Application of substances for detecting SNP polymorphism in identification or auxiliary identification of ginseng

Abstract

The present invention discloses the application of a substance for detecting SNP polymorphism in identifying or assisting in identifying ginseng, and belongs to the field of nucleic acid determination or inspection methods in biochemistry. The technical problem to be solved by the present invention is how to identify and / or quantitatively detect ginseng. In the application of the substance for detecting SNP polymorphism provided by the present invention in identifying or assisting in identifying ginseng, the SNP includes SNP1, which is a SNP in the chloroplast genome of a species of the genus Panax, which is the 71st nucleotide of SEQ ID No.1 in the sequence list, and the nucleotide is G or C. In the above application, the SNP may also include SNP2, which is a SNP in the chloroplast genome of a species of the genus Panax, which is the 164th nucleotide of SEQ ID No.5 in the sequence list, and the nucleotide is C or T. The present invention can accurately distinguish ginseng from the common adulterated species American ginseng, and can be used for the identification and quantification of ginseng.

Description

Technical Field

[0001] The invention belongs to the field of nucleic acid determination or testing methods in biochemistry, and specifically relates to the application of a substance for detecting SNP polymorphism in identifying or assisting in identifying ginseng. Background Art

[0002] Ginseng is a perennial herbaceous plant of the Araliaceae family. Panax ginseng The dried roots and rhizomes of Panax notoginseng have the effects of greatly replenishing vital energy, restoring pulse and strengthening deficiency, tonifying spleen and lung, promoting body fluid and nourishing blood, calming the mind and improving intelligence. They are used to treat symptoms such as physical weakness, cold limbs and weak pulse, spleen deficiency and poor appetite, and lung deficiency and cough. The morphology and chemical composition of closely related species of the genus Panax notoginseng are similar, and the types of products on the market are diverse, and adulteration and mixing occur from time to time. Adulteration not only damages the trading order of the Chinese herbal medicine market, but also affects the efficacy and safety of Chinese medicine. Therefore, developing an effective method for identifying ginseng varieties is an important means to combat adulteration and fraud.

[0003] The roots of closely related species of the genus Panax are similar in appearance, and most commercially available products are crushed and processed, making them difficult to distinguish by traditional morphological and microscopic methods. Many analytical methods have contributed to the identification and quality control of ginseng. For example, studies have found that the quality markers of ginseng, American ginseng, and Panax notoginseng are the ratio characteristics of their unique components ginsenoside Rf, pseudoginsenoside F11, and Panax notoginseng saponin R1, and the common components ginsenoside Rg1, Re, and Rb1. Ultra-high performance liquid chromatography and ultra-high performance liquid chromatography-tandem mass spectrometry were used to establish the content determination methods of quality markers in traditional Chinese medicines containing ginseng, American ginseng, and Panax notoginseng, respectively. However, because samples of closely related plants contain similar bioactive ingredients, and the chemical composition of plants varies significantly due to growth environment or processing conditions, methods that rely on target species-specific markers or the ratio characteristics of common components are difficult to distinguish closely related species in complex mixed samples. Molecular identification technology represented by DNA barcoding has become a powerful tool for species identification. Based on sequences such as ITS2 and psbA-trnH, ginseng and its adulterated species can be quickly identified, but quantification cannot be achieved.

[0004] As the latest generation of genetic molecular markers, single nucleotide polymorphisms (SNPs) have been widely used in the identification of closely related species. The detection of SNP sites based on pyrophosphate sequencing has been successfully applied to the identification and quantification of Pinellia ternata, Fritillaria cirrhosa, and closely related adulterants in mixed samples. Therefore, by developing species-specific SNP sites and specific primer combinations, pyrophosphate sequencing can be used to identify ginseng and its congener adulterant species American ginseng in mixed samples, and adulteration quantification can be achieved by combining the allele fluorescence signal ratio. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to identify and / or quantitatively detect ginseng.

[0006] In order to solve the above technical problems, the present invention first provides an application of a substance for detecting SNP polymorphism in identifying or assisting in identifying ginseng, wherein the SNP includes SNP1, which is a SNP in the chloroplast genome of a Panax species, and is the 71st nucleotide of SEQ ID No.1 in the sequence list, and its nucleotide is G or C, and the letter S in SEQ ID No.1 represents any one of the nucleotides G and C.

