A SNP molecular marker associated with protein content in longissimus dorsi muscle of Beijing black pigs and its application

Abstract

The present invention discloses a SNP molecular marker associated with the protein content of the longissimus dorsi muscle of Beijing black pigs and its application, belonging to the technical field of livestock molecular markers. The present invention uses the PLA2G4B gene as a candidate gene affecting the protein content trait of pig muscle (longissimus dorsi muscle), and based on this, develops a molecular marker associated with the protein content of the longissimus dorsi muscle of pigs. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. There is a T / C mutation at position 501 of the sequence. Experiments have found that the protein content of the longissimus dorsi muscle of pigs with the TT and TC genotypes of the mutation site is significantly higher than the protein content of the longissimus dorsi muscle of pigs with the CC genotype. The present invention provides a new molecular marker resource for the breeding of new pig varieties or the selection of high-protein pork.

Description

Technical Field

[0001] The present invention relates to the technical field of livestock molecular markers, in particular to a SNP molecular marker related to the protein content of the longissimus dorsi muscle of Beijing black pigs and an application thereof. Background Art

[0002] Chinese black pigs have a nearly 5,000-year history of domestication. With the rapid increase in demand for pork, fast-growing, economically profitable Western pig breeds, primarily Large White, Landrace, and Duroc, have flooded the Chinese market, gradually phasing out slow-moving, low-lean black pigs. In recent years, consumers have begun to value pork flavor, and the black pig farming market has begun to recover. However, most current black pigs are the result of multiple generations of crossbreeding, and the original Chinese black pig lineage has almost disappeared. The Beijing Black Pig, bred at Shuangqiao Farm and Beijiao Farm in Beijing, is a hybrid of local pigs from Tongxian, Dingxian, Pinggu, Zhuoxian, and Xinjin counties, Jilin Black pigs, Berkshire pigs, Yorkshire pigs, Soviet Large White pigs, and Caucasian pigs, combining the best characteristics of domestic and international pig breeds.

[0003] The Beijing Black pig is a meat-producing breed that combines the best characteristics of both domestic and international pig breeds. Its hybrid maternal line utilizes the Beijing Black pig's superior maternal qualities—its tolerance to rough conditions, resistance to stress, early maturity, easy conception, and good care of offspring—and its excellent internal quality. This is then crossed with foreign sire lines, such as the Duroc, Landrace, and Large White, which boast excellent carcass characteristics and large, fast growth. This results in high-quality meat with a high lean meat percentage. The hybrid sire line utilizes the Beijing Black pig as the sire, and is crossed with ancient Chinese, high-end, tender, juicy, and flavorful pork, characterized by excellent reproductive performance and thin, wrinkle-free skin, fine bones, and tender meat. The result is a uniquely flavorful pork.

[0004] With economic development and improved living standards, pork quality requirements are shifting from high lean meat percentage to edible qualities such as juiciness, color, flavor, tenderness, and water retention. Therefore, improving pork quality and meeting consumer demand for palatable, nutritious, and healthy pork has become a key factor influencing pork quality trait research and a research hotspot for pig breeding institutions and major breeding companies worldwide. Protein content in the longissimus dorsi muscle of pigs is a crucial trait, playing a key role in meat quality and growth performance. As one of the major muscle parts in pork, its protein content directly influences the taste, flavor, and nutritional value of the meat. A higher protein content improves meat quality, resulting in a more tender and juicy taste and enhanced nutritional value, thus meeting consumer demand for high-quality pork. Therefore, research and breeding for protein content in the longissimus dorsi muscle through molecular markers and genomic selection techniques can significantly improve overall pork quality.

[0005] PLA2G4B (phospholipase A2, group IVB) is a cytosolic phospholipase A2 enzyme that specifically recognizes and hydrolyzes the sn-2 acyl bond of glycerophospholipids, releasing free fatty acids and lysophospholipids. This hydrolysis has a wide range of impacts on cellular physiological processes. Within cells, it participates in the remodeling of cell membrane phospholipids, affecting membrane fluidity and permeability. Furthermore, the released fatty acids can serve as signaling molecules or participate in other metabolic pathways. For example, during inflammation, the arachidonic acid produced by this protein hydrolysis can be further metabolized into inflammatory mediators such as prostaglandins, which participate in immune regulation and inflammatory processes. In cells involved in fat metabolism, its phospholipid hydrolysis function also has the potential to influence the balance between triglyceride synthesis and catabolism. Currently, there are no reports linking PLA2G4B to protein content in the longissimus dorsi muscle of Beijing Black pigs. This study, based on this gene, has developed a molecular marker associated with protein content in the longissimus dorsi muscle of Beijing Black pigs, which can be applied in pig breed research and breeding, and has important implications for improving the overall quality of pork. Summary of the Invention

