Application of PAFAH1B1 gene in ovarian granular cell cycle

Abstract

The invention provides application of a PAFAH1B1 gene in an ovarian granular cell cycle, and relates to the technical field of gene expression regulation. Comprising the following steps: regulating the expression of the PAFAH1B1 gene in the ovarian granulosa cells, regulating the cycle of the ovarian granulosa cells, and increasing the expression quantity or activity of the PAFAH1B1 gene; or the method comprises the step of reducing the expression quantity or activity of the PAFAH1B1 gene; or the method comprises the step of promoting or inhibiting the combination of the PAFAH1B1 gene expression product with the cyclin and the cyclin-dependent kinase in the recipient cell. The application verifies that the expression level of the PAFAH1B1 gene can obviously influence the cell cycle of granulosa cells, and a simple and effective new way is provided for regulating and controlling the cell cycle of granulosa cells. The invention discloses a molecular mechanism of the PAFAH1B1 gene influencing the cell cycle and application thereof, and provides reference for subsequent regulation and control of ovarian granular cell functions, follicular development and initial estrus initiation of mammals. An interference fragment capable of knocking down gene expression on PAFAH1B1 gene expression is developed and verified, and an effective new research material is provided for inhibiting PAFAH1B1 gene expression.

Description

Technical Field

[0001] The present invention relates to the technical field of gene expression regulation, and specifically to a PAFAH1B1 Gene application in the ovarian granulosa cell cycle. Background Art

[0002] Ovarian granulosa cells are the main components of follicles, and their function is closely related to the normal development of follicles. Among them, the cell cycle of ovarian granulosa cells is one of the main factors affecting the function of ovarian granulosa cells.

[0003] The cell cycle process is mainly regulated by cyclins, cyclin-dependent kinases (CDKs), etc. Cyclin E1 (CCNE1) is a key gene involved in regulating the cell cycle. CCNE1 forms a complex with cyclin-dependent kinase 2 (CDK2) to promote the G1 / S phase of cells. Overexpression of CCNE1 in human osteosarcoma cells significantly promotes cells to enter the S phase, resulting in double-stranded DNA breaks. In addition, CCNE1 can also activate CDK1 and promote cells to transition to the M phase. Studies have shown that the key genes currently studied that can participate in the regulation of the cell cycle include CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, CCNE1, CCNE2, etc. If a new regulatory mechanism can be discovered to affect multiple cyclins and cyclin-dependent kinases from upstream, thereby affecting the cell cycle, this will make the regulation of the cell cycle simpler and more efficient.

[0004] Platelet activating factoracetylhydrolase 1B regulatory subunit 1 (PAFAH1B1) is a regulatory subunit of platelet activating factor (PAF). As a lipid messenger, PAF can activate the MAPK signaling pathway and is widely involved in biological processes. However, PAFAH1B1 There is no relevant report on whether it can participate in follicular development by regulating the cell cycle of ovarian granulosa cells. Summary of the invention

[0005] In order to more simply and efficiently regulate the granulosa cell cycle and thus regulate granulosa cell function and follicle development, the purpose of this application is to provide a PAFAH1B1 Gene application in the ovarian granulosa cell cycle.

[0006] In order to achieve the purpose of this application, this application provides a PAFAH1B1 The application of genes in the ovarian granulosa cell cycle adopts the following technical scheme: Regulates the ovarian granulosa cells PAFAH1B1 Gene expression regulates the ovarian granulosa cell cycle, including increased PAFAH1B1 Gene expression or activity; or PAFAH1B1 or steps involving promoting or inhibiting gene expression or activity in recipient cells. PAFAH1B1 The step of combining the gene expression product with cell cycle proteins and cell cycle protein-dependent kinases. PAFAH1B1 The gene sequence is the target fragment, designed and synthesized PAFAH1B1 Gene overexpression vector primer F and primer R, COV434 as a template to amplify the target fragment, construct PAFAH1B1 Overexpression vector; The sequence of the primer F is shown in SEQ ID NO: 21, and the sequence of the primer R is shown in SEQ ID NO: 22; in vitro, PAFAH1B1 Overexpression vectors are introduced into recipient cells to PAFAH1B1 The gene is expressed in the recipient cells.

