Key gene BPZ1 for regulating and controlling pathopoiesis and toxin production of penicillium expansum and application thereof

Abstract

The invention discloses a key gene BPZ1 for regulating and controlling pathopoiesis and toxin production of penicillium expansum and application of the key gene BPZ1. The invention provides application of PBZ1 protein or PBZ1 gene in regulating vegetative growth and / or reproductive growth and / or pathogenicity of penicillium expansum and / or patulin production capability. The PBZ1 protein is a protein as shown in SEQ ID NO: 1. The PBZ1 gene is a gene for coding PBZ1 protein. The inventor of the invention discovers and verifies the functions of the PBZ1 protein and the PBZ1 gene. The PBZ1 protein and the PBZ1 gene are ideal targets for controlling fruit rot and mycotoxin pollution. The fruit fresh-keeping agent can be used for fruit fresh-keeping and is beneficial to ensuring the quality and safety of fruits.

Description

Technical Field

[0001] The invention belongs to the field of plant pathology and microbial genetic engineering, and relates to a key gene BPZ1 for regulating the pathogenicity and toxin production of Penicillium expansum and a use thereof. Background Art

[0002] Fresh fruits are rich in nutrients and are an indispensable part of human diet and are closely related to health. However, every year in my country, a large amount of fruits suffer losses during storage, transportation and sales after harvest, with post-harvest decay caused by pathogenic fungi being the main cause.

[0003] Penicillium expansum belongs to the subphylum Ascomycota, the order Eurotiales, and the genus Penicillium. It is one of the most important pathogenic fungi in postharvest fruits. It can infect a variety of widely consumed fruits such as apples, pears, peaches, and grapes, causing serious postharvest rot. In the process of infecting fruits, Penicillium expansum also produces an important mycotoxin, patulin, which can enter the food chain with processed products such as juice and exist stably for a long time, posing a great hidden danger to food safety and a huge threat to human health.

[0004] There are currently no crop varieties resistant to Penicillium in production practice, and the prevention and control of post-harvest Penicillium still mainly relies on chemical fungicides. However, due to the strong adaptability of Penicillium to the environment and its rapid reproduction and spread, its prevention and control is very difficult and it is easy to develop drug resistance. Long-term use of pesticides will not only cause environmental pollution, but may also cause food safety problems. Therefore, in production, it is urgent to develop more effective prevention and control strategies for post-harvest Penicillium in fruits, and a deep understanding of the pathogenesis and pathogenic mechanism of Penicillium will provide an important basis for this. Summary of the invention

[0005] The purpose of the present invention is to provide a key gene BPZ1 for regulating the pathogenicity and toxin production of Penicillium expansum and its use.

[0006] The present invention provides a protein derived from Penicillium expansum, named as PBZ1 protein, which is as follows (a1) or (a2) or (a3) ​​or (a4):

[0007] The PBZ1 protein is as follows (a1) or (a2) or (a3) ​​or (a4):

[0008] (a1) the protein shown in SEQ ID NO: 1;

[0009] (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0010] (a3) a protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1) and having the same function as (a1);

[0011] (a4) A protein derived from Penicillium expansum and having 98% or more identity with (a1) and having the same function as (a1).

[0012] The PBZ1 protein plays an important regulatory role in the vegetative growth and / or reproductive growth and / or pathogenicity and / or toxin production ability of Penicillium expansum.

[0013] The gene encoding the PBZ1 protein, named as the PBZ1 gene, also belongs to the protection scope of the present invention.

[0014] Specifically, the PBZ1 gene molecule is as follows (b1) or (b2) or (b3) or (b4) or (b5):

[0015] (b1) a DNA molecule whose coding region is shown in SEQ ID NO: 2;

[0016] (b2) the DNA molecule shown at positions 1001-1812 in SEQ ID NO: 3;

[0017] (b3) the DNA molecule shown in SEQ ID NO: 3;

[0018] (b4) a DNA molecule derived from Penicillium expansum and having 95% or more identity with (b1) or (b2) or (b3) and encoding the protein;

[0019] (b5) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) or (b3) under stringent conditions and encodes the protein.

[0020] The above stringent conditions can be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65°C and washing the membrane in a DNA or RNA hybridization experiment.

