Application of PAFAH1B1 gene in ovarian granulosa cell cycle
By regulating the expression level of the PAFAH1B1 gene, the ovarian granulosa cell cycle is regulated, which solves the problem of insufficient regulation of the ovarian granulosa cell cycle in existing technologies and achieves effective regulation of follicle development and ovarian granulosa cell function.
Patent Information
- Application Number
- CN202411826951.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-11
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-12-11
AI Technical Summary
There is a lack of effective methods for regulating the ovarian granulosa cell cycle in the current technology, which affects follicle development and ovarian granulosa cell function.
By regulating the expression level of the PAFAH1B1 gene, including increasing or decreasing its expression level or promoting its binding to cyclins and cyclin-dependent kinases, PAFAH1B1 gene overexpression vectors and siRNA interference fragments were introduced into recipient cells in vitro to affect cell cycle progression.
It significantly affects the cell cycle of ovarian granulosa cells, regulates granulosa cell function and follicle development, and provides a simple and efficient regulatory pathway, revealing the mechanism by which the PAFAH1B1 gene affects key genes in the cell cycle.
Smart Images

Figure CN119614634B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the technical field of gene expression regulation, specifically to a... PAFAH1B1 Application of genes in the ovarian granulosa cell cycle. Background Technology
[0002] Ovarian granulosa cells are the main components of follicles, and their function is closely related to whether follicles develop normally. Among them, the cell cycle of ovarian granulosa cells is one of the main factors affecting the function of ovarian granulosa cells.
[0003] Cell cycle progression is primarily regulated by cyclins and cyclin-dependent kinases (CDKs). Cyclin E1 (CCNE1) is a key gene involved in cell cycle regulation. CCNE1 forms a complex with cyclin-dependent kinase 2 (CDK2), promoting the G1 / S phase progression. Overexpression of CCNE1 in human osteosarcoma cells significantly promotes cell entry into the S phase, leading to double-strand DNA breaks. Furthermore, CCNE1 can also activate CDK1, promoting cell transition to the M phase. Existing research indicates that key genes involved in cell cycle regulation include CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, CCNE1, and CCNE2. Discovering a new regulatory mechanism that influences multiple cyclins and cyclin-dependent kinases upstream, thereby affecting the cell cycle, would simplify and streamline cell cycle regulation.
[0004] Platelet activating factor acetylhydrolase 1B regulatory subunit 1 (PAFAH1B1) is a regulatory subunit of platelet activating factor (PAF). As a lipid messenger, PAF can activate the MAPK signaling pathway and participates extensively in biological processes. However, PAFAH1B1 There are currently no reports on whether regulating the cell cycle of ovarian granulosa cells can participate in follicle development. Summary of the Invention
[0005] To more simply and efficiently regulate the granulosa cell cycle, thereby regulating granulosa cell function and follicle development, the purpose of this application is to provide a... PAFAH1B1 Application of genes in the ovarian granulosa cell cycle.
[0006] To achieve the purpose of this application, this application provides a PAFAH1B1 The application of genes in the ovarian granulosa cell cycle employs the following technical approach:
[0007] Regulating the ovarian granulosa cells PAFAH1B1 Gene expression regulates the ovarian granulosa cell cycle, including increasing... PAFAH1B1 Steps involving reducing gene expression levels or activity; or steps involving reducing gene expression levels or activity. PAFAH1B1 Steps involving gene expression levels or activity; or steps that include promoting or inhibiting gene expression in recipient cells. PAFAH1B1 The steps involved in the binding of gene expression products to cyclins and cyclin-dependent kinases. Further, with... PAFAH1B1 Design and synthesize gene sequences as target fragments. PAFAH1B1 Gene overexpression vector primers F and R were used to amplify the target fragment using COV434 as a template to construct... PAFAH1B1 Overexpression vector;
[0008] The sequence of primer F is shown in SEQ ID NO: 21, and the sequence of primer R is shown in SEQ ID NO: 22; in vitro, the primer F is subjected to... PAFAH1B1 Overexpression vector is introduced into recipient cells, causing PAFAH1B1 The gene is expressed within the recipient cells.
[0009] More specifically, it is PAFAH1B1 Using the CDS region sequence of a gene as the target fragment, design and synthesize... PAFAH1B1 Primers for gene overexpression vectors.
