid was inoculated into fresh REB liquid medium containing 50 mg / L Rif and cultured overnight until OD600=1.0. Under sterile conditions, the fresh bacterial solution was centrifuged at 4°C at 8000 rpm for 10 min in a 50 mL centrifuge tube, the supernatant was removed, and the bacterial solution was resuspended with osmotic medium (ddH2O containing 10 mM MgCl2, 10 mM MES and 200 μM acetosyringone, pH=5.6), and the bacterial solution concentration was adjusted to OD600=0.8. The bacterial solution was injected into the leaves of Nicotiana benthamiana plants with the same growth vigor at room temperature in the dark for 3 h.
[0096] 3, Luminescence detection
[0097] After 3 days of injection, the Dual-Luciferase Repoter Assay Kit (Vazyme, China) and multifunctional enzyme label EnVision (PerkinElmer, USA) were used for luminescence detection. First, the injection area was sampled into a 1.5ml centrifuge tube with a puncher, ground with liquid nitrogen, and 500μL of 1×Cell Lysis Buffer was added and vortexed for 5min. After centrifugation at 12000rpm for 2min, the supernatant was taken into a new 1.5mL centrifuge tube. 100μL of Luciferase Substrate and 20μL of lysate were added to a 96-well enzyme-labeled plate, and the Firefly luciferase reporter gene activity was detected after rapid mixing. Then 100μL of Renilla substrate working solution was added, mixed quickly, and the Renilla luciferase reporter gene activity was detected immediately.
[0098] The results are shown in Figure 7 It was found that the Luc / Ren ratio of the pGreenII 62SK-OsMYB1 and pGreenII 0800-proOsDFR-LUC co-transformed tobacco leaves in the experimental group was significantly lower than that in the control group, indicating that OsMYB1 negatively regulates the expression of OsDFR.
[0099] Finally, it should be noted that the terms "comprising", "including" or any other variant thereof are intended to cover non-exclusive inclusion, so that processes, methods, articles or equipment including a series of elements not only include those elements, but also include other elements not explicitly listed or inherent to such processes, methods, articles or equipment.
[0100] Although the preferred embodiments of the present application have been described, those skilled in the art can make further changes and modifications to these embodiments once they know the basic inventive concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present application.
[0101] Obviously, those skilled in the art can make various modifications and variations to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.
Claims
1. A method for increasing the anthocyanin content of a plant, characterized in that, Adopting gene targeting OsMYB1 The gene knockout or knockdown vector of the gene OsMYB1 The nucleotide sequence of the gene OsMYB1 The construction method of the knockout or knockdown vector of the gene The gRNA targeting gene OsMYB1 The nucleotide sequence of the gRNA of the targeting gene OsMYB1 is shown as SEQ ID NO: 3, and the plant is Dianzixinu rice.
2. The application of gene knockout or knockdown vectors targeting the OsMYB1, or transformants containing said vectors, in increasing the anthocyanin content of plants, wherein said gene... OsMYB1 OsMYB1 OsMYB1 OsMYB1 OsMYB1 OsMYB1 OsMYB1 OsMY The nucleotide sequence is shown in SEQ ID NO:1, and the plant is rice glutinous rice.