[0021] The present invention also protects the application of PBZ1 protein or PBZ1 gene in negatively regulating the nutritional growth of Penicillium expansum.

[0022] The abundance of PBZ1 protein increased and the vegetative growth of Penicillium expansum was weakened.

[0023] The abundance of PBZ1 protein was reduced and the vegetative growth of Penicillium expansum was enhanced.

[0024] The abundance of PBZ1 gene increased and the vegetative growth of Penicillium expansum was weakened.

[0025] The abundance of the PBZ1 gene decreased and the vegetative growth of Penicillium expansum was enhanced.

[0026] The present invention also protects the use of PBZ1 protein or PBZ1 gene in positively regulating the reproductive growth of Penicillium expansum.

[0027] Specifically, the reproductive growth is manifested as spore production ability.

[0028] Increased abundance of PBZ1 protein enhanced the reproductive growth of Penicillium expansum.

[0029] The abundance of PBZ1 protein decreased and the reproductive growth of Penicillium expansum was weakened.

[0030] The abundance of the PBZ1 gene increased and the reproductive growth of Penicillium expansum was enhanced.

[0031] The abundance of the PBZ1 gene decreased and the reproductive growth of Penicillium expansum was weakened.

[0032] The present invention also protects the use of PBZ1 protein or PBZ1 gene in positively regulating the pathogenicity of Penicillium expansum.

[0033] Increased abundance of PBZ1 protein enhances the pathogenicity of Penicillium expansum.

[0034] The abundance of PBZ1 protein decreased and the pathogenicity of Penicillium expansum was weakened.

[0035] The increased abundance of the PBZ1 gene enhanced the pathogenicity of Penicillium expansum.

[0036] The abundance of PBZ1 gene decreased and the pathogenicity of Penicillium expansum was weakened.

[0037] The present invention also protects the use of PBZ1 protein or PBZ1 gene in positively regulating the ability of Penicillium to produce patulin.

[0038] The abundance of PBZ1 protein increased, and the ability of Penicillium expansum to produce patulin was enhanced.

[0039] The abundance of PBZ1 protein decreased and the ability of Penicillium expansum to produce patulin was weakened.

[0040] The abundance of PBZ1 gene increased, and the ability of Penicillium expansum to produce patulin was enhanced.

[0041] The abundance of the PBZ1 gene decreased, and the ability of Penicillium expansum to produce patulin was weakened.

[0042] The present invention also provides a method for preparing a recombinant Penicillium expansum with reduced reproductive growth ability, comprising the following steps: inhibiting the expression of the PBZ1 gene in the target Penicillium expansum to obtain a recombinant Penicillium expansum with a reproductive growth ability lower than that of the target Penicillium expansum. Specifically, the reproductive growth ability is embodied as spore production ability.

[0043] The present invention also provides a method for preparing a recombinant Penicillium expansum with improved vegetative growth ability, comprising the following steps: inhibiting the expression of the PBZ1 gene in the target Penicillium expansum to obtain a recombinant Penicillium expansum with a vegetative growth ability higher than that of the target Penicillium expansum.

[0044] The present invention also provides a method for preparing a recombinant Penicillium expansum with reduced pathogenicity, comprising the following steps: inhibiting the expression of the PBZ1 gene in the target Penicillium expansum to obtain a recombinant Penicillium expansum with lower pathogenicity than the target Penicillium expansum.

[0045] The present invention also provides a method for preparing a recombinant Penicillium expansum with reduced ability to produce patulin, comprising the steps of: inhibiting the expression of the PBZ1 gene in the target Penicillium expansum to obtain a recombinant Penicillium expansum with lower ability to produce patulin than the target Penicillium expansum.

[0046] The present invention also protects the recombinant Penicillium expansum prepared by any of the above methods.

[0047] Specifically, the recombinant Penicillium expansum is obtained by replacing the DNA molecule shown at positions 1-2871 in SEQ ID NO: 3 in the genomic DNA with the DNA molecule shown at positions 7-4432 in SEQ ID NO: 4.

[0048] The present invention also protects the use of substances that inhibit PBZ1 protein or substances that inhibit PBZ1 gene in cultivating plants resistant to Penicillium expansum.