[0007] More specifically, PAFAH1B1 The gene CDS region sequence is the target fragment, designed and synthesized PAFAH1B1 Gene overexpression vector primers.

[0008] Furthermore, siRNA interference fragments are designed and synthesized, and the siRNA interference fragments are introduced into the receptor cells in vitro to interfere with the expression of PAFAH1B1 expression; the siRNA interference fragment is PAFAH1B1-siRNA1, and the sequence of PAFAH1B1-siRNA1 is shown in SEQ ID NO: 23.

[0009] Furthermore, the siRNA interference fragment is PAFAH1B1-siRNA2, and the sequence of PAFAH1B1-siRNA2 is shown in SEQ ID NO: 24.

[0010] Furthermore, the siRNA interference fragment is PAFAH1B1-siRNA3, and the sequence of PAFAH1B1-siRNA3 is shown in SEQ ID NO: 25. More specifically, PAFAH1B1-siRNA3 at a concentration of 100 nM was selected for subsequent studies and named ND-PAFAH1B1.

[0011] Furthermore, in vitro, the PAFAH1B1Overexpression vector, transfected PAFAH1B1 Overexpression of the vector into granulosa cells reduced the proportion of cells in the G1 phase and increased the proportion of cells in the G2 / M phase.

[0012] The experimental results showed that the transfection PAFAH1B1 Overexpression of the vector into granulosa cells can promote PAFAH1B1 Expression of β-actin significantly decreased the proportion of granulosa cells in the G1 phase and increased the proportion of cells in the G2 / M phase.

[0013] Further, the siRNA interference fragment is used to transfect granulosa cells to reduce PAFAH1B1 Expression of β-actin increased the proportion of granulosa cells in the G1 phase and decreased the proportion of cells in the G2 / M phase.

[0014] The experimental results show that the use of the siRNA interference fragment to transfect granulosa cells can reduce PAFAH1B1 Expression can significantly increase the proportion of granulosa cells in the G1 phase and reduce the proportion of cells in the G2 / M phase.

[0015] Furthermore, overexpression PAFAH1B1 It can promote the expression of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, inhibit the mRNA levels of CCNB1 and CCNB2, and affect the cell cycle of granulosa cells; interfere with PAFAH1B1 Gene, which can inhibit the expression of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, promote the expression of CCNB1 and CCNB2, and affect the cell cycle of granulosa cells.

[0016] The experimental results showed that overexpression PAFAH1B1 Genes, significantly promoted the mRNA levels of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, and significantly inhibited the mRNA levels of CCNB1 and CCNB2. PAFAH1B1 Genes, significantly inhibited the mRNA levels of CDK1, CDK2, CDK4, CCND1 and CCNE1, inhibited the mRNA level of CCNE2, the difference was not significant, and significantly promoted the mRNA levels of CCNB1 and CCNB2. PAFAH1B1 Genes, significantly promoted the protein expression levels of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, and had no significant effect on the protein expression levels of CCNB1 and CCNB2. PAFAH1B1 genes, significantly inhibited the protein expression levels of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, and significantly promoted the protein expression levels of CCNB1 and CCNB2.

[0017] Furthermore, the impact PAFAH1B1 Binding to any of CDK1, CDK2, CCNB1, CCNB2, and CCNE1 at the mRNA level affects the cell cycle.

[0018] Furthermore, the impact PAFAH1B1 At the protein level, binding to any one or a complex of CDK1, CDK2, CDK4, CCND1, CCNB2, CCNE1, and CCNE2 affects the cell cycle.

[0019] In summary, the present application provides a PAFAH1B1 The application of genes in the ovarian granulosa cell cycle has the following technical effects: First, the method of this application verifies for the first time PAFAH1B1 The expression level of the gene can significantly affect the cell cycle of granulosa cells, providing a simple and effective new way to regulate the cell cycle of granulosa cells.