[0010] Furthermore, an siRNA interference fragment was designed and synthesized. In vitro, the siRNA interference fragment was introduced into recipient cells to interfere with the function of the recipient cells. PAFAH1B1 The expression of the siRNA; the siRNA interference fragment is PAFAH1B1-siRNA1, and the sequence of PAFAH1B1-siRNA1 is shown in SEQ ID NO: 23.
[0011] Furthermore, the siRNA interference fragment is PAFAH1B1-siRNA2, and the sequence of PAFAH1B1-siRNA2 is shown in SEQ ID NO: 24.
[0012] Furthermore, the siRNA interference fragment is PAFAH1B1-siRNA3, and the sequence of PAFAH1B1-siRNA3 is shown in SEQ ID NO: 25.
[0013] More specifically, a 100 nM concentration of PAFAH1B1-siRNA3 was selected for subsequent research and named ND-PAFAH1B1.
[0014] Furthermore, in an in vitro environment, construct PAFAH1B1 Transfected with the expression vector PAFAH1B1 Overexpression of the vector into granulosa cells reduced the proportion of granulosa cells in the G1 phase and increased the proportion of cells in the G2 / M phase.
[0015] Experimental results show that transfection of the above-mentioned PAFAH1B1 Overexpression vector into granulosa cells can promote PAFAH1B1 Expression significantly reduced the proportion of granulocytes in G1 phase and increased the proportion of cells in G2 / M phase.
[0016] Furthermore, the siRNA interference fragment was used to transfect granulosa cells to reduce... PAFAH1B1 Expression increases the proportion of granulocytes in G1 phase and decreases the proportion of cells in G2 / M phase.
[0017] Experimental results show that transfecting granulosa cells with the aforementioned siRNA interference fragment reduces... PAFAH1B1 Expression of this substance can significantly increase the proportion of granulocytes in the G1 phase and decrease the proportion of cells in the G2 / M phase.
[0018] Furthermore, overexpression PAFAH1B1 It can promote the expression of CDK1, CDK2, CDK4, CCND1, CCNE1, and CCNE2, inhibit the mRNA levels of CCNB1 and CCNB2, and affect the cell cycle of granulocytes; it interferes with... PAFAH1B1 The gene can inhibit the expression of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, promote the expression of CCNB1 and CCNB2, and affect the cell cycle of granulocytes.
[0019] Experimental results show that overexpression PAFAH1B1 The gene significantly promoted the mRNA levels of CDK1, CDK2, CDK4, CCND1, CCNE1, and CCNE2, and significantly suppressed the mRNA levels of CCNB1 and CCNB2. Interference PAFAH1B1 The gene significantly suppressed the mRNA levels of CDK1, CDK2, CDK4, CCND1, and CCNE1, suppressed the mRNA level of CCNE2 (with no significant difference), and significantly promoted the mRNA levels of CCNB1 and CCNB2. Overexpression of the gene significantly reduced the mRNA levels of both. PAFAH1B1 The gene significantly promoted the protein expression levels of CDK1, CDK2, CDK4, CCND1, CCNE1, and CCNE2, but had no significant effect on the protein expression levels of CCNB1 and CCNB2. Interference PAFAH1B1The gene significantly suppressed the protein expression levels of CDK1, CDK2, CDK4, CCND1, CCNE1, and CCNE2, and significantly promoted the protein expression levels of CCNB1 and CCNB2.
[0020] Furthermore, the impact PAFAH1B1 Binding to any one of CDK1, CDK2, CCNB1, CCNB2, or CCNE1 at the mRNA level affects the cell cycle.
[0021] Furthermore, the impact PAFAH1B1 The binding of complexes to one or more of CDK1, CDK2, CDK4, CCND1, CCNB2, CCNE1, and CCNE2 at the protein level affects the cell cycle.
[0022] In summary, this application provides a PAFAH1B1 The application of genes in the ovarian granulosa cell cycle has the following technical effects:
[0023] Firstly, the method of this application is the first to verify... PAFAH1B1 Gene expression levels can significantly affect the cell cycle of granulocytes, providing a simple and effective new approach for regulating the granulocyte cell cycle.
[0024] Secondly, the application discloses PAFAH1B1 The molecular mechanisms by which genes influence the cell cycle by affecting the mRNA and protein levels of CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, CCNE1, and CCNE2 genes in ovarian granulosa cells, and their applications, provide insights for subsequent regulation of the cell cycle. PAFAH1B1 This provides a reference for understanding how genes influence the function of granulosa cells in mammalian ovaries, follicle development, and the onset of puberty.