[0049] The present invention also protects the use of a substance that inhibits PBZ1 protein or a substance that inhibits PBZ1 gene in the preparation of an inhibitor of Penicillium expansum.

[0050] Specifically, the substance that inhibits the PBZ1 protein may be a substance that reduces the abundance of the PBZ1 protein and / or a substance that inhibits the activity of the PBZ1 protein.

[0051] Specifically, the substance that inhibits the PBZ1 gene may be a substance that inhibits the expression of the PBZ1 gene.

[0052] Specifically, the substance that inhibits the PBZ1 gene may be a recombinant plasmid having the DNA molecule shown at positions 7 to 4432 in SEQ ID NO:4.

[0053] Specifically, the recombinant plasmid is obtained by replacing the small fragment starting from the Sac I restriction enzyme recognition sequence and ending at the Hind III restriction enzyme recognition sequence in the pCHPH plasmid with the double-stranded DNA molecule shown in SEQ ID NO: 4.

[0054] The plant is a host plant of Penicillium expansum.

[0055] Specifically, the plant is apple (such as Fuji apple) or pear (such as Crown pear).

[0056] Exemplarily, any of the above Penicillium expansum is Penicillium expansum PE-T01.

[0057] The inventors of the present invention have discovered and verified the functions of PBZ1 protein and PBZ1 gene. PBZ1 protein and PBZ1 gene are ideal targets for controlling fruit rot and fungal toxin contamination. The present invention can be used for fruit preservation, helping to ensure the quality and safety of fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 This is a map of the pCHPH plasmid.

[0059] Figure 2 The working principle of the PBZ1 knockout vector in Example 1 (A), an exemplary electrophoresis diagram of PCR identification (B), and an exemplary result of Southern blot identification (C).

[0060] Figure 3 The following are exemplary photos and quantitative statistical results of the colony diameter detection test in Example 3.

[0061] Figure 4 The following are exemplary photos and quantitative statistical results of the spore production test in Example 3.

[0062] Figure 5 The following are exemplary photos and quantitative statistical results of the test for detecting the diameter of lesions in Example 3.

[0063] Figure 6 The following are exemplary photos and quantitative statistical results of the test for detecting toxin production ability in Example 3. DETAILED DESCRIPTION

[0064] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0065] The experimental methods in the following examples are conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples are repeated three times, and the results are averaged. Unless otherwise specified, solutions refer to aqueous solutions.

[0066] The Penicillium expansum used in the examples is strain PE-T01 (i.e., "P. expansum T01" in the literature), which is described in the following literature: Li BQ, Zong YY, Du ZL, Shang YJ, Chen Y, Zhang ZQ, Qin GZ, Zhao WM, Tian SP. 2015. Genomic characterization reveals insights into patulin biosynthesis and pathogenicity in Penicillium species. Molecular Plant-Microbe Interactions, 28(6): 635-647. The public can obtain the biological material from the Institute of Botany, Chinese Academy of Sciences. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0067] pCHPH plasmid (pCHPH plasmid is obtained by transforming pCAMBIA1300 plasmid. The map of pCHPH plasmid is shown in Figure 1 , i.e. "binary vector pCHPH" in the literature), which is recorded in the following literature: Li BQ, Zong YY, Du ZL, Shang YJ, Chen Y, Zhang ZQ, Qin GZ, Zhao WM, Tian SP. 2015. Genomic characterization reveals insights into patulin biosynthesis and pathogenicity in Penicillium species. Molecular Plant-Microbe Interactions, 28(6): 635-647. The public can obtain the biological material from the Institute of Botany, Chinese Academy of Sciences. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0068] The pCNEO plasmid (i.e., "vector pCNEO" in the literature) is described in the following literature: Li BQ, Chen Y, Zong YY, Shang YJ, Zhang ZQ, Wang X, Long MY, Tian SP. 2019. Dissection of patulin biosynthesis, spatial control and regulation mechanism in Penicillium expansum. Environmental Microbiology, 21: 1124-1139. The public can obtain the biological material from the Institute of Botany, Chinese Academy of Sciences. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0069] Preparation method of liquid IM culture medium: Take 0.146g NaCl, 0.492g MgSO4·7H2O, 0.066g CaCl2, 0.001g FeSO4·7H2O, 0.529g (NH4)2SO4, 1.4g K2HPO4·3H2O, 0.524g KH2PO4 and 5mL glycerol, add HCl solution to adjust the pH to 5.2, dissolve and make up to 970mL with dH2O, then autoclave at 121℃ for 20min, add 20mL 1M MES solution and 10mL 40g / 100mL D-glucose solution before use.