[0020] Second, the present application discloses PAFAH1B1 The gene affects the mRNA and protein levels of CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, CCNE1 and CCNE2 genes in ovarian granulosa cells, thereby affecting the molecular mechanism of cell cycle and its application, which provides a basis for subsequent regulation PAFAH1B1 It provides a reference for the influence of genes on mammalian ovarian granulosa cell function, follicle development and the onset of puberty.

[0021] Third, this application develops and verifies the ability to PAFAH1B1 Gene expression knocks down the gene expression interference fragment, which is used to inhibit PAFAH1B1 Gene expression provides effective new research materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 A is the optimal concentration for detecting overexpression vector.

[0023] Figure 1 B is the optimal concentration for detecting interfering fragments.

[0024] Figure 2 A is flow cytometry detection of overexpression PAFAH1B1 Effects on the granulosa cell cycle.

[0025] Figure 2 B is interference with flow cytometry detection PAFAH1B1 Effects on the granulosa cell cycle.

[0026] Figure 3 A is qRT-PCR detection of overexpression PAFAH1B1Effects on the mRNA expression levels of key genes in the granulosa cell cycle.

[0027] Figure 3 B is interference with qRT-PCR detection PAFAH1B1 Effects on the mRNA expression levels of key genes in the granulosa cell cycle.

[0028] Figure 4 A is Western blot detection of overexpression PAFAH1B1 Effects on the expression levels of key gene proteins in the granulosa cell cycle.

[0029] Figure 4 B is interference in Western blot detection PAFAH1B1 Effects on the expression levels of key gene proteins in the granulosa cell cycle.

[0030] Figure 5 Is RIP detection PAFAH1B1 Binding to cell cycle-related genes at the mRNA level.

[0031] Figure 6 CoIP detection PAFAH1B1 Binding to cell cycle-related genes at the protein level. DETAILED DESCRIPTION

[0032] This application provides a PAFAH1B1 The application of genes in the ovarian granulosa cell cycle was carried out in vitro using the human ovarian granulosa carcinoma cell line COV434 as experimental cells.

[0033] The human ovarian granulosa carcinoma cell line COV434 used in this application was purchased from Wuhan Pronocell Life Science Co., Ltd. and revived, maintained and cryopreserved in the cell laboratory of South China Agricultural University.

[0034] The following will further illustrate the embodiments of the present invention in conjunction with the accompanying drawings and specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. It should be noted that many specific details are set forth in the following description to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and therefore, the protection scope of the present invention is not limited by the specific embodiments disclosed below. If specific conditions are not specified in the embodiments, they are carried out according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0035] The present invention uses statistical methods to analyze the results of three independent experiments in each embodiment, calculate the "mean ± standard deviation", and use one-way analysis of variance to perform significant difference analysis (the "*" in the figure indicates P<0.05, “**” indicates P <0.01).

[0036] Example 1: Cultivation of human ovarian granulosa carcinoma cell line COV434 COV434 recovery: thaw the frozen cells in a 37 ℃ water bath, centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend the cells in DMEM complete medium, inoculate into a 25 mL cell culture flask (Thermo, USA) with 4.45 mL DMEM high glucose medium (Hyclone, USA), 500 µL calf serum (Hyclone, USA) and 50 µL penicillin-streptomycin (Hyclone, USA), and place in a 37 ℃ 5% CO2 incubator.

[0037] COV434 plating: Observe the status of COV434 cells. When the cell confluence reaches about 80%, discard the culture medium and wash the cells twice with PBS preheated at 37°C (containing 1% (v / v) penicillin-streptomycin double antibody). Use 0.25% trypsin preheated at 37°C for 5 min, terminate the digestion with DMEM complete medium, and wash the cells twice with PBS preheated at 37°C (containing 1% (v / v) penicillin-streptomycin double antibody). Resuspend the cells with DMEM complete medium, add the cell suspension evenly to the cell culture plate, replenish the volume with DMEM complete medium, and shake gently. Place in a 37°C, 5% CO2 incubator, observe the growth of KGN after 24 hours, and the confluence of the cells in the cell culture plate reaches about 80%, and then conduct subsequent experiments.

