SNP (Single Nucleotide Polymorphism) site related to plateau adaptability and application thereof

Abstract

The invention provides a single nucleotide polymorphism (SNP) site related to plateau adaptability and application thereof. The SNP site is rs79612768, a specific primer and a probe for detecting the rs79612768 SNP site can be used for preparing a detection kit related to plateau adaptability, and the detection kit can be used for screening altitude stress susceptible people, predicting the sickness risk of altitude stress and the like. According to the detection kit, non-invasive operation is adopted, and detection is convenient and harmless. Therefore, the detection kit which is screened, designed and constructed can realize rapid, efficient and economical screening and evaluation of the susceptibility and adaptability of altitude stress.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and in particular relates to a single nucleotide polymorphism (SNP) site for evaluating plateau adaptability and an application thereof. Background Art

[0002] The plateau environment poses a series of challenges to the human body due to its low pressure, low oxygen, and strong radiation. Acute mountain sickness (AMS) is a common problem for people who have not adapted to the plateau environment after entering high altitude areas. Its severity can range from mild discomfort to life-threatening high altitude pulmonary edema (HAPE) and high altitude cerebral edema (HACE). Therefore, screening and evaluating biomarkers of early altitude sickness are crucial for early identification, prevention, and treatment.

[0003] With the rapid development of molecular biology technology, especially in the fields of genomics and genetics, we have a deeper understanding of the genetic factors related to plateau adaptability. Single nucleotide polymorphism (SNP) technology has become an important tool for studying genetic diversity and disease susceptibility due to its high efficiency, accuracy and cost-effectiveness. SNPs are the most common form of genetic variation in the genome, representing variations at a single nucleotide position.

[0004] Using SNP technology, researchers were able to identify loci in specific genes that are associated with high altitude adaptation. These loci may be involved in multiple biological processes, including oxygen transport and utilization, cellular adaptation to hypoxic environments, vascular responses, and antioxidant mechanisms.

[0005] The present invention provides a new method for quickly identifying individuals with a high risk of acute mountain sickness (AMS) by identifying SNP sites associated with plateau adaptability. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention aims to provide a SNP site related to plateau adaptability and a diagnostic kit thereof. To achieve this purpose, the present invention adopts the following technical solutions:

[0007] In the first aspect, the present invention provides a SNP site related to plateau adaptability, wherein the SNP site is rs79612768; wherein rs represents the number of the site in the dbSNP database, located at position 241759237 of human chromosome 2, and contains significant genes such as KIF1A, AGXT and MAB21L4.

[0008] The present invention collects oral buccal mucosa specimens from people exposed to high altitude, groups them according to the degree of altitude sickness (with / without), extracts DNA, and applies whole exome sequencing and bioinformatics technology. The SNP sites that distinguish different altitude sicknesses are screened out through the GWAS method, revealing the connection between genetic characteristics and altitude adaptability.

[0009] In a second aspect, the present invention provides a detection reagent for detecting the SNP site as described in the first aspect.

[0010] The detection reagent of the present invention is used for detecting rs79612768, and provides a basis for the genotyping of the SNP site.

[0011] As a preferred technical solution of the present invention, the primers include a forward primer and a reverse primer; the upstream primer includes a nucleotide sequence as shown in SEQ ID NO.1; and the downstream primer includes a nucleotide sequence as shown in SEQ ID NO.2.

[0012] Preferably, the forward primer is CTCCAGGGAAGCGGAATAGCC (SEQ ID NO.1);

[0013] Preferably, the reverse primer is CAGGTGCCGCTGGAAAAGGT (SEQ ID NO. 2).

[0014] As a preferred technical solution of the present invention, the probe comprises a wild-type probe and a mutant probe; the wild-type probe comprises a nucleotide sequence as shown in SEQ ID NO.3; and the mutant probe comprises a nucleotide sequence as shown in SEQ ID NO.4.

[0015] Preferably, the wild-type probe is GAC C CCCGCCCGCCTAAGC(SEQ ID NO.3);

[0016] Preferably, the mutant probe is GAC A CCCGCCCGCCTAAGC (SEQ ID NO. 4)

[0017] It should be noted that the primer and probe sequences shown in the present invention are not limited to the listed SEQ ID NOs. 1 to 4, and any base sequence that can amplify and detect the rs79612768 site can be used to prepare products for detecting the site.

[0018] In a third aspect, a gene detection kit is provided, wherein the gene detection kit comprises a detection reagent for detecting the SNP site described in the first aspect.

[0019] In a fourth aspect, a gene detection kit for detecting plateau adaptability comprises a detection reagent for amplifying the SNP site described in the first aspect.

[0020] As a preferred technical solution of the present invention, the test sample of the gene detection kit is the body fluid, skin, oropharyngeal swab or subcutaneous tissue of the subject.