[0025] Third, this application has developed and verified the ability to […]. PAFAH1B1 Gene expression is affected by knocking down interfering fragments of gene expression, thus inhibiting gene expression. PAFAH1B1 Gene expression provides valuable new research material. Attached Figure Description
[0026] Figure 1 A represents the optimal concentration for detecting the overexpression vector.
[0027] Figure 1 B is the optimal concentration for detecting interfering fragments.
[0028] Figure 2 A is the overexpression detected by flow cytometry. PAFAH1B1 Effects on the granulocyte cell cycle.
[0029] Figure 2B is interference detected by flow cytometry. PAFAH1B1 Effects on the granulocyte cell cycle.
[0030] Figure 3 A is the overexpression detected by qRT-PCR. PAFAH1B1 Effects on the expression levels of key genes in the granulocyte cell cycle mRNA.
[0031] Figure 3 B represents interference from qRT-PCR detection. PAFAH1B1 Effects on the expression levels of key genes in the granular cell cycle mRNA.
[0032] Figure 4 A is the result of Western blot detection of overexpression. PAFAH1B1 Effects on the expression levels of key gene proteins in the granulocyte cell cycle.
[0033] Figure 4 B represents interference detected by Western blot. PAFAH1B1 Effects on the expression levels of key gene proteins in the granulocyte cell cycle.
[0034] Figure 5 It is a RIP detection PAFAH1B1 Binding of cell cycle-related genes at the mRNA level.
[0035] Figure 6 CoIP testing PAFAH1B1 The binding of cell cycle-related genes at the protein level. Detailed Implementation
[0036] This application provides a PAFAH1B1 The application of genes in the ovarian granulosa cell cycle was carried out in vitro using the human ovarian granulosa cancer cell line COV434 as the experimental cell.
[0037] The human ovarian granulosa cell carcinoma line COV434 used in this application was purchased from Wuhan Pronosai Life Science Technology Co., Ltd., and was resuscitated, cultured and cryopreserved in the cell laboratory of South China Agricultural University.
[0038] The embodiments of the present invention will be further described below with reference to the accompanying drawings and specific examples. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. It should be noted that many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can also be implemented in other ways different from those described herein. Therefore, the scope of protection of the present invention is not limited to the specific embodiments disclosed below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0039] This invention employs statistical methods to analyze the results of three independent experiments in each embodiment, calculating the "mean ± standard deviation" for each experiment, and using one-way ANOVA to analyze the significance of differences (as indicated by "*" in the figure). P <0.05, "**" indicates P <0.01).
[0040] Example 1: Culture of human ovarian granulosa carcinoma cell line COV434
[0041] COV434 thawing: Thaw frozen cells in a 37 ℃ water bath, centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend cells in DMEM complete medium, and seed into 25 mL cell culture flasks (Thermo, USA). The culture medium consists of 4.45 mL DMEM high glucose medium (Hyclone, USA), 500 µL fetal bovine serum (Hyclone, USA), and 50 µL penicillin-streptomycin antibiotics (Hyclone, USA). Incubate at 37 ℃ in a 5% CO2 incubator.
[0042] COV434 plating: Observe the COV434 cell status. When the cell confluence reaches approximately 80%, discard the culture medium and wash the cells twice with PBS preheated to 37°C (containing 1% (v / v) penicillin and streptomycin). Digest the cells with 0.25% trypsin preheated to 37°C for 5 min, terminate the digestion with DMEM complete medium, and wash the cells twice with PBS preheated to 37°C (containing 1% (v / v) penicillin and streptomycin). Resuspend the cells in DMEM complete medium, add the cell suspension evenly to the cell culture plate, and make up the volume with DMEM complete medium, gently shaking to mix. Incubate at 37°C, 5% CO2. After 24 h, observe the KGN growth. When the cell confluence in the cell culture plate reaches approximately 80%, proceed with subsequent experiments.
[0043] Example 2: qRT-PCR
[0044] In this invention, the qRT-PCR detection of genes was performed using the Maxima SYBR Green qPCR Master Mix (2X) kit (Thermo Scientific, USA). The relative expression levels of genes in the samples were determined using the Ct value method, with GAPDH used as an internal control. The qRT-PCR primers used in this invention are shown in Table 1. Specific calculation formulas are as follows:
[0045] Relative gene expression level = 2 - {<(Ct value of target gene in experimental group) - (Ct value of internal reference gene in experimental group)> - <(Ct value of target gene in control group) - (Ct value of internal reference gene in control group)>}.