[0038] Example 2: qRT-PCR The qRT-PCR detection of genes in the present invention uses the Maxima SYBR Green qPCR Master Mix (2X) kit (Thermo Scientific, USA). The experiment uses the comparative Ct value method to detect the relative expression of genes in the sample, and GAPDH is used as an internal reference for the detected gene. The qRT-PCR primers used in the present invention are shown in Table 1. Specific calculation formula: Relative gene expression = 2-{〈﹙Ct value of target gene in experimental group﹚-﹙Ct value of reference gene in experimental group﹚〉-〈﹙Ct value of target gene in control group﹚-﹙Ct value of reference gene in control group﹚〉}.

[0039] Table 1 qRT-PCR primer sequences Example 3: Transfection PAFAH1B1 Overexpression vector and interference fragment into cells Build PAFAH1B1 Gene overexpression vector: Search for target gene from NCBI PAFAH1B1 The CDS region sequence of the target fragment (NCBI Gene ID: 397482) was analyzed using BioEdit software to analyze the restriction site distribution of the target fragment, and the amplified fragment was determined by referring to the pCDNA3.1 (+) vector map (Guangzhou Dongze Biological Company, China). PAFAH1B1 The restriction site is Kpn I and Nhe I. Use Primer Premier 5.0 software to design restriction primers for the target fragment and amplify PAFAH1B1 The target gene fragment was connected to the pCDNA3.1 vector to obtain the recombinant plasmid pCDNA3.1-PAFAH1B1, which is PAFAH1B1 Gene overexpression vector, wherein PAFAH1B1 The primer information of gene overexpression vector is shown in Table 2.

[0040] Transfection PAFAH1B1 Overexpression vector: Use Lipofectamine® 3000 kit (Invitrogen, USA), refer to the instruction manual for specific experimental steps. Take COV434 cells with a confluence of 80% in Example 1, and transfect 200 ng, 500 ng and 1000 ng of recombinant plasmid pCDNA3.1-PAFAH1B1 and control pCDNA3.1 into COV434 cells respectively, with 3 replicates in each group. Place the transfected 6-well plate in a 37°C, 5% CO2 incubator for culture. Observe the cell status 24 hours after transfection, and collect the cells if they grow well. Detect by qRT-PCR method of Example 2 PAFAH1B1 Expression level.

[0041] Table 2 PAFAH1B1 Gene overexpression vector primers Note: The bold part is the protected base, and the underline is the restriction site.

[0042] qRT-PCR results Figure 1 As shown in A, compared with the control group, 200 ng, 500 ng and 1000 ng of plasmid pCDNA3.1-PAFAH1B1 and pCDNA3.1 were transfected into COV434 cells, and the three concentrations of overexpression vectors could significantly promote PAFAH1B1 The higher the concentration, the better the effect. Therefore, the transfection concentration selected in the subsequent experiments was 1000 ng. In the subsequent experiments, the recombinant plasmid pCDNA3.1-PAFAH1B1 of this example was named OE-PAFAH1B1, and the overexpression control pCDNA3.1 (+) vector was named OE-NC.

[0043] synthesis PAFAH1B1 Gene interference fragment: commissioned to Guangzhou Dongze Biological Co., Ltd. (China) for synthesis PAFAH1B1 The gene interference fragments PAFAH1B1-siRNA1, PAFAH1B1-siRNA2, and PAFAH1B1-siRNA3 have the following specific sequences ("t" represents "U" in the sequence table).

[0044] PAFAH1B1-siRNA1: GCAUUGAGGUGGUCAUAGGA (SEQ ID NO: 23); PAFAH1B1-siRNA2: GGCAUACAGACUCUGUACA (SEQ ID NO: 24); PAFAH1B1-siRNA3: GGCCAUGACCACAAUGUUU (SEQ ID NO: 25).