[0070] The only difference between solid IM medium and liquid IM medium is that 15 g of agar powder is added per liter of medium during preparation.

[0071] Preparation method of CY medium: Take 3 g NaNO3, 0.5 g MgSO4·7H2O, 0.5 g KCl, 0.01 g FeSO4·7H2O, 1 g K2HPO4·3H2O, 30 g sucrose and 5 g yeast extract, add HCl solution to adjust the pH to 5.2, dissolve and make up to 1 L with dH2O, and sterilize at 121℃ for 20 min.

[0072] The only difference between CY medium and CYA medium is that 15 g of agar powder is added per liter of medium during preparation.

[0073] Preparation method of MM culture medium: take 5.95g NaNO3, 0.52g KCl, 1.5g KH2PO4, 0.062g MgSO4·7H2O, 0.01g FeSO4·7H2O, 10g D-glucose and 15g agar powder, add NaOH solution to adjust the pH to 5.2, dissolve and make up to 1L with dH2O, and sterilize at 121℃ for 20min.

[0074] The PBZ1 protein in Penicillium expansum is shown in SEQ ID NO: 1. The coding frame of the PBZ1 gene in the cDNA of Penicillium expansum is shown in SEQ ID NO: 2. In the genomic DNA of Penicillium expansum, the PBZ1 gene and its upstream and downstream sequences are shown in SEQ ID NO: 3. In SEQ ID NO: 3, positions 1001-1812 are the PBZ1 gene (the intron is located at positions 1165-1223 in SEQ ID NO: 3).

[0075] Example 1: Preparation of recombinant bacteria with PBZ1 gene knockout

[0076] 1. Primer Design

[0077] A primer pair for amplifying the upstream homology arm (primer LF and primer LR) and a primer pair for amplifying the downstream homology arm (primer RF and primer RR) were designed.

[0078] The primer sequences are as follows (the underlined part is the sequence overlapping with the pCHPH vector):

[0079] LF: ATGACCATGATTACGAATTCGAGCTC TCATTCCAAAAACTCTCTTCCAT;

[0080] LR: ATGCGGCTCCACAGCTGCAGGTCGAC GGTAAGAGAGGTAAAAGCTAAGAGC.

[0081] RF: CATGCATGGTTGCCTAACTAGGCGCGCC ACTTACTCTCATCATACCGACCAG;

[0082] RR: GTAAAACGACGGCCAGTGCCAAGCTT GGGGTGTGGATATTGTCTCG.

[0083] 2. Construction of knockout vector

[0084] 1. Using the genomic DNA of Penicillium expansum as a template, a primer pair consisting of primer LF and primer LR was used for PCR amplification, and the amplified product was recovered.

[0085] 2. Using the genomic DNA of Penicillium expansum as a template, perform PCR amplification using a primer pair consisting of primer RF and primer RR, and recover the amplified product.

[0086] 3. Take the pCHPH plasmid, use restriction endonucleases HindⅢ and AscⅠ for double digestion, and recover the linearized vector backbone of about 11.3 kb.

[0087] 4. The amplified product obtained in step 2 and the linearized vector backbone obtained in step 3 were incubated at 37° C. for 30 min under the action of homologous recombinase (Beijing Zhuangmeng International Biogene Technology Co., Ltd., a component of the kit with product catalog number ZC231-2, the same below) to obtain a recombinant plasmid.

[0088] 5. Take the recombinant plasmid obtained in step 4, use restriction endonucleases Sac I and Xba I to perform double digestion, and recover the linearized vector backbone of about 12.4 kb.

[0089] 6. The amplified product obtained in step 1 and the linearized vector backbone obtained in step 5 were incubated at 37° C. for 30 min under the action of homologous recombinase to obtain a recombinant plasmid, namely the PBZ1 knockout vector.