[0006] The purpose of the present invention is to provide a SNP molecular marker related to the protein content of the longissimus dorsi muscle of Beijing black pigs and its application to solve the problems existing in the above-mentioned prior art. The SNP molecular marker is located on the 17th exon of the PLA2G4B gene, and there is a T / C mutation at the 501st position of the nucleotide sequence shown in SEQ ID NO:1, and the mutation site is significantly correlated with the protein content of the longissimus dorsi muscle of Beijing black pigs.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a SNP molecular marker associated with the protein content of the longissimus dorsi muscle of pigs. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and a T / C mutation exists at position 501 of the sequence.

[0009] Optionally, the mutation site of the SNP molecular marker has TT, TC and CC genotypes.

[0010] Optionally, the pig comprises a Beijing black pig.

[0011] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0012] The invention also provides a kit for detecting the protein content of the longissimus dorsi muscle of pigs, comprising the primer pair.

[0013] The present invention also provides the use of the SNP molecular marker, the primer pair, or the kit in any of the following:

[0014] (1) Application in detecting protein content of pig longissimus dorsi muscle;

[0015] (2) Application in breeding pig breeds related to traits related to protein content of the longissimus dorsi muscle;

[0016] (3) Application in screening pork with high protein content.

[0017] The present invention also provides a method for detecting the protein content of pig longissimus dorsi muscle, comprising the following steps:

[0018] The SNP molecular marker is amplified using a primer pair, and the porcine longissimus flexus protein content is determined according to the genotype of the SNP site of the amplified product; wherein the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0019] Optionally, the judgment criterion is: the protein content of the longissimus dorsi muscle of pig individuals with TT and TC genotypes at the SNP site is higher than that of the longissimus dorsi muscle of pig individuals with CC genotype.

[0020] The present invention also provides a method for breeding high-protein pork, comprising: using a primer pair to amplify the SNP molecular marker, retaining pork with mutation sites of the SNP molecular marker as TT and TC genotypes; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0021] The present invention also provides a method for breeding pig breeds related to the protein content trait of the longissimus dorsi muscle of pigs, comprising: using a primer pair to amplify the SNP molecular marker, and retaining pig individuals with TT and TC genotypes at the mutation sites of the SNP molecular marker; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0022] The present invention discloses the following technical effects:

[0023] The present invention screened and obtained a molecular marker associated with the protein content trait of the longissimus dorsi muscle of pigs. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. A T / C mutation exists at position 501 of the sequence. Experimental verification found that the TC genotype individuals and the TT genotype individuals at the mutation site were significantly higher than those of the CC genotype individuals. The TC genotype and the TT genotype are favorable genotypes for the protein content of the longissimus dorsi muscle of pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 The results of the genome-wide association analysis of the present invention;

[0026] Figure 2 The amplified bands are obtained by polymerase chain reaction using primers of the present invention; M: DL2000 DNA Marker, 1-3: bands of the sample amplified using specific primers, with a size of 172 bp;

[0027] Figure 3 The sequencing results of the amplified bands of the present invention are shown; the blue mark of sequence 1 is a single peak, indicating the wild type TT, and the blue mark of sequence 2 is a double peak, indicating the heterozygous TC;

[0028] Figure 4 The results of variance analysis of the protein content of the longissimus dorsi muscle of different genotypes of the molecular markers of the present invention are shown. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1 Genetic marker mining for protein content of pig longissimus dorsi muscle

[0035] Phenotypic data were obtained from 1509 Beijing Black pigs for the protein content of the longissimus dorsi muscle and carcass weight. Outliers for the longissimus dorsi muscle protein content and carcass weight phenotypic traits were eliminated using the interquartile range test. Genotyping of Beijing Black pigs was performed using the Zhongxin No. 1 PLUS Pig 50K SNP chip. The chip data were then populated to the whole genome level using the 1kcigp filling panel using Shapeit5 and Minimac4 software. Quality control was then performed using PLINK software, with the following quality control criteria:

[0036] ① Individual genotype frequency>0.95;

[0037] ②SNP call rate>0.95;

[0038] ③Minimum allele frequency (MAF)>0.05;

[0039] ④ Hardy-Weinberg equilibrium test P value>10 -6 ; The SNP site information obtained after quality control is used for subsequent genome-wide association analysis.