[0045] Transfection PAFAH1B1 Gene interference fragment: Use Lipofectamine® 3000 kit (Invitrogen, USA), and refer to the instructions for specific experimental steps. Take COV434 cells with a confluence of 80% in Example 1, and transfect 50 nM and 100 nM PAFAH1B1-siRNA1, PAFAH1B1-siRNA2, PAFAH1B1-siRNA3 and NC-siRNA into COV434 cells respectively. Set up 3 replicates for each group. The transfected well plate is placed in a 37°C, 5% CO2 incubator for culture. 24 hours after transfection, observe the cell state, and collect the cells if they grow well. Detection by qRT-PCR method in Example 2 PAFAH1B1 Gene expression levels. qRT-PCR results Figure 1 As shown in B, compared with the control group, transfection of 50 nM and 100 nM interference fragments could significantly inhibit PAFAH1B1 The expression of the gene was determined, and the 100 nM interference fragment PAFAH1B1-siRNA3 had the best effect. Therefore, the 100 nM interference fragment PAFAH1B1-siRNA3 was selected as the transfection concentration for subsequent experiments. In the subsequent experiments, the PAFAH1B1-siRNA3 of this example was named ND-PAFAH1B1, and its interference control NC-siRNA was named ND-NC.

[0046] Example 4: Flow cytometry detection of cell cycle COV434 cells transfected with 1000 ng overexpression vector OE-PAFAH1B1, overexpression control OE-NC, 100 nM interference fragment ND-PAFAH1B1 and interference control ND-NC in Example 3 were collected, washed twice with PBS, digested with 0.25% trypsin preheated at 37°C for 5 min (Thermo, USA), terminated digestion with DMEM complete medium, washed twice with PBS preheated at 37°C (containing 1% (v / v) penicillin-streptomycin double antibody). Cells were fixed with 70% ethanol solution, fixed at 4°C for more than 4 h, washed twice with precooled PBS, centrifuged at 2000 rpm for 5 min, discarded the supernatant, gently resuspended with 400 μL of ethidium bromide, added with 100 μL of RNase, and incubated at 4°C in the dark for 30 min. The cell cycle was analyzed by flow cytometry within 24 h, with 3 replicates per group.

[0047] Flow cytometry detection of cell cycle results Figure 2 shown. Figure 2 A shows that compared with the overexpression control OE-NC, the proportion of G1 phase cells in COV434 cells transfected with the overexpression vector OE-PAFAH1B1 was significantly reduced, and the proportion of G2 / M phase cells was significantly increased; Figure 2 B shows that compared with the interference control ND-NC, the proportion of cells in the G1 phase of COV434 cells transfected with the interference fragment ND-PAFAH1B1 was significantly increased, and the proportion of cells in the G2 / M phase was significantly decreased.

[0048] Embodiment 5: PAFAH1B1 Effects on mRNA expression levels of key cell cycle genes The cells transfected with 1000 ng of overexpression vector OE-PAFAH1B1, overexpression control OE-NC, 100 nM interference fragment ND-PAFAH1B1 and interference control ND-NC in Example 3 were collected, and total RNA of the cells was extracted. The integrity of RNA was detected by agarose gel electrophoresis, and RNA reverse transcription was performed according to the instructions of PrimerScriptTM RT reagent kit (Takara, Japan). qRT-PCR was performed as in Example 2 to detect PAFAH1B1 Overexpression or interference PAFAH1B1 Effects of expression on the mRNA levels of key cell cycle genes CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, CCNE1 and CCNE2.

[0049] qRT-PCR results Figure 3 shown. Figure 3 A shows that compared with the control group, overexpression PAFAH1B1Genes, significantly promoted the mRNA levels of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, and significantly inhibited the mRNA levels of CCNB1 and CCNB2. Figure 3 B shows that compared with the control group, the interference PAFAH1B1 Genes, significantly inhibited the mRNA levels of CDK1, CDK2, CDK4, CCND1 and CCNE1, inhibited the mRNA level of CCNE2 with no significant difference, and significantly promoted the mRNA levels of CCNB1 and CCNB2.