[0090] After sequencing identification, the structure of the PBZ1 knockout vector was described as follows: the small fragment from the Sac I restriction enzyme recognition sequence to the Hind III restriction enzyme recognition sequence in the pCHPH plasmid was replaced with a double-stranded DNA molecule shown in SEQ ID NO: 4. In SEQ ID NO: 4, from upstream to downstream, there are: an upstream homology arm, a hygromycin resistance gene expression cassette (promoter OliC-hygromycin resistance gene hph-terminator TrpC) and a downstream homology arm.

[0091] The working principle of the PBZ1 knockout vector is shown in Figure 2 A.

[0092] 3. Preparation of recombinant bacteria

[0093] 1. Introduce the PBZ1 knockout vector into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium.

[0094] 2. The recombinant Agrobacterium single colony obtained in step 1 was inoculated into 5 mL of liquid LB medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin, and cultured at 28°C and 220 rpm for 24 h, then centrifuged at 5000 rpm for 5 min, the supernatant was discarded, the cells were washed with 5 mL of liquid IM medium, and then resuspended in liquid IM medium to obtain OD 600nm Take 10 mL of the bacterial suspension, add acetosyringone (AS) to a concentration of 200 μM, and culture at 28°C and 220 rpm for 6 h.

[0095] 3. Use liquid IM medium to suspend and expand Penicillium spores to obtain 10 5 The spore suspension with a concentration of spores / mL was cultured at 25°C and 120 rpm for 4 h.

[0096] 4. Mix equal volumes of the liquid phase system obtained in step 2 and the liquid phase system obtained in step 3, mix thoroughly and spread on a solid IM culture medium plate covered with cellophane, dry thoroughly and culture at 25°C in the dark for 2 days.

[0097] 5. After completing step 4, peel off the cellophane and transfer the cells to a CYA medium plate containing 250 μg / mL hygromycin B and 500 μg / mL carbenicillin. Culture at 25°C in the dark for 2-3 days.

[0098] 6. After completing step 5, pick the newly grown colonies and place them on a new CYA medium plate containing 250 μg / mL hygromycin B and 500 μg / mL carbenicillin, and culture them at 25°C in the dark for 2-3 days.

[0099] 7. After completing step 6, pick the newly grown colonies onto a new CYA medium plate covered with cellophane, culture at 25°C in the dark for 2 days, and then perform PCR identification. The strains identified as positive are recombinant bacteria. PCR identification method: collect hyphae, extract genomic DNA, use genomic DNA as a template, and use primers consisting of primers LF and RR for PCR amplification. If an amplification product of 4478bp is displayed, it is identified as positive.

[0100] An exemplary electropherogram of PCR identification is shown in Figure 2 B.

[0101] 4. Single spore isolation of recombinant bacteria

[0102] 1. Take the recombinant bacteria obtained in step 3 and inoculate them on a PDA medium plate, incubate at 25°C in the dark for 5 days, collect spores, and prepare 3×10 3 spores / mL of spore suspension.

[0103] 2. Take 100 μL of the spore suspension prepared in step 1, spread it on a PDA medium plate containing 250 μg / mL hygromycin B, and culture it at 25°C for 2 days.

[0104] 3. After completing step 2, pick a single spore-forming colony and inoculate it on a CYA medium plate covered with cellophane. Culture it at 25°C in the dark for 2 days, and then perform PCR identification. The strain that is positive is the recombinant bacteria. The PCR identification method is the same as step 3, step 7.

[0105] 5. Southern blot identification of recombinant bacteria

[0106] In order to exclude ectopic recombination, the recombinant bacteria obtained in step 4 need to be tested by Southern blot.

[0107] The specific steps are as follows: extract the genomic DNA of the recombinant bacteria, then double digest with restriction endonucleases BamH I and Hind III, and then use digoxigenin-labeled hygromycin gene (hph) as a hybridization probe for Southern blot identification. If a single band is displayed and the size is about 3.4 kb, it means that the recombinant bacteria are the target recombinant bacteria with a single copy insertion.

[0108] Exemplary results of Southern blot identification are shown in Figure 2 C.