[0046] Table 1 qRT-PCR primer sequences
[0047]
[0048]
[0049] Example 3: Transfection PAFAH1B1 Overexpression vector and interfering fragment into cells
[0050] Build PAFAH1B1 Gene overexpression vector: Search for the target gene on NCBI PAFAH1B1 The CDS region sequence of (NCBI Gene ID: 397482) was analyzed using BioEdit software to determine the distribution of restriction enzyme sites for the target fragment. Referring to the pCDNA3.1(+) vector map (Guangzhou Dongze Biotechnology Co., Ltd., China), the amplification... PAFAH1B1 The restriction enzyme site is Kpn I and Nhe I. Using Primer Premier 5.0 software, design enzyme digestion primers for the target fragment and amplify... PAFAH1B1 The target gene fragment is ligated into the pCDNA3.1 vector to obtain the recombinant plasmid pCDNA3.1-PAFAH1B1, which is... PAFAH1B1 Gene overexpression vectors, in which PAFAH1B1 Primer information for gene overexpression vectors is shown in Table 2.
[0051] Transfection PAFAH1B1 Overexpression vector: The Lipofectamine® 3000 kit (Invitrogen, USA) was used, and the specific experimental procedures were followed according to the manufacturer's instructions. COV434 cells with 80% confluence as described in Example 1 were transfected with 200 ng, 500 ng, and 1000 ng of the recombinant plasmid pCDNA3.1-PAFAH1B1 and the control pCDNA3.1, respectively, in triplicate. The transfected 6-well plates were incubated at 37°C in a 5% CO2 incubator. Cell status was observed 24 h post-transfection; cells were collected when growth was good. The expression was detected using the qRT-PCR method described in Example 2. PAFAH1B1 Level of expression.
[0052] Table 2 PAFAH1B1 Gene overexpression vector primers
[0053]
[0054] Note: Bolded parts are protective bases, and underlined parts are enzyme cleavage sites.
[0055] qRT-PCR results are as follows Figure 1As shown in Figure A, compared with the control group, transfection of COV434 cells with 200 ng, 500 ng, and 1000 ng of plasmid pCDNA3.1-PAFAH1B1 and pCDNA3.1, respectively, at all three concentrations significantly promoted the growth of the control group. PAFAH1B1 Higher gene expression concentration leads to better results. Therefore, the transfection concentration chosen for subsequent experiments was 1000 ng. In subsequent experiments, the recombinant plasmid pCDNA3.1-PAFAH1B1 of this example was named OE-PAFAH1B1, and the overexpression control pCDNA3.1(+) vector was named OE-NC.
[0056] synthesis PAFAH1B1 Gene interference fragment: synthesized by Guangzhou Dongze Biotechnology Co., Ltd. (China) PAFAH1B1 The gene interference fragments PAFAH1B1-siRNA1, PAFAH1B1-siRNA2, and PAFAH1B1-siRNA3 have the following sequences (in the sequence listing, "t" represents "U").
[0057] PAFAH1B1-siRNA1: GCAUUGAGGUGGUCAUAGGA (SEQ ID NO: 23);
[0058] PAFAH1B1-siRNA2: GGCAUACAGACUCUGUACA (SEQ ID NO: 24);
[0059] PAFAH1B1-siRNA3: GGCCAUGACCACAAUGUUU (SEQ ID NO: 25).
[0060] Transfection PAFAH1B1 Gene interference fragments: The Lipofectamine® 3000 kit (Invitrogen, USA) was used, with specific experimental procedures following the manufacturer's instructions. COV434 cells with 80% confluence (as described in Example 1) were transfected with 50 nM and 100 nM PAFAH1B1-siRNA1, PAFAH1B1-siRNA2, PAFAH1B1-siRNA3, and NC-siRNA, respectively, in triplicate for each group. The transfected plates were incubated at 37°C in a 5% CO2 incubator. Cell status was observed 24 h post-transfection; cells were collected once growth was deemed optimal. Detection was performed using the qRT-PCR method described in Example 2. PAFAH1B1 Gene expression level.