[0021] In a fifth aspect, the present invention further provides at least one application of the substance for detecting the SNP site as described in the first aspect as follows:

[0022] (1) Application in the preparation of products for predicting the risk of acute mountain sickness;

[0023] (2) Application in the preparation and identification of products for treating altitude sickness or assisting in the identification of products for treating altitude sickness.

[0024] Among them, predicting the risk of acute mountain sickness can know the plateau adaptability of the test subject in advance; identifying or assisting in the identification of mountain sickness can identify or assist in the identification of whether the test subject suffers from mountain sickness when symptoms occur.

[0025] As a preferred technical solution of the present invention, the substance may include a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2;

[0026] Preferably, the substance may be a wild-type probe as shown in SEQ ID NO.3 and a mutant-type probe as shown in SEQ ID NO.4.

[0027] As a preferred technical solution of the present invention, the substance also includes any one or a combination of at least two of the reagents, instruments, software or models for joint analysis of the SNP sites.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] (1) The present invention aims to fill the gap in the field of plateau adaptation analysis and provide biomarkers for clinical diagnosis and prevention of altitude sickness. By using high-throughput sequencing technology, key SNP sites are identified, the molecular mechanism of plateau adaptation is studied in depth, and the physiological response to hypoxia is associated with disease susceptibility.

[0030] (2) The SNP sites related to plateau adaptability screened out by the present invention include rs79612768, which is located at position 241759237 of human chromosome 2 and contains significant genes such as KIF1A, AGXT and MAB21L4; detecting this site can be used to screen people susceptible to altitude sickness, predict the risk of altitude sickness, or identify or assist in identifying altitude sickness, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Draw Manhattan plots for GWAS analysis. DETAILED DESCRIPTION

[0032] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0033] In the following examples, unless otherwise specified, all reagents and consumables used were purchased from conventional reagent manufacturers in the field; unless otherwise specified, all experimental methods and technical means used were conventional methods and means in the field.

[0034] Example 1

[0035] 1. Sample population and exclusion criteria

[0036] In order to study the differences in altitude sickness among people, 312 healthy adults aged no more than 40 years old were enrolled in this example. Oral buccal mucosal specimens were uniformly collected within 48 hours of high altitude exposure, and all enrolled people were informed of the nature of the study.

[0037] II. Information and Biological Sample Collection

[0038] (1) Information Collection

[0039] All subjects completed the questionnaire within 48 hours of entering the plateau, and the Lake Louise International Acute Mountain Sickness Scoring Standard was used to reflect the degree of mountain sickness. The specific Lake Louise International Acute Mountain Sickness Scoring Standard is shown in Table 1 below.

[0040] Table 1

[0041]

[0042] 1. When scoring each symptom as 0, 1, 2, or 3, it must be an integer;

[0043] 2. The minimum total score is 0 and the maximum is 15;

[0044] 3. Self-assessment is for builders with a high school education or above. This form will be distributed before entering the plateau and professionals will explain how to fill it out. After entering the plateau, the score will be self-scored; however, if the group is large or the individual has low education and does not have a deep understanding of this scoring system, it should be filled out by a doctor. The purpose of self-assessment is to treat oneself as soon as possible (such as when climbing) or to seek medical treatment as soon as possible, so as to achieve the purpose of early diagnosis and treatment.

[0045] 4. When conducting AMS observations on a large group, it is generally recommended to fill out the form and score within the first 2 to 3 hours after entering the plateau. In the first week, it is best to score twice a day, the first time one hour after waking up in the morning and the second time after work every day.

[0046] The final diagnosis is based on the comprehensive score: self-scoring + clinical scoring. AMS diagnosis: headache must be present, with a score of ≥ 3. AMS severity judgment: scores of 0-2 are absent; 3-4 are mild; ≥ 5 are severe.

[0047] Example 2

[0048] 1. Collection of biological samples

[0049] Within 48 hours of plateau exposure, buccal mucosal samples were collected from the subjects and placed in a DNA gene detection sampling tube. They were immediately placed in dry ice for temporary storage and frozen in a -80℃ refrigerator within 8 hours.

[0050] 2. DNA Extraction and Sequencing

[0051] (1) DNA sample testing

[0052] There are two main methods for testing DNA samples:

[0053] 1. Agarose gel electrophoresis was used to analyze the degree of DNA degradation and whether there was RNA or protein contamination.

[0054] 2. Qubit 3.0 accurately quantifies DNA concentration. DNA samples with a content of more than 0.5ug are used to build the library.

[0055] (2) Library construction and capture

[0056] Efficiently enrich the DNA of specific target regions of humans, and then perform high-throughput and high-depth sequencing on the Illumina platform. Basic experimental process:

[0057] The genomic DNA was randomly broken into fragments of 180-280 bp in length by Covaris fragmentation apparatus. After end repair and A-tailing, adapters were connected to both ends of the fragments to prepare DNA library.