[0109] The target recombinant bacteria in the form of a single copy insertion obtained through the above steps are recombinant bacteria in which the PBZ1 gene is knocked out (the DNA molecules shown at positions 1-2871 in SEQ ID NO: 3 in the expansom Penicillium genomic DNA are replaced with the DNA molecules shown at positions 7-4432 in SEQ ID NO: 4), and multiple strains were obtained, which were named ΔBPZ1-2 strain, ΔBPZ1-3 strain, and ΔBPZ1-5 strain respectively.

[0110] Example 2: Preparation and identification of recombinant bacteria with PBZ1 gene complementation

[0111] 1. Constructing a replenishment carrier

[0112] The double-stranded DNA molecule shown in SEQ ID NO: 3 was used to replace the small fragment between the Sac I and Kpn I restriction enzyme recognition sequences of the pCNEO plasmid to obtain a recombinant plasmid, namely the PBZ1 complementing vector (which has been sequenced and verified).

[0113] 2. Preparation of recombinant bacteria

[0114] 1. Introduce the PBZ1 complementing vector into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium.

[0115] 2. The recombinant Agrobacterium single colony obtained in step 1 was inoculated into 5 mL of liquid LB medium containing 50 μg / mL rifampicin and 50 μg / mL kanamycin, and cultured at 28°C and 220 rpm for 24 h, then centrifuged at 5000 rpm for 5 min, the supernatant was discarded, the cells were washed with 5 mL of liquid IM medium, and then resuspended in liquid IM medium to obtain OD 600nm Take 10 mL of the bacterial suspension, add acetosyringone (AS) to a concentration of 200 μM, and culture at 28°C and 220 rpm for 6 h.

[0116] 3. Suspend ΔBPZ1-2 strain spores in liquid IM medium to obtain 10 5 The spore suspension with a concentration of spores / mL was cultured at 25°C and 120 rpm for 4 h.

[0117] 4. Mix equal volumes of the liquid phase system obtained in step 2 and the liquid phase system obtained in step 3, mix thoroughly and spread on a solid IM culture medium plate covered with cellophane, dry thoroughly and culture at 25°C in the dark for 2 days.

[0118] 5. After completing step 4, peel off the cellophane and transfer the cells to a CYA medium plate containing 250 μg / mL G418 and 500 μg / mL carbenicillin. Culture at 25°C in the dark for 2-3 days.

[0119] 6. After completing step 5, pick the newly grown colonies and place them on a new CYA medium plate containing 250 μg / mL G418 and 500 μg / mL carbenicillin, and culture them at 25°C in the dark for 2-3 days.

[0120] 7. After completing step 6, pick the newly grown colonies onto a new CYA medium plate covered with cellophane, culture at 25°C in the dark for 2 days, and then perform PCR identification. The strains identified as positive are recombinant bacteria. PCR identification method: collect hyphae, extract genomic DNA, use genomic DNA as a template, and use primers F (primer R corresponds to the PBZ1 gene) and primer R (primer R corresponds to the vector backbone) to perform PCR amplification. If an amplified product is displayed, it is identified as positive.

[0121] F: ATGAATCGCTCTCCATCGTA; R: TCAGAAGAACTCGTCAAGAA.

[0122] The recombinant bacteria obtained through the above steps are the recombinant bacteria with PBZ1 gene complementation, and are named BPZ1 C strains.

[0123] Example 3: Phenotypic Identification

[0124] The test bacteria were: Penicillium expansum (wild type, denoted by WT), ΔBPZ1-2 strain, ΔBPZ1-3 strain, BPZ1 C strains.

[0125] 1. BPZ1 regulates the growth and development of Penicillium expansum

[0126] Prepare 10 5 spores / mL of spore suspension.

[0127] The test culture media were: PDA medium, CYA medium, and MM medium. 5 μL of the spore suspension of the test bacteria was inoculated into the center of the test culture medium plate and cultured at 25°C in the dark for 7 days. During the culture process, photos were taken and the colony diameter was measured. An exemplary photo after 7 days of culture is shown in Figure 3A, the colony diameter statistics after 7 days of culture are shown in Figure 3 B (* indicates significant difference compared with WT, P<0.05; sample number N=4). The results showed that compared with the wild-type strain, the colony of ΔBPZ1 strain was significantly larger and the growth rate was significantly increased; BPZ1 C The strains showed trait complementation.