[0040] Genome-wide association analysis was performed using GEMMA software based on a linear mixed model. The linear mixed model was expressed as:

[0041] y=Xα+Yβ+Zγ+e;

[0042] y is the meat quality phenotypic vector; α is the SNP marker effect vector, X is the association matrix corresponding to α, coded as 0, 1, 2; β is the non-genetic fixed effect vector, including population mean, sex, and carcass weight, and Y is the association matrix corresponding to β; γ is the residual polygenic effect vector, which follows a normal distribution G is the genomic kinship matrix, is the additive genetic variance, Z is the correlation matrix corresponding to γ; e is the residual vector, obeying I is the identity matrix, are random residuals.

[0043] The significance test was performed using the Wald test with a 10 -6 As the threshold for potential genome-wide significance, the Manhattan results obtained are as follows Figure 1 The results showed that the newly discovered SNP at position 129516749 of exon 17 on chromosome 1 (located in the PLA2G4B gene) may be a regulatory site for the protein content of the longissimus dorsi muscle of pigs.

[0044] Based on large-scale Beijing Black pig gene chip data and protein content phenotypic data in the longissimus dorsi muscle of pigs, the present invention fills the 50K genome chip data to the sequencing level, and uses a linear mixed model to perform genome-wide association analysis. A new SNP is discovered in the PLA2G4B gene, which is significantly associated with protein content in the longissimus dorsi muscle of pigs. By blasting the upstream and downstream sequences of the SNP on the NCBI website, the nucleotide polymorphism site (SNP site) is found in the amplified fragment. The SNP site is at the 501st base of the sequence described in SEQ ID NO: 1. The mutation site is named c.501T>C, and the sequence is shown below:

[0045] CGAGCTCTTTGGCTCTCAGTTCTTCATGGGGCGCCTGACAAAGCAGCTTCCTGAGTCCCGCATCTGCTTCCTGGAAGGTGAGGGTGACTGGTAGGTGGGACAATGGGACCCAGGGAGATGGTGAGCCCAGAG GTCCCAGCTCAGTCACTGGGATGTTCCCTGGTCCCCACTGGGCTGAGGGGAAAGGTCAGACTGTTCCTCCCATGTCTTCTCCTCAGGTATCTGGAGCAACCTGTACACAGCCAACCTCCAGGACAGCTTGTA TTGGTCTCCGAGCCCAGCCAGTTTTGGGACCGCTGGGCACAGGATCAGATCAGCCTGGGTAGGTTGGGATGTATTGGGGAGCTTCGGGGTAGCCCTCAGGCCTTCATGAGTCCACAGAGGCCAGAATAAAG GTCCAAGGGTCCCCGTGTCTCCTCTTCTTGATTGCAGACAAGGACCAGGTCCCCCTTCTGAAGGTAGAAGAGCCTCCCACAGTGGCCGGCAGGATAGCTGAGTTR(T / C)TTCACTGACCTTCTGACATGGC GTCCACTTGCCCAGACCACCCACAATTTCCTACGTGGCCTCTCTTTCCACAAGGACTACTACCAGCATCCTCACTTCTCTGCCTGGAAAGGTATCTGCTTTTCTCCCCCTGGTCCAGCTCTCGAAAGTCTTTCCATGGCCGTCCTGGGGTCCCTGGTCCAGACACGCACACTCTCTAGCCCCTTGGCGCCAT.

[0046] Example 2 Application of PLA2G4B Molecular Marker

[0047] 1. DNA extraction

[0048] The present invention uses Beijing black pigs as experimental materials, and extracts DNA from pig ear tissue using a whole genome DNA kit, and the steps are as follows:

[0049] (1) Add a certain amount of anhydrous ethanol to buffer GD and rinse solution PW according to the instructions.

[0050] (2) Material processing: Cut 30 mg of ear / muscle tissue into a 1.5 mL centrifuge tube and mince and grind as much as possible.

[0051] (3) Add 200 μL of buffer GA and vortex until thoroughly suspended.

[0052] (4) Add 20 μL of proteinase K and mix well, then place in a molecular hybridization oven at 56°C for overnight digestion.

[0053] (5) Add 200 μL of buffer GB to the digested tissue solution, mix thoroughly by inversion, and place in a water bath at 70°C for about 10 min. Wait for the tissue solution to clarify and then centrifuge for 10 s.

[0054] (6) Add 200 μL of anhydrous ethanol, shake for 15 seconds, and centrifuge for 10 seconds.

[0055] (7) Add the liquid and precipitate obtained in step (6) to the adsorption column a-collection tube A, centrifuge (12000 rpm, 30 s) and discard the waste liquid.

[0056] (8) Add 500 μL of buffer GD to the adsorption column a-collection tube A (12000 rpm, 30 s) and discard the waste liquid from the centrifugation.

[0057] (9) Add 600 μL PW to the adsorption column a-collection tube A, centrifuge (12000 rpm, 30 s), and discard the waste liquid.