[0058] After pooling, the library with specific index is hybridized with up to 500,000 biotin-labeled probes in liquid phase, and then the n exons of n genes are captured using magnetic beads with streptavidin. After PCR amplification, the library is quality-checked and sequencing can be performed if qualified.

[0059] (3) Inventory inspection

[0060] After the library construction is completed, Qubit 2.0 is used for preliminary quantification, and then NGS3K / Caliper is used to detect the insert size of the library. After the insert size meets expectations, the qPCR method is used to accurately quantify the effective concentration (3nM) of the library to ensure the quality of the library.

[0061] (4) Sequencing

[0062] If the library is qualified, the Illumina platform will be used for sequencing according to the effective concentration of the library and the data output requirements.

[0063] Example 3

[0064] 1. Analysis of Sequencing Results

[0065] After obtaining the original sequencing sequence (Sequenced Reads), in the case of a reference sequence or reference genome (GRCh38 / hg38), the information analysis process is carried out, including the following two parts:

[0066] (1) Sequencing data quality assessment

[0067] The main statistics are on sequencing error rate, data volume and comparison rate, to evaluate whether the library construction and sequencing have met the standards. If they meet the standards, subsequent analysis will be carried out, otherwise the library needs to be rebuilt or additional testing is required.

[0068] (2) Mutation Detection

[0069] Align high-quality sequences to the human reference genome and detect variation information in samples.

[0070] 2. Sequencing Statistics

[0071] The effective sequencing data were aligned to the reference genome (GRCh38) using BWA (Li H et al.) to obtain the initial alignment results in the BAM format.

[0072] Then, SAMtools (Li H et al.) was used to align and sort the results; GATK was used to mark duplicate reads.

[0073] Finally, the coverage, depth, etc. are counted using the alignment results after repeat marking.

[0074] Usually, the sequencing reads of human samples can achieve a matching rate of more than 95%; when the base coverage depth (read depth) of a site reaches more than 10X, the SNP detected at the site is more reliable.

[0075] 3. Comparison of results

[0076] Comparison of susceptibility genes for severe acute mountain sickness and mild (or no) acute mountain sickness after entering the plateau:

[0077] According to the AMS score, these cases were divided into two groups according to whether they had altitude sickness or not, namely:

[0078] There is acute mountain sickness group (class: H);

[0079] No acute mountain sickness group (class: NH).

[0080] Table 2 shows the basic information of the subjects, including age, percentage of males, weight, and height.

[0081] Table 2

[0082] Acute mountain sickness group Control group Number of samples 156 156 Age (years) 20.0(19.0；21.0) 20.0[19.0；21.0] Male proportion (%) 96.2 96.2 weight 65(60.0；70.0) 64.7(60.0；70.0) height 172(169；176) 171(169；175)

[0083] PLINK was used to implement an additive logistic regression model to test the association between AMS and healthy controls. The significance threshold for genome-wide association analysis was set at 1×10^(-4) and Info>0.4.

[0084] The Variant Effect Predictor (VEP) is accessible through the Ensembl genome browser to identify genes and regulatory regions affected by nucleotide sequence variations.

[0085] Figure 1 A Manhattan plot is drawn for GWAS analysis. The chromosome is the horizontal axis and the statistical significance (negative log-transformed P value) is the vertical axis. Each point in the plot represents a single nucleotide polymorphism (SNP) site or candidate gene region. The position of the point indicates the strength of association between the site and the studied phenotype. Above the threshold line are SNP sites with significant specificity.

[0086] Table 3 shows the significant SNP sites (rs79612768) and gene results of GWAS analysis.

[0087] Table 3

[0088]

[0089]

[0090] As shown in Table 3, rs79612768 is located at position 241759237 of human chromosome 2, and contains significant genes such as KIF1A, AGXT and MAB21L4.

[0091] Table 4 shows the results of SNP analysis in acute mountain sickness. The effect of carrying the relevant allele on acute mountain sickness was determined by calculating the odds ratio (OR) of the alleles.

[0092] Table 4

[0093] SNP OR SE P-value rs79612768 0.3512 0.2572 0.00004722

[0094] According to the data analysis results, the SNP site rs79612768 is closely related to the plateau adaptability of individuals. Therefore, the amplification primer pair, probe or other detection substances can be designed according to the rs79612768 site to detect the susceptibility of the population to altitude sickness.

[0095] Example 4

[0096] In this embodiment, a gene detection kit for detecting plateau adaptability is provided, and the gene detection kit comprises a primer pair and a probe for detecting the rs79612768 site.