[0007] In the above application, the detection of SNP polymorphism can determine the type of nucleotides of SNP in the genome of the sample to be tested by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0008] In the above application, the substance comprises a substance for detecting SNP1 polymorphism; the substance for detecting SNP1 polymorphism may be the following D1), D2) or D3):

[0009] D1) containing a PCR primer pair for amplifying a genomic DNA fragment including the SNP1 site;

[0010] D2) a PCR reagent containing the PCR primer pair described in D1);

[0011] D3) A kit containing the PCR primer pair described in D1) or the PCR reagent described in D2).

[0012] In the above application, the PCR primer pair for amplifying the genomic DNA fragment including the SNP1 site can be a primer pair consisting of PGF1 and PGR1:

[0013] The PGF1 is a single-stranded DNA shown in SEQ ID No. 2 in the sequence list;

[0014] The PGR1 is a single-stranded DNA shown as SEQ ID No. 3 in the sequence table.

[0015] In the above applications, the PCR primers may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include but are not limited to dyes; radioactive labels such as32 P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, mass determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., directly reading the sequence).

[0016] In the above application, the 5' end of the PGR1 may be labeled with biotin.

[0017] In the above application, the substance for detecting SNP1 polymorphism may further include a primer PGS1 for pyrophosphate sequencing, and the PGS1 is a single-stranded DNA shown in SEQ ID No. 4 in the sequence table.

[0018] In the above application, the SNP may further include SNP2, which is a SNP in the chloroplast genome of a Panax species, and is the 164th nucleotide of SEQ ID No.5 in the sequence list, and its nucleotide is C or T. The letter Y in SEQ ID No.5 represents any nucleotide of C and T.

[0019] In the above application, the substance may further include a substance for detecting SNP2 polymorphism; the substance for detecting SNP2 polymorphism is the following E1), E2) or E3):

[0020] E1) containing a PCR primer pair for amplifying a genomic DNA fragment including the SNP2 site;

[0021] E2) a PCR reagent containing the PCR primer pair described in E1);

[0022] E3) A kit containing the PCR primer pair described in E1) or the PCR reagent described in E2).

[0023] In the above application, the PCR primer pair for amplifying the genomic DNA fragment including the SNP2 site can be a primer pair consisting of PGF2 and PGR2:

[0024] The PGF2 is a single-stranded DNA shown in SEQ ID No.6 in the sequence list;

[0025] The PGR2 is a single-stranded DNA shown as SEQ ID No. 7 in the sequence table.

[0026] In the above application, the 5' end of the PGR1 may be labeled with biotin.

[0027] In the above application, the substance for detecting SNP2 polymorphism may further include a primer PGS2 for pyrophosphate sequencing, and the PGS2 is a single-stranded DNA shown in SEQ ID No. 8 in the sequence table.

[0028] The present invention also provides a product, which contains the above-mentioned substance for detecting SNP polymorphism, and is used for identifying or assisting in identifying a sample claimed to be ginseng or a sample claimed to contain ginseng.

[0029] The present invention also provides a method for identifying or assisting in identifying ginseng using SNP, the method comprising the steps of detecting the polymorphism of SNP1 in a sample to be tested, and determining the ginseng content in the sample to be tested;

[0030] The SNPs include SNP1, which is a SNP in the chloroplast genome of a Panax species, and is the 71st nucleotide of SEQ ID No. 1 in the sequence list, and the nucleotide is G or C;

[0031] The judgment criteria are: when the nucleotide of SNP1 is only G, the sample to be tested is ginseng; when the nucleotide of SNP1 is only C, there is no ginseng in the sample to be tested, but there are other species of Panax not ginseng; when the nucleotide of SNP1 has both G and C, there is both ginseng and other species of Panax not ginseng in the sample to be tested.

[0032] In the above method, the detection of the polymorphism of SNP1 in the sample to be tested can be performed by using the genomic DNA of the sample to be tested as a template, performing PCR amplification with a primer pair consisting of the single-stranded DNA shown in SEQ ID No.2 in the sequence list and the single-stranded DNA shown in SEQ ID No.3 in the sequence list, and then performing pyrophosphate sequencing using the single-stranded DNA shown in SEQ ID No.4 in the sequence list as a primer; the 5' end of the single-stranded DNA shown in SEQ ID No.3 in the sequence list is labeled with biotin.

[0033] In the above method, for the test sample whose nucleotide of SNP1 contains C ((the nucleotide of SNP1 is only C, or the nucleotide of SNP1 has both G and C)), the method may also include the steps of detecting the polymorphism of SNP2 in the test sample and determining the content of American ginseng in the test sample;

[0034] The SNP2 is a SNP in the chloroplast genome of a Panax species, which is the 164th nucleotide of SEQ ID No. 5 in the sequence list, and the nucleotide is C or T;

[0035] The judgment criteria are: when the nucleotide of SNP2 is only C, the sample to be tested is American ginseng; when the nucleotide of SNP2 is only T, there is no American ginseng in the sample to be tested, but there are other species of Panax ginseng other than American ginseng; when the nucleotide of SNP2 has both C and T, there is both American ginseng and other species of Panax ginseng other than American ginseng in the sample to be tested.