[0050] Embodiment 6: PAFAH1B1 Effects on the expression levels of key cell cycle gene proteins The total protein of COV434 cells transfected with 1000 ng of overexpression vector OE-PAFAH1B1, overexpression control OE-NC, 100 nM interference fragment ND-PAFAH1B1 and interference control ND-NC were extracted by referring to the total protein extraction kit (Thermo, USA). Protein quantification was performed by BCA protein quantification kit (Biosharp, China), and Western Blot was performed. Western Blot was analyzed using Image Plus software. Protein bands in the blot film, antibodies include Anti-CDK1 (Abclonal, China, A0220), Anti-CDK2 (Affinity, USA, DF6237), Anti-CDK4 (Affinity, USA, DF6102), Anti-CCND1 (Affinity, USA, DF0931), Anti-CCNB1 (Bioss, China, bsm-52044R), Anti-CCNB2 (Bioss, China, bs-6656R), Anti-CCNE1 (Proteintech, China, 11554-1-AP) and Anti-CCNE2 (Proteintech, China, 11935-1-AP). Study overexpression PAFAH1B1 or interference PAFAH1B1 Effect of expression on protein expression levels of key cell cycle genes CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, CCNE1, and CCNE2.

[0051] Western Blot results Figure 4 As shown, Figure 4 A shows that compared with the control group OE-NC, overexpression PAFAH1B1 Genes, significantly promoted the protein expression levels of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, and had no significant effect on the protein expression levels of CCNB1 and CCNB2. Figure 4 B shows that compared with the control group ND-NC, the interference PAFAH1B1 genes, significantly inhibited the protein expression levels of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, and significantly promoted the protein expression levels of CCNB1 and CCNB2.

[0052] Example 7: RNA immunoprecipitation (RIP) RIP detection was performed using a RIP kit (MIX, China), and the specific steps were referred to the instruction manual.

[0053] Cell lysis: Collect the COV434 cells cultured in Example 1, wash the cells twice with PBS, add 500 µL RIP lysis buffer, 1.5 µL Protease inhibitor, 1.5 µL DTT and 20 µL RNase inhibitor, vortex to mix, lyse at room temperature for 5 min, and mix by blowing 3 times during the period. Add 500 µL RNase-free water, mix, lyse at room temperature for 5 min, and vortex 3 times during the period. Centrifuge at 12000 g at 4 ℃ for 10 min, and transfer the supernatant to a new RNase-free tube. Add 1.5 µL DNase at 37 ℃ and incubate for 10 min, add 10 µL RNase&DNase inhibitor mix, and mix by inversion 5 times.

[0054] Immunoprecipitation: Take 40 µL of Protein A / G beads, add 200 µL of RIP washing buffer, mix well, remove the supernatant on a magnetic rack, wash Protein A / G beads twice, and resuspend Protein A / G beads in 40 µL of RIP washing buffer. Divide the cell lysate into 3 portions (400 µL for IP group, 400 µL for IgG group, and 200 µL for Input group). Add 3 µg of IP-grade antibody (Anti-PAFAH1B1, Active motif, USA) and 20 µL of Protein A / G beads to the IP group, add 1.5 µL of IgG antibody and 20 µL of Protein A / G beads to the IgG group, and store the Input group at -20 ℃. Incubate the IP and IgG groups at room temperature for 1 h on a vertical mixer, collect the beads with a magnetic rack, and discard the supernatant. Add 500 µL of RIPwashing buffer to the IP and IgG groups, wash at room temperature for 3 min, collect the beads with a magnetic rack, discard the supernatant, and wash 3 times. Add 100 µL Polysome elution buffer to each of the IP and IgG groups, mix by inversion for 3 times, and then add 200 µL RNA binding buffer. Add only 200 µL RNA binding buffer to the Input group, mix by inversion for 5 times. Transfer the solution to the Nucleic Acid column, centrifuge at 12000 g at 4 ℃ for 1 min, and discard the waste liquid. Add 300 µL wash buffer, centrifuge at 12000 g at 4 ℃ for 1 min, and discard the waste liquid. Repeat the wash once.

[0055] RNA elution: stand at room temperature for 10 min, add 50 µL RNase-free water for elution, centrifuge at 4 ℃ 12000 g for 1 min, and collect RNA liquid. Then perform qRT-PCR. All components involved in the above steps are from the kit.

[0056] RIP results are as follows Figure 5 As shown, the results show that PAFAH1B1 Significantly binds to CDK1, CDK2, CCNB1, CCNB2, and CCNE1 at the mRNA level.