[0061] qRT-PCR results are as follows Figure 1 As shown in Figure B, compared with the control group, transfection with 50 nM and 100 nM of the interfering fragments significantly inhibited [the virus]. PAFAH1B1 Gene expression was assessed, with the 100 nM interfering fragment PAFAH1B1-siRNA3 showing the best effect. Therefore, the 100 nM interfering fragment PAFAH1B1-siRNA3 was selected as the transfection concentration for subsequent experiments. In subsequent experiments, the PAFAH1B1-siRNA3 in this example was named ND-PAFAH1B1, and its interfering control NC-siRNA was named ND-NC.
[0062] Example 4: Flow Cytometry Detection of Cell Cycle
[0063] COV434 cells transfected with 1000 ng of overexpression vector OE-PAFAH1B1, overexpression control OE-NC, 100 nM of interference fragment ND-PAFAH1B1, and interference control ND-NC were collected as described in Example 3. Cells were washed twice with PBS, digested for 5 min with 0.25% trypsin (Thermo, USA) preheated to 37°C, and digestion was terminated with DMEM complete medium. Cells were washed twice with PBS preheated to 37°C (containing 1% (v / v) penicillin-streptomycin). Cells were fixed with 70% ethanol at 4°C for at least 4 h, washed twice with pre-cooled PBS, centrifuged at 2000 rpm for 5 min, the supernatant was discarded, and cells were gently resuspended in 400 µL of ethidium bromide. 100 µL of RNase was added, and the cells were incubated at 4°C in the dark for 30 min. Cell cycle was analyzed by flow cytometry within 24 h, with three replicates per group.
[0064] Flow cytometry results of cell cycle detection are as follows Figure 2 As shown. Figure 2 A indicates that, compared with the overexpression control OE-NC, COV434 cells transfected with the overexpression vector OE-PAFAH1B1 showed a significant decrease in the proportion of cells in the G1 phase and a significant increase in the proportion of cells in the G2 / M phase. Figure 2 B indicates that, compared with the interference control ND-NC, COV434 cells transfected with the interference fragment ND-PAFAH1B1 showed a significantly increased proportion of cells in the G1 phase and a significantly decreased proportion of cells in the G2 / M phase.
[0065] Example 5: PAFAH1B1 Effects on the expression levels of key cell cycle genes mRNA
[0066] Cells transfected with 1000 ng of overexpression vector OE-PAFAH1B1, overexpression control OE-NC, 100 nM interference fragment ND-PAFAH1B1, and interference control ND-NC were collected in Example 3. Total RNA was extracted from the cells, and the integrity of the RNA was detected by agarose gel electrophoresis. RNA reverse transcription was performed according to the PrimerScript™ RT reagent kit (Takara, Japan) instructions, and qRT-PCR was performed as in Example 2 to detect RNA. PAFAH1B1 Overexpression or interference PAFAH1B1 Effects of expression on the mRNA levels of key cell cycle genes CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, CCNE1, and CCNE2.
[0067] qRT-PCR results are as follows Figure 3 As shown. Figure 3 A indicates that, compared to the control group, overexpression PAFAH1B1 The gene significantly promoted the mRNA levels of CDK1, CDK2, CDK4, CCND1, CCNE1, and CCNE2, and significantly inhibited the mRNA levels of CCNB1 and CCNB2. Figure 3 B indicates that, compared with the control group, the interference PAFAH1B1 The gene significantly suppressed the mRNA levels of CDK1, CDK2, CDK4, CCND1, and CCNE1, suppressed the mRNA level of CCNE2 (with no significant difference), and significantly promoted the mRNA levels of CCNB1 and CCNB2.
[0068] Example 6: PAFAH1B1 Effects on the expression levels of key cell cycle genes and proteins
[0069] Following the total protein extraction kit (Thermo, USA), total protein was extracted from COV434 cells transfected with 1000 ng of overexpression vector OE-PAFAH1B1, overexpression control OE-NC, 100 nM interference fragment ND-PAFAH1B1, and interference control ND-NC. Protein quantification was performed using a BCA protein quantification kit (Biosharp, China). Western blotting was conducted, and Image Plus software was used for analysis. Protein bands in the blot film, with antibodies including Anti-CDK1 (Abclonal, China, A0220), Anti-CDK2 (Affinity, USA, DF6237), Anti-CDK4 (Affinity, USA, DF6102), Anti-CCND1 (Affinity, USA, DF0931), Anti-CCNB1 (Bioss, China, bsm-52044R), Anti-CCNB2 (Bioss, China, bs-6656R), Anti-CCNE1 (Proteintech, China, 11554-1-AP), and Anti-CCNE2 (Proteintech, China, 11935-1-AP). The study investigated overexpression... PAFAH1B1 or interference PAFAH1B1 Effects of expression on the protein expression levels of key cell cycle genes CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, CCNE1, and CCNE2.