[0036] In the above method, the detection of the polymorphism of SNP2 in the sample to be tested is performed by using the genomic DNA of the sample to be tested as a template, performing PCR amplification with a primer pair consisting of the single-stranded DNA shown in SEQ ID No.6 in the sequence list and the single-stranded DNA shown in SEQ ID No.7 in the sequence list, and then performing pyrophosphate sequencing with the single-stranded DNA shown in SEQ ID No.8 in the sequence list as a primer; the 5' end of the single-stranded DNA shown in SEQ ID No.7 in the sequence list is labeled with biotin.

[0037] The present invention also provides a method for quantifying ginseng in a sample to be tested, comprising the following steps: using the genomic DNA of the sample to be tested as a template, performing PCR amplification using a primer pair consisting of a single-stranded DNA shown in SEQ ID No.2 in the sequence list and a single-stranded DNA shown in SEQ ID No.3 in the sequence list, and then performing pyrophosphate sequencing using the single-stranded DNA shown in SEQ ID No.4 in the sequence list as a primer, detecting the base G fluorescence signal ratio of SNP1, and obtaining the mass percentage of ginseng in the sample to be tested; the 5' end of the single-stranded DNA shown in SEQ ID No.3 in the sequence list is labeled with biotin.

[0038] In the present invention, the sample to be tested may specifically be a sample claimed to be ginseng or a sample claimed to contain ginseng.

[0039] The specific SNP molecular markers of ginseng and its common adulterant species American ginseng obtained by screening in the chloroplast genome sequence provided by the present invention have the characteristics of high specificity and strong specificity, and can accurately distinguish ginseng from American ginseng with similar morphology, and can be used to identify ginseng and its closely related species in mixed samples. Combining pyrophosphate sequencing technology to detect the two SNP markers screened in the present invention, ginseng and its common adulterant species American ginseng can be simultaneously identified and quantified. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the pyrophosphate sequencing result of the amplified product of the ginseng medicinal material in Example 2 at SNP1.

[0041] Figure 2 The results of screening two specific SNP sites in Example 3 and the pyrophosphate sequencing results of three samples to be tested at different sites; wherein, Figure 2A is a specific SNP site of ginseng. Figure 2 B is the pyrosequencing result of the mixed sample at SNP1; Figure 2 C is a specific SNP site of American ginseng. Figure 2 D is the pyrosequencing result of the mixed sample at SNP2.

[0042] Figure 3 It is the base G fluorescence signal ratio and base C fluorescence signal ratio of SNP1 in the 7 mixed samples of quantifying the degree of adulteration in the ginseng mixed sample in Example 4.

[0043] Figure 4 It is a linear regression equation established based on the results of the determination of the base G fluorescence signal ratio and base C fluorescence signal ratio of the 7 mixed samples SNP1 in Example 4. Three replicates are set for each mixed sample. In the figure, 1 is the data of replicate 1 of each mixed sample, 2 is the data of replicate 2 of each mixed sample, and 3 is the data of replicate 3 of each mixed sample. The average is the average of replicate 1, replicate 2, and replicate 3 of each mixed sample.

[0044] Figure 5 This is the result of verifying the accuracy and repeatability of the method for measuring the degree of adulteration in the mixed ginseng samples of the present invention by mixing samples in different proportions in Example 4. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0046] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0047] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0048] Example 1. Screening of SNP sites for identifying Panax species

[0049] A total of 106 chloroplast genome (CP) sequences of all species in the genus Panax were downloaded from the GenBank database of NCBI (https: / / www.ncbi.nlm.nih.gov / ). Using the ginseng sequence as a reference, CodonCode software was used to perform multiple sequence alignment to screen single nucleotide polymorphism sites (SNPs), and the BLAST tool in NCBI was used to determine the specificity of candidate SNPs.

[0050] Two SNPs were screened out, which can distinguish ginseng from American ginseng, which is easily mixed with ginseng, and can also distinguish ginseng and American ginseng from other species of the genus Panax to which they belong, and are numbered SNP1 and SNP2 respectively. The specific positions and primer information are shown in Table 1:

[0051]

[0052] Note: Biotin in the table means that the 5' end of the sequence is labeled with biotin.