[0057] Example 8: Co-Immunoprecipitation (CoIP) The CoIP kit (ACE, China) was used for detection, and the specific steps were referred to the instruction manual.

[0058] Cell lysis: COV434 cells cultured in Example 1 were collected, washed twice with PBS, and 200 μL of pre-cooled 1× Lysis / Wash Buffer (Enhanced) was added to the cells and incubated on ice for 5 min. The lysed sample was transferred to a new centrifuge tube, centrifuged at 13000 g for 10 min, and the supernatant was transferred to a new centrifuge tube. The protein concentration was determined using a BCA protein quantification kit (Biosharp, China).

[0059] Immunoprecipitation: Rinse the magnetic beads. Mix the rProtein A / G MagPoly Beads thoroughly, take 20 µL in a 1.5mL centrifuge tube, add 180 µL 1× Lysis / Wash Buffer (Enhanced), vortex to mix, collect the magnetic beads with a magnetic stand, discard the supernatant, and wash twice. Antibody incubation. See Example 6 for the secondary antibody. Incubate the cell lysis sample prepared in this example with the antibody for 30 min respectively. The recommended antibody dosage is 5 µg. If the volume is insufficient, adjust the sample volume to 500 µL with 1× Lysis / Wash Buffer (Enhanced). Add the washed magnetic beads, incubate overnight at 4°C with rotation, collect the magnetic beads with a magnetic stand, and discard the supernatant. Add 500 µL 1× Lysis / Wash Buffer (Enhanced), invert and mix for 1 min, collect the magnetic beads with a magnetic stand, discard the supernatant, and repeat twice. Add 500 µL 1× Lysis / Wash Buffer (Enhanced), transfer the tube together with the magnetic beads to a new centrifuge tube, invert and mix for 1 min, collect the magnetic beads using a magnetic rack, and discard the supernatant.

[0060] Protein elution: Add 50 µL electrophoresis loading buffer and incubate in a 100 ℃ water bath for 10 min. Collect the beads using a magnetic rack and transfer the eluate to a new centrifuge tube. All components involved in the above steps are from the kit.

[0061] CoIP results are as follows Figure 6 shown. Figure 6 A shows that PAFAH1B1 can pull down CDK1, CDK2, CDK4, CCND1, CCNB2, CCNE1 and CCNE2 proteins, that is, PAFAH1B1 binds to CDK1, CDK2, CDK4, CCND1, CCNB2, CCNE1 and CCNE2 proteins.

[0062] Reverse CoIP showed that CCND1 was able to pull down PAFAH1B1 and CDK4, that is, CCND1 bound to CDK4 and PAFAH1B1 ( Figure 6 B). CCNB1 cannot pull down PAFAH1B1, that is, CCNB1 does not bind to PAFAH1B1 protein ( Figure 6 C). CCNB2 cannot pull down PAFAH1B1, that is, CCNB2 does not bind to PAFAH1B1 protein ( Figure 6 D). CCNE1 can pull down PAFAH1B1, CDK2 and CDK1, that is, CCNE1 binds to PAFAH1B1, CDK2 and CDK1 proteins ( Figure 6 E). CCNE2 cannot pull down PAFAH1B1, CDK2 and CDK1, that is, CCNE2 does not bind to PAFAH1B1, CDK2 and CDK1 proteins ( Figure 6 F).

[0063] The present application constructed an overexpression vector pCDNA3.1-PAFAH1B1 and synthesized PAFAH1B1 Gene interference fragments PAFAH1B1-siRNA1, PAFAH1B1-siRNA2, PAFAH1B1-siRNA3, verified the overexpression vector and PAFAH1B1 Gene interference fragments can effectively affect PAFAH1B1 Gene expression activity. PAFAH1B1 The association between gene expression and granulosa cell cycle revealed PAFAH1B1 The essence of gene expression affecting the cell cycle is PAFAH1B1 Gene expression affected the key cell cycle genes CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, CCNE1 、 The mRNA and protein expression levels of CCNE2 were manipulated PAFAH1B1 It provides a theoretical basis and methodological guidance for effectively controlling key cell cycle genes in granulosa cells by gene expression, and then regulating the cell cycle of granulosa cells. PAFAH1B1 It can significantly bind to some key cell cycle genes at the mRNA level and protein level, thereby affecting the mRNA level and protein expression level of key cell cycle genes. PAFAH1B1 The combination of genes and key genes affecting the cell cycle provides a theoretical basis and methodological guidance for affecting the granulosa cell cycle.