[0070] Western Blot results are as follows: Figure 4 As shown, where Figure 4 A indicates that, compared to the control group OE-NC, overexpression PAFAH1B1 The gene significantly promoted the protein expression levels of CDK1, CDK2, CDK4, CCND1, CCNE1, and CCNE2, but had no significant effect on the protein expression levels of CCNB1 and CCNB2. Figure 4 B indicates that, compared to the control group ND-NC, the interference... PAFAH1B1 The gene significantly suppressed the protein expression levels of CDK1, CDK2, CDK4, CCND1, CCNE1, and CCNE2, and significantly promoted the protein expression levels of CCNB1 and CCNB2.
[0071] Example 7: RNA immunoprecipitation (RIP)
[0072] RIP testing was performed using a RIP kit (MIX, China). Please refer to the instruction manual for specific steps.
[0073] Cell lysis: Collect COV434 cells cultured in Example 1, wash cells twice with PBS, add 500 µL RIP lysis buffer, 1.5 µL Protease inhibitor, 1.5 µL DTT, and 20 µL RNase inhibitor, vortex to mix, and lyse at room temperature for 5 min, mixing three times by pipetting during lysis. Add 500 µL RNase-free water, mix, and lyse at room temperature for 5 min, vortexing three times during lysis. Centrifuge at 12000 g for 10 min at 4 ℃, and transfer the supernatant to a new RNase-free tube. Incubate at 37 ℃ with 1.5 µL LDNase for 10 min, add 10 µL RNase & DNase inhibitor mix, and invert to mix five times.
[0074] Immunoprecipitation: Take 40 µL of Protein A / G beads, add 200 µL of RIP washing buffer, mix well, remove the supernatant on a magnetic rack, repeat the washing process twice, and resuspend the Protein A / G beads in 40 µL of RIP washing buffer. Divide the cell lysate into three aliquots (400 µL for the IP group, 400 µL for the IgG group, and 200 µL for the Input group). Add 3 µg of IP-grade antibody (Anti-PAFAH1B1, Active motif, USA) and 20 µL of Protein A / G beads to the IP group, add 1.5 µL of IgG antibody and 20 µL of Protein A / G beads to the IgG group, and store the Input group at -20 °C. Incubate the IP and IgG groups at room temperature for 1 h on a vertical mixer, collect the beads using a magnetic rack, and discard the supernatant. Add 500 µL of RIP washing buffer to each of the IP and IgG groups, wash at room temperature for 3 min, collect the beads using a magnetic rack, discard the supernatant, and wash three times. Add 100 µL of polysome elution buffer to each of the IP and IgG groups, invert and mix 3 times, then add 200 µL of RNA binding buffer. Add only 200 µL of RNA binding buffer to the Input group, invert and mix 5 times. Transfer the solution to a Nucleic Acid column, centrifuge at 12000 g for 1 min at 4 ℃, and discard the waste liquid. Add 300 µL of wash buffer, centrifuge at 12000 g for 1 min at 4 ℃, and discard the waste liquid. Repeat the wash once.
[0075] RNA elution: Incubate at room temperature for 10 min, add 50 µL of RNase-free water, centrifuge at 12000 g for 1 min at 4 ℃, and collect the RNA liquid. Then perform qRT-PCR. All components involved in the above steps were obtained from the kit.
[0076] RIP results are as follows Figure 5 As shown, the results indicate that PAFAH1B1 It significantly binds to CDK1, CDK2, CCNB1, CCNB2, and CCNE1 at the mRNA level.
[0077] Example 8: Co-Immunoprecipitation (CoIP)
[0078] The detection was performed using a CoIP kit (ACE, China). Please refer to the instruction manual for specific steps.