[0053] SNP1 is a ginseng-specific SNP site, a SNP in the chloroplast genome of Panax species, and is the 29964th nucleotide of the NC_006290.1 ​​CP sequence. Its nucleotide is G or C, represented by the letter S, corresponding to the 71st position of SEQID No.1 in the sequence list (SEQ ID No.1 is the nucleotide sequence of the PCR product amplified using PGF1 (SEQ ID No.2) and PGR1 (SEQ ID No.3) as primers). The nucleotide of SNP1 in Panax ginseng is G, and the nucleotide of SNP1 in other Panax species other than ginseng is C.

[0054] SEQ ID No.1

[0055] TCGGTCAGAATCCCTTTTTGACTCTGCACCGTTGATTCCACTATTATTAATGAGCAATAATGGAATAATTSCTTCATAGAGATAGGGGACATAATTCACATGGATATAGTAAGTCTTGCTTGGGCTGCTTTAATGGTAGTCTTTACATTTTCCCTTTCACTCG

[0056] When the Panax genus sample to be tested is subjected to PCR amplification using PGF1 and PGR1 as primers, and pyrophosphate sequencing using PGS1 as primer, judgment is made according to the following standards: when the sequencing result shows that SNP1 is only base G, it can be determined that only ginseng is present in the test sample; when it is only base C, it can be determined that there is no ginseng component in the test sample, and all of the samples are other species of the genus Panax ginseng; when there are both base G and base C, it can be determined that both ginseng and other species of the genus Panax ginseng are present in the test sample.

[0057] SNP2 is a specific SNP site for American ginseng. It is a SNP in the chloroplast genome of Panax ginseng species. It is the 79770th nucleotide in the NC_027456.1 CP sequence. Its nucleotide is C or T, represented by the letter Y, corresponding to the 164th position of SEQID No.5 in the sequence table (SEQ ID No.5 is the nucleotide sequence of the PCR product amplified using PGF2 (SEQ ID No.6) and PGR2 (SEQ ID No.7) as primers). The nucleotide of SNP2 in American ginseng is C, and the nucleotide of SNP2 in other Panax ginseng species other than American ginseng is T.

[0058] SEQ ID No.5

[0059] GTTCTTTTTGATTGGTACCGCAGTGGCCCTTTGGTTAGGTATTGGTGCAACATTACCTATTGATAAATCCCTAACTTTAGGTCTTTTTTAATTTTAAAATTTATTGAATTGTGAAATAAAATATCACGACGTGTGTATCTAGGGAATAGTCGCTTCAACCAAAGYGAATTCTCCCTAGATACATCTATTCAATTTAATTCGGGAATCTATCCCGATTCCGAATATATGG

[0060] When the Panax genus sample to be tested is subjected to PCR amplification using PGF2 and PGR2 as primers, and pyrophosphate sequencing using PGS2 as primer, judgment is made according to the following standards: when the sequencing result shows that SNP2 is only base C, it can be determined that only American ginseng is present in the test sample; when it is only base T, it can be determined that American ginseng is not present in the test sample, and only other species of Panax genus other than American ginseng are present; when there are both base C and base T, it can be determined that both American ginseng and other species of Panax genus other than American ginseng are present in the test sample.

[0061] Example 2. Identification of ginseng medicinal materials based on SNP site variation

[0062] The method for rapid identification of ginseng medicinal materials in this embodiment specifically comprises the following steps:

[0063] (1) A total of 21 samples of ginseng were collected from Beijing, Baishan, Jilin, Weihai, Shandong, Bozhou, Anhui, Yulin, Guangxi, Anguo, Hebei, and Chengdu, Sichuan. The samples were sliced, dried, crushed, and passed through a 100-mesh sieve. The powder was sealed in a ziplock bag for later use.

[0064] (2) 200 mg of each of the 21 medicinal material powder samples was taken and genomic DNA was extracted using the modified CTAB method to obtain genomic DNA of 21 samples to be tested.

[0065] (3) Using the genomic DNA of each sample as a template, firstly, a primer pair consisting of a forward primer PGF1 and a reverse primer PGR1 was used for PCR amplification to obtain amplification products of 21 samples respectively, and to detect whether there was ginseng adulteration in the sample;

[0066] The total volume of the PCR system (25 μL) included 12.5 μL 2×Taq Master Mix, 1 μL each of forward and reverse primers (2.5 μmol / L), 2 μL DNA template, and 8.5 μL deionized water.

[0067] Reaction procedure: pre-denaturation (94°C, 4 min), denaturation (94°C, 30 s)-annealing (55.5°C, 1 min)-extension (72°C, 1 min) 35 cycles, extension (72°C, 10 min).