[0097] The primer pair comprises a forward primer and a reverse primer;

[0098] The forward primer is CTCCAGGGAAGCGGAATAGCC (SEQ ID NO.1);

[0099] The reverse primer is CAGGTGCCGCTGGAAAAGGT (SEQ ID NO. 2).

[0100] The probes include wild-type probes and mutant-type probes;

[0101] The wild-type probe is GACCCCCGCCCGCCTAAGC (SEQ ID NO. 3);

[0102] The mutant probe is GACACCCGCCCGCCTAAGC (SEQ ID NO. 4).

[0103] Example 5

[0104] 1. PCR amplification reaction

[0105] Genotyping detection was performed using the primers and probes provided in Example 4 using real-time fluorescence PCR technology. The specific PCR reaction system is shown in Table 5.

[0106] In this embodiment, DNA extracted from the sample to be detected is used as a PCR template; an appropriate amount of PCR reaction solution is taken out, and the PCR reaction solution is mixed with an appropriate amount of the PCR template.

[0107] Table 5

[0108] Reagents Volume(uL) 10× PCR buffer 2.5 DNA (30ng / uL) 1 dNTP 2 Wild-type probe (10 nmol / mL) 0.5 Mutation probe (10nmol / mL) 0.5 Forward primer (10nmol / mL) 0.5 Reverse primer (10nmol / mL) 0.5 UNG enzyme (5U / uL) 0.25 Ultrapure water 17.25

[0109] 2. Genotyping

[0110] In this embodiment, the PCR amplification reaction was performed under the following conditions: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10 s; annealing at 60°C for 60 s; and 45 cycles to obtain the amplification result.

[0111] 3. Analyze and judge the amplification results

[0112] If the wild-type probe fluorescence has a logarithmic increase in fluorescence in the real-time fluorescence PCR reaction system of the sample, and the Ct value is ≤30.0, then there is no mutation at the site;

[0113] If in the real-time fluorescence PCR reaction system of the sample, the fluorescence of the mutant probe increases logarithmically and the Ct value is ≤30.0, then the site has mutated.

[0114] 4. Correlation Analysis

[0115] Before the association analysis, the samples and SNP levels were quality controlled. Finally, principal component analysis (PCA) of the population was performed to test the matching degree between the acute mountain sickness group and the control group. After quality control, this study finally included 156 cases in the acute mountain sickness group and 156 cases in the control group.

[0116] Table 6

[0117]

[0118] Table 6 shows the allele frequencies of SNPs in the case group and the control group. The calculation method is that the wild-type gene frequency is obtained by genotyping, and the mutant gene frequency is obtained by (1-wild-type gene frequency). The change is the difference between the wild-type and mutant gene frequencies of the two groups.

[0119] As can be seen from the results of Table 6, the frequency of the mutant gene of rs79612768 in the acute mountain sickness group is 11.40% higher than the frequency of the genotype in the control group, indicating that the risk genotype of rs79612768 is a mutant. The above experiment proves that rs79612768 can be used to detect the susceptibility to mountain sickness in the population to be tested. If the test result shows that the genotype of rs79612768 in the subject to be tested is a mutant, then the risk of mountain sickness in this person is high.

[0120] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention are within the protection scope and disclosure scope of the present invention.

Claims

1. A SNP locus associated with plateau adaptability, characterized in that: The SNP site is rs79612768.

2. A detection reagent for amplifying the SNP site as claimed in claim 1.

3. The detection reagent according to claim 2, characterized in that The detection reagents include primers and / or probes.

4. The detection reagent according to claim 3, characterized in that The primers include a forward primer and a reverse primer; The upstream primer comprises the nucleotide sequence shown in SEQ ID NO.1; The downstream primer comprises the nucleotide sequence shown in SEQ ID NO.

2.

5. The detection reagent according to claim 3, characterized in that The probes include wild-type probes and mutant-type probes; The wild-type probe comprises the nucleotide sequence shown in SEQ ID NO.3; The mutant probe comprises the nucleotide sequence shown in SEQ ID NO.

4.

6. A gene detection kit, characterized in that: The gene detection kit comprises a detection reagent for detecting the SNP site according to claim 1.

7. The gene detection kit according to claim 6, characterized in that: The test sample of the gene detection kit is the body fluid, skin, oropharyngeal swab or subcutaneous tissue of the subject.

8. At least one of the following uses of the substance for detecting the SNP site according to claim 1: (1) Use in the preparation of products for predicting the risk of acute mountain sickness; or (2) Application in the preparation and identification of products for altitude sickness or in assisting in the identification of products for altitude sickness; (3) Application in the preparation of products for detecting single nucleotide polymorphisms related to plateau adaptability.

9. The use according to claim 8, characterized in that The substances include primers and / or probes.

10. The use according to claim 8, characterized in that The substance also includes any one or a combination of at least two of the reagents, instruments, software or models for joint analysis of the SNP sites.

Images