[0079] Cell lysis: COV434 cells cultured in Example 1 were collected, washed twice with PBS, and 200 µL of pre-chilled 1× Lysis / Wash Buffer (Enhanced) was added to the cells. The cells were incubated on ice for 5 min. The lysed sample was transferred to a new centrifuge tube, centrifuged at 13000g for 10 min, and the supernatant was transferred to a new centrifuge tube. Protein concentration was determined using a BCA protein quantification kit (Biosharp, China).
[0080] Immunoprecipitation: Wash magnetic beads. Thoroughly mix rProtein A / G MagPoly Beads, transfer 20 µL to a 1.5 mL centrifuge tube, add 180 µL of 1× Lysis / Wash Buffer (Enhanced), vortex to mix, collect the magnetic beads using a magnetic rack, discard the supernatant, and wash twice. Antibody incubation. Secondary antibody is described in Example 6. Incubate the cell lysate sample prepared in this example with the antibody for 30 min each. The recommended antibody volume is 5 µg; if the volume is insufficient, adjust the sample volume to 500 µL with 1× Lysis / Wash Buffer (Enhanced). Add the washed magnetic beads, incubate overnight at 4 °C with rotation, collect the magnetic beads using a magnetic rack, and discard the supernatant. Add 500 µL of 1× Lysis / Wash Buffer (Enhanced), invert to mix for 1 min, collect the magnetic beads using a magnetic rack, discard the supernatant, and repeat twice. Add 500 µL of 1× Lysis / Wash Buffer (Enhanced) and transfer it along with the magnetic beads to a new centrifuge tube. Invert and mix for 1 min. Collect the magnetic beads using a magnetic rack and discard the supernatant.
[0081] Protein elution: Add 50 µL of electrophoresis loading buffer and incubate at 100 °C for 10 min. Collect the magnetic beads using a magnetic rack and transfer the eluent to a new centrifuge tube. All components involved in the above steps are from the kit.
[0082] CoIP results are as follows Figure 6 As shown. Figure 6 A indicates that PAFAH1B1 can pull down CDK1, CDK2, CDK4, CCND1, CCNB2, CCNE1, and CCNE2 proteins, meaning that PAFAH1B1 binds to these proteins.
[0083] Reverse CoIP indicates that CCND1 can pull down PAFAH1B1 and CDK4, meaning that CCND1 binds to CDK4 and PAFAH1B1. Figure 6 B). CCNB1 cannot pull down PAFAH1B1, meaning CCNB1 does not bind to the PAFAH1B1 protein. Figure 6 C). CCNB2 cannot pull down PAFAH1B1, meaning CCNB2 does not bind to the PAFAH1B1 protein. Figure 6 D). CCNE1 can pull down PAFAH1B1, CDK2, and CDK1, meaning CCNE1 binds to the proteins PAFAH1B1, CDK2, and CDK1. Figure 6 E). CCNE2 cannot pull down PAFAH1B1, CDK2, and CDK1, meaning CCNE2 does not bind to the PAFAH1B1, CDK2, and CDK1 proteins. Figure 6 F).
[0084] This application constructed the overexpression vector pCDNA3.1-PAFAH1B1 and synthesized... PAFAH1B1 Gene interference fragments PAFAH1B1-siRNA1, PAFAH1B1-siRNA2, and PAFAH1B1-siRNA3 were used to verify the overexpression vector and its efficacy. PAFAH1B1 Gene interference fragments can effectively affect PAFAH1B1 Gene expression activity. This has been clarified. PAFAH1B1 The association between gene expression and granulocyte cell cycle revealed PAFAH1B1 The essence of gene expression affecting the cell cycle is PAFAH1B1 Gene expression affects key cell cycle genes CDK1, CDK2, CDK4, CCND1, CCNB1, CCNB2, and CCNE1. 、 The mRNA and protein expression levels of CCNE2 were manipulated to obtain the data. PAFAH1B1This study provides a theoretical basis and methodological guidance for effectively manipulating key genes in the cell cycle of granulosa cells through gene expression, thereby regulating the cell cycle of granulosa cells. It also further reveals... PAFAH1B1 It can significantly bind to some key cell cycle genes at both the mRNA and protein levels, thereby affecting the mRNA and protein expression levels of these genes. This provides a basis for utilizing... PAFAH1B1 The study provides a theoretical basis and methodological guidance for understanding how genes and their combinations with key genes affecting the cell cycle influence the granular cell cycle.