[0128] The test culture medium is: PDA medium, CYA medium. 5 μL of the spore suspension of the test bacteria was inoculated into the center of the test culture medium plate and cultured at 25°C in the dark for 7 days. During the culture process, photos were taken and the number of conidia was counted. An exemplary photo after 3 days of culture is shown in Figure 4 A, the results of counting the number of molecular spores after 7 days of culture are shown in Figure 4 B (* indicates significant difference compared with WT, P<0.05; sample number N=4). The results showed that compared with the wild-type strain, the conidia production of the ΔBPZ1 strain was significantly reduced (especially on CYA medium, the conidia production of the ΔBPZ1 strain was reduced by about 90% compared with WT); BPZ1 C The strains showed trait complementation.

[0129] These results indicate that the BPZ1 gene negatively regulates the vegetative growth of P. expansulae and positively regulates its reproductive growth.

[0130] BPZ1 regulates the pathogenicity of Penicillium expansum

[0131] Prepare 10 5 spores / mL of spore suspension.

[0132] Crown pear and Fuji apple fruits of similar maturity and without mechanical damage were selected, and the surface of the fruits was disinfected with 2% sodium hypochlorite solution, then washed with running water and dried naturally. The waist of the fruit was pierced with a sterile inoculation needle, and the wound was 3mm (depth) × 3mm (width). Each fruit had 4 wounds, and each was inoculated with a spore suspension of a test bacteria (5μL in each wound), and then moisturized and cultured at 25℃. Photos were taken and the diameter of the lesions were counted 5 days after inoculation and 7 days after inoculation.

[0133] See the sample photos Figure 5 A (showing four wound photos of the same fruit). The statistical results of the lesion diameter are shown in Figure 5 B (* indicates significant difference compared with WT, P<0.05; sample size N=20). Compared with the wild-type strain, the pathogenicity of the ΔBPZ1 strain on pear and apple fruits was significantly reduced, and the diameter of the lesions was reduced by 18%-22% after 5 days of inoculation. This indicates that the BPZ1 gene is an important pathogenicity regulatory gene of Penicillium expansum.

[0134] BPZ1 regulates and expands the toxin-producing capacity of Penicillium

[0135] Prepare 10 6 spores / mL of spore suspension.

[0136] 1. Cut the cellophane into 1 cm diameter discs, sterilize at high temperature and spread them on PDA medium plates. Inoculate 1 μL of the spore suspension of the test bacteria on each piece of cellophane, culture at 25°C for 36 hours, then transfer the cellophane together with the hyphae to a 24-well plate (each well contains 1 mL of CY medium, and each well contains one piece of the above cellophane), let the cellophane float on the liquid surface, and culture at 25°C for 2 days. Then take the culture solution, filter it with a 0.22 μm filter membrane, collect the filtrate, and then perform HPLC analysis.

[0137] The relevant parameters for HPLC analysis are as follows:

[0138] Chromatograph: High performance liquid chromatograph from Waters, USA, equipped with an automatic sample injector (Waters 2695), a bidirectional HPLC pump (Waters 1525) and a UV detector (Waters 2489);

[0139] Chromatographic column: ODS reverse phase column (C18 column, 5 μm, 250 × 4.6 mm, GL Sciences, Japan);

[0140] Mobile phase: composed of 10 parts by volume of acetonitrile and 90 parts by volume of water;

[0141] Mobile phase flow rate: 1.0 mL / min; column temperature 25°C; detection wavelength: 276 nm; injection volume: 10 μL.

[0142] The patulin standard was tested using the same HPLC parameters to determine the peak position of the target peak, and a standard curve equation was prepared with the peak area of ​​the target peak and the patulin content as variables. The patulin content in the culture medium was calculated based on the standard curve equation.

[0143] See the exemplary photos of the culture medium and the statistical results of the patulin content in the culture medium. Figure 6 A (* indicates significant difference compared with WT, P<0.05; number of samples N=6). Compared with the wild-type strain, the patulin production of the ΔBPZ1 strain was reduced by more than 98%, and the amount of pigment deposition was also significantly reduced.