[0058] (10) Repeat the previous step and rinse again, then centrifuge (12000 rpm, 30 s). After centrifugation, open the lid and let it stand to dry the alcohol-containing rinse solution.

[0059] (11) Assemble adsorption column a-collection tube B, elute the DNA on the adsorption column membrane with a certain amount of TE solution, let it stand for 5 minutes, and then centrifuge (12000 rpm, 30 seconds).

[0060] Use a nucleic acid quality detector to test, use elution buffer TE (the reagent for dissolving DNA at the end of genome extraction) as a blank control, and start testing the sample when the concentration is ±0.2ng / μL. Each time, take 2μL of DNA sample for measurement. After each sample is measured, use TE buffer solution to wash and wipe the optical surface with lens paper. The software will automatically calculate the concentration, purity and spectral image of the DNA for evaluation. According to the A given by the software 260 and A 280 The OD value at the place is used for judgment. If the measured A 260 / A 280 Between 1.8 and 2.2, it meets the purity requirements of DNA. 260 / A 230 The DNA extracted between 1.5 and 2.2 has less ionic contamination, otherwise it needs to be re-extracted.

[0061] 2. DNA amplification

[0062] The conventional primers used in the present invention were designed based on the S. scrofa 11.1 version as the reference genome and the porcine PLA2G4B gene sequence published in the NCBI database. The sequence of the primer pair is shown below:

[0063] F Primer (SEQ ID NO: 2): 5'-CACTGGGATGTTCCCTGGTC-3';

[0064] R Primer (SEQ ID NO: 3): 5'-ACGCCATGTCAGAAGGTCAG-3'.

[0065] Before use, the synthesized primer powder should be centrifuged at 4500 rpm for 1 minute. Then, the primers should be dissolved and diluted in ddH2O at 10 times the OD value indicated on the primers. Vortex to mix thoroughly and store at 4°C. PCR amplification (reaction system and conditions are shown in Tables 1 and 2), PCR product purification, cloning, sequencing, and sequence analysis should be performed using this primer pair.

[0066] Table 1 PCR reaction system

[0067]

[0068] Table 2 PCR reaction conditions

[0069]

[0070]

[0071] The electrophoresis results of PCR amplification products were as follows Figure 2 The obtained PCR products were purified and cloned and then sequenced, as shown in Figure 3 As shown in FIG. 5 , blast comparison analysis revealed that the SNP mutation (base substitution) existed in the amplified product, ie, the sequence, and that the mutation caused the polymorphism of the PLA2G4B gene.

[0072] 3. Perform variance analysis on the protein content of the longissimus dorsi muscle of different genotypes of this molecular marker

[0073] The results of variance analysis are as follows Figure 4 As shown, the results showed that the TC genotype individuals and TT genotype individuals at the molecular marker SNP site were significantly higher than the CC genotype individuals, and the TC genotype and TT genotype were favorable genotypes for the protein content of the longissimus dorsi muscle of pigs.

[0074] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of SNP molecular markers in any of the following: (1) Application in detecting protein content of longissimus dorsi muscle of Beijing black pig; (2) Application in breeding Beijing black pigs with high longissimus dorsi muscle protein content; (3) Application in screening Beijing black pork with high longissimus dorsi protein content; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and there is a T / C mutation at position 501 of the sequence.

2. A method for detecting the protein content of the longissimus dorsi muscle of Beijing black pigs, characterized in that: The following steps are involved: A primer pair is used to amplify a SNP molecular marker, and the protein content of the longissimus dorsi muscle of Beijing black pigs is determined according to the genotype of the SNP site in the amplified product; wherein the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and there is a T / C mutation at position 501 of the sequence; the mutation site of the SNP molecular marker has TT, TC and CC genotypes; The judgment standard is: the protein content of the longissimus dorsi muscle of Beijing Black pig individuals with TT and TC genotypes at the SNP site is higher than the protein content of the longissimus dorsi muscle of Beijing Black pig individuals with CC genotype.

3. A method for screening Beijing black pork with high longissimus dorsi protein content, characterized in that: include: A primer pair is used to amplify a SNP molecular marker, and the mutation site of the SNP molecular marker is retained in Beijing black pork of TT and TC genotypes; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and there is a T / C mutation at position 501 of the sequence.

4. A method for breeding Beijing black pigs with high longissimus dorsi muscle protein content, characterized in that: include: A primer pair is used to amplify a SNP molecular marker, and the mutation site of the SNP molecular marker is retained in Beijing black pig individuals with TT and TC genotypes; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and there is a T / C mutation at position 501 of the sequence.

Images