[0085] The foregoing description of the specific embodiments of this application discloses the technical details of this application in detail and illustrates the technical concept of this application with examples, aiming to meet the authorization requirements of the patent law, but should not be regarded as a limitation on the scope of protection of this application. Researchers in this field can make various changes or modifications based on this application and in combination with the knowledge and technology at that time. As long as they do not deviate from the core concept and spirit of this application, they should all fall within the protection scope of the appended claims.
Claims
1. Regulating human ovarian granulosa cells PAFAH1B1 The application of gene expression in regulating the human ovarian granulosa cell cycle is characterized by, The regulation of human ovarian granulosa cells PAFAH1B1 Gene expression is to increase the PAFAH1B1 Gene expression levels, specifically regulating the human ovarian granulosa cell cycle, involve reducing the proportion of granulosa cells in the G1 phase and increasing the proportion of cells in the G2 / M phase; PAFAH1B1 Design and synthesize gene sequences as target fragments. PAFAH1B1 Gene overexpression vector primers F and R were used to amplify the target fragment using COV434 as a template to construct... PAFAH1B1 Overexpression vector; the sequence of primer F is shown in SEQ ID NO: 21, and the sequence of primer R is shown in SEQ ID NO: 22; in vitro, the... PAFAH1B1 The overexpression vector was introduced into human ovarian granulosa cells, causing... PAFAH1B1 The gene is expressed in the granulosa cells of the human ovary.
2. The method for regulating human ovarian granulosa cells according to claim 1 PAFAH1B1 The application of gene expression in regulating the human ovarian granulosa cell cycle is characterized by, overexpression PAFAH1B1 The gene can promote the expression of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, inhibit the mRNA levels of CCNB1 and CCNB2, reduce the proportion of granulocytes in G1 phase, and increase the proportion of cells in G2 / M phase.
3. Regulating human ovarian granulosa cells PAFAH1B1 The application of gene expression in regulating the human ovarian granulosa cell cycle is characterized by, The regulation of human ovarian granulosa cells PAFAH1B1 Gene expression is reduced PAFAH1B1 Gene expression levels, the regulation of the human ovarian granulosa cell cycle is to increase the proportion of granulosa cells in the G1 phase and decrease the proportion of cells in the G2 / M phase; A siRNA interference fragment was designed and synthesized. In vitro, the siRNA interference fragment was introduced into recipient cells to reduce intracellular emissions in human ovarian granulosa cells. PAFAH1B1 Gene expression.
4. The method for regulating human ovarian granulosa cells according to claim 3 PAFAH1B1 The application of gene expression in regulating the human ovarian granulosa cell cycle is characterized by, The siRNA interference fragment is PAFAH1B1-siRNA1, and the sequence of PAFAH1B1-siRNA1 is shown in SEQ ID NO:
23.
5. The method for regulating human ovarian granulosa cells according to claim 3 PAFAH1B1 The application of gene expression in regulating the human ovarian granulosa cell cycle is characterized by, The siRNA interference fragment is PAFAH1B1-siRNA2, and the sequence of PAFAH1B1-siRNA2 is shown in SEQ ID NO:
24.
6. The method for regulating human ovarian granulosa cells according to claim 3 PAFAH1B1 The application of gene expression in regulating the human ovarian granulosa cell cycle is characterized by, The siRNA interference fragment is PAFAH1B1-siRNA3, and the sequence of PAFAH1B1-siRNA3 is shown in SEQ ID NO:
25.
7. The method for regulating human ovarian granulosa cells according to claim 3 PAFAH1B1 The application of gene expression in regulating the human ovarian granulosa cell cycle is characterized by, reduce PAFAH1B1 Gene expression can inhibit the expression of CDK1, CDK2, CDK4, CCND1, CCNE1 and CCNE2, promote the expression of CCNB1 and CCNB2, increase the proportion of granulocytes in G1 phase, and decrease the proportion of cells in G2 / M phase.
8. The method for regulating human ovarian granulosa cells according to any one of claims 1-3 PAFAH1B1 The application of gene expression in regulating the human ovarian granulosa cell cycle is characterized by: By influencing PAFAH1B1 Genes can influence the cell cycle by binding to any one of CDK1, CDK2, CCNB1, CCNB2, or CCNE1 at the mRNA level.
Citation Information
Patent Citations
Application of RSPO2 gene to porcine ovarian granulosa cells
CN113388614A
Application of TAB2 in porcine ovarian granular cells
CN114941010A