[0144] 2. Select Crown pear and Fuji apple fruits with similar maturity and no mechanical damage, use 2% sodium hypochlorite solution to disinfect the surface of the fruit, then wash with running water and dry naturally. Use a sterile inoculation needle to puncture the waist of the fruit, the wound is 3mm (depth) × 3mm (width), 4 wounds per fruit, inoculate each with a spore suspension of the test bacteria (5μL inoculated in each wound), and then moisturize and culture at 25℃ for 7 days (obvious lesions can be observed). Take 20g of the lesion pulp, add 10mL of sterile water, homogenize, then add pectinase (5mg pectinase per 100mg pulp), enzymolyze at 40℃ for 1h, then centrifuge at 6000rpm for 5min, take the supernatant and filter it through a 0.22μm filter membrane for HPLC analysis (the method is the same as step 1). Calculate the patulin content in the pulp according to the standard curve equation.

[0145] See the illustrative photos of apples and the statistical results of patulin content in apple pulp. Figure 6 B (* indicates significant difference compared with WT, P < 0.05; sample size N = 6). Pear exemplary photos and statistical results of patulin content in pear pulp are shown in Figure 6 C (* indicates significant difference compared with WT, P<0.05; number of samples N=6). No patulin was detected in the lesion tissue of apple and pear 7 days after inoculation with ΔBPZ1 strain. The above results indicate that BPZ1 gene is a key regulatory gene for patulin biosynthesis.

[0146] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of PBZ1 protein or PBZ1 gene in regulating the vegetative growth and / or reproductive growth and / or pathogenicity and / or the ability to produce patulin of Penicillium expansum; The PBZ1 protein is as follows (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1) and having the same function as (a1); (a4) a protein derived from Penicillium expansum that has 98% or more identity with (a1) and has the same function as (a1); The PBZ1 gene is a gene encoding the PBZ1 protein.

2. A method for preparing a recombinant Penicillium expansum with reduced reproductive growth ability, comprising the following steps: inhibiting the expression of the PBZ1 gene in the target Penicillium expansum to obtain a recombinant Penicillium expansum with a reproductive growth ability lower than that of the target Penicillium expansum; the PBZ1 gene is the PBZ1 gene described in claim 1.

3. A method for preparing a recombinant Penicillium expansum with improved vegetative growth ability, comprising the following steps: inhibiting the expression of the PBZ1 gene in the target Penicillium expansum to obtain a recombinant Penicillium expansum with a vegetative growth ability higher than that of the target Penicillium expansum; the PBZ1 gene is the PBZ1 gene described in claim 1.

4. A method for preparing a recombinant Penicillium expansum with reduced pathogenicity, comprising the following steps: inhibiting the expression of the PBZ1 gene in the target Penicillium expansum to obtain a recombinant Penicillium expansum with lower pathogenicity than the target Penicillium expansum; the PBZ1 gene is the PBZ1 gene described in claim 1.

5. A method for preparing a recombinant Penicillium expansum with reduced ability to produce patulin, comprising the following steps: inhibiting the expression of the PBZ1 gene in the target Penicillium expansum to obtain a recombinant Penicillium expansum with an ability to produce patulin lower than that of the target Penicillium expansum; the PBZ1 gene is the PBZ1 gene described in claim 1.

6. The recombinant Penicillium expansum prepared by the method according to any one of claims 2 to 5.

7. Use of a substance that inhibits PBZ1 protein or a substance that inhibits PBZ1 gene in cultivating plants resistant to Penicillium expansum; the PBZ1 protein is the PBZ1 protein described in claim 1; the PBZ1 gene is the PBZ1 gene described in claim 1.

8. Use of a substance that inhibits PBZ1 protein or a substance that inhibits PBZ1 gene in the preparation of a Penicillium expansum inhibitor; the PBZ1 protein is the PBZ1 protein described in claim 1; the PBZ1 gene is the PBZ1 gene described in claim 1.

9. A protein, which is (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1) and having the same function as (a1); (a4) A protein derived from Penicillium expansum and having 98% or more identity with (a1) and having the same function as (a1).

10. A gene encoding the protein according to claim 9.

Images