[0064] The above description of the specific implementation methods of the present application discloses the technical details of the present application in detail and illustrates the technical ideas of the present application, which is intended to meet the authorization provisions of the Patent Law, but should not be considered as limiting the scope of protection of the present application. Researchers in this field can make various changes or deformations based on the present application and in combination with the knowledge and technology at that time. As long as they do not deviate from the core ideas and spirit of the present application, they should all fall within the scope of protection of the claims attached to the present application.

Claims

1. A PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized in that, Regulates the ovarian granulosa cells PAFAH1B1 Gene expression regulates the ovarian granulosa cell cycle, including increased PAFAH1B1 Gene expression or activity; or PAFAH1B1 or steps involving promoting or inhibiting gene expression or activity in recipient cells. PAFAH1B1 Steps in which gene expression products bind to cyclins and cyclin-dependent kinases.

2. A method according to claim 1 PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized in that, by PAFAH1B1 The gene sequence is the target fragment, designed and synthesized PAFAH1B1 Gene overexpression vector primer F and primer R, COV434 as a template to amplify the target fragment, construct PAFAH1B1 Overexpression vector; the sequence of the primer F is shown in SEQ ID NO: 21, and the sequence of the primer R is shown in SEQ ID NO: 22; in vitro, the PAFAH1B1 Overexpression vectors are introduced into recipient cells to PAFAH1B1 The gene is expressed in the recipient cells.

3. A method according to claim 1 PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized in that, Design and synthesize siRNA interference fragments, and introduce the siRNA interference fragments into receptor cells in vitro to interfere with the expression of PAFAH1B1 expression; the siRNA interference fragment is PAFAH1B1-siRNA1, and the sequence of PAFAH1B1-siRNA1 is shown in SEQ ID NO:

23.

4. A method according to claim 3 PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized in that, The siRNA interference fragment is PAFAH1B1-siRNA2, and the sequence of PAFAH1B1-siRNA2 is shown in SEQ ID NO:

24.

5. A method according to claim 3 PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized in that, The siRNA interference fragment is PAFAH1B1-siRNA3, and the sequence of PAFAH1B1-siRNA3 is shown in SEQ ID NO:

25.

6. A method according to any one of claims 1 to 2 PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized by: In vitro environment, construct PAFAH1B1 Overexpression vector, transfected PAFAH1B1 Overexpression of the vector into granulosa cells reduced the proportion of cells in the G1 phase and increased the proportion of cells in the G2 / M phase.

7. A method according to any one of claims 1 or 3 to 5. PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized by: The siRNA interference fragment was used to transfect granulosa cells to reduce PAFAH1B1 Expression of β-actin increased the proportion of granulosa cells in the G1 phase and decreased the proportion of cells in the G2 / M phase.

8. A method according to any one of claims 1 to 5 PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized by: Overexpression PAFAH1B1 It can promote the expression of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, inhibit the mRNA levels of CCNB1 and CCNB2, and affect the cell cycle of granulosa cells; interfere with PAFAH1B1 Gene, which can inhibit the expression of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, promote the expression of CCNB1 and CCNB2, and affect the cell cycle of granulosa cells.

9. A method according to claim 8 PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized by: Influence PAFAH1B1 Binding to any of CDK1, CDK2, CCNB1, CCNB2, and CCNE1 at the mRNA level affects the cell cycle.

10. A method according to claim 8 PAFAH1B1 The application of the gene in the ovarian granulosa cell cycle is characterized by: Influencing the binding of PAFAH1B1 at the protein level with any one or more of the complexes of CDK1, CDK2, CDK4, CCND1, CCNB2, CCNE1, and CCNE2 affects the cell cycle.

Images