[0068] (4) Using PGS1 as a primer, the amplified products of the 21 samples obtained above were subjected to pyrophosphate sequencing to detect the polymorphism of SNP1.

[0069] (5) The pyrophosphate sequencing results of the amplified products of 21 samples at SNP1 are as follows Figure 1 As shown, there are only base Gs in all 21 samples. It can be determined that only ginseng exists in all 21 samples, that is, all 21 collected samples are ginseng medicinal materials.

[0070] Example 3. Identification of ginseng and its common adulterated species American ginseng in mixed medicinal powder

[0071] This embodiment proposes a method for quickly identifying ginseng and its common adulterated species American ginseng in mixed powder, which specifically includes the following steps:

[0072] (1) Collect 3 kinds of authentic ginseng and American ginseng, slice them, dry them, grind them, pass them through a 100-mesh sieve, put the powders into ziplock bags and seal them for later use, to obtain ginseng powder 1, ginseng powder 2, ginseng powder 3 and American ginseng powder 1, American ginseng powder 2, and American ginseng powder 3.

[0073] (2) Take 100 mg of ginseng powder sample and 100 mg of western medicine powder sample respectively, and mix them into a mixed powder sample with a total mass of 200 mg. The specific mixed sample information is shown in Table 2:

[0074]

[0075] (3) Take the three kinds of uniformly mixed test sample powders in Table 2 respectively, and use the improved CTAB method to extract genomic DNA respectively to obtain the three kinds of test sample genomic DNA.

[0076] (4) Using the genomic DNA of the three samples to be tested as templates, firstly, the fragment where the ginseng-specific SNP site SNP1 is located ( Figure 2 A), PCR amplification was performed using primers PGF1 and PGR1 to obtain amplification product 1.

[0077] The total volume of the PCR system (25 μL) included 12.5 μL 2×Taq Master Mix, 1 μL each of forward and reverse primers (2.5 μmol / L), 2 μL DNA template, and 8.5 μL deionized water.

[0078] Reaction procedure: pre-denaturation (94°C, 4 min), denaturation (94°C, 30 s) - annealing (56°C, 1 min) - extension (72°C, 1 min) 35 cycles, extension (72°C, 10 min).

[0079] (5) Pyrophosphate sequencing of amplified product 1 was performed using PGS1 as primer to detect the polymorphism of SNP1.

[0080] The pyrophosphate sequencing results of the amplified product 1 of the three samples to be tested at SNP1 all showed both base G and base C ( Figure 2 B), it can be determined that both ginseng and other species of the genus Panax other than ginseng are present in the three samples to be tested.

[0081] (6) Furthermore, the genomic DNA of the three samples to be tested were used as templates to detect the fragment where the specific SNP site SNP2 of American ginseng was located ( Figure 2 C), PCR amplification was performed using primers PGF2 and PGR2 to obtain amplification product 2.

[0082] The PCR amplification reaction system and reaction procedure are the same as step (4).

[0083] (7) Pyrophosphate sequencing of amplified product 2 was performed using PGS2 as primer to detect the polymorphism of SNP2.

[0084] The pyrophosphate sequencing results of the amplified product 2 of the three samples to be tested at SNP2 all showed both base C and base T ( Figure 2 D), it can be determined that both American ginseng and other species of Panax ginseng are present in the three samples to be tested.

[0085] It can be seen that the specific SNP sites of the three mixed samples were identified by pyrophosphate sequencer, and the results were consistent with the actual results, which proved the effectiveness and accuracy of the method of the present invention.

[0086] Example 4 Method for quantifying the degree of adulteration in mixed ginseng samples and its validation

[0087] 1. Method for quantifying the degree of adulteration in mixed ginseng samples

[0088] The method used in this embodiment to quantify the degree of adulteration in the mixed ginseng sample is as follows:

[0089] (1) Genuine ginseng (PG) and American ginseng (PQ) were used to extract genomic DNA using the modified CTAB method.

[0090] (2) Mixed samples were prepared by adding 0%, 10%, 30%, 50%, 70%, 90% and 100% of American ginseng to ginseng, respectively, and the total amount of DNA in the mixed sample was 100 ng. The following 7 mixed samples were obtained (mass percentage):

[0091] Mixed sample 1: 100% ginseng, 0% American ginseng.

[0092] Mixed sample 2: 90% ginseng, 10% American ginseng.

[0093] Mixed sample 3: 70% ginseng, 30% American ginseng.

[0094] Mixed sample 4: 50% ginseng, 50% American ginseng.

[0095] Mixed sample 5: 30% ginseng, 70% American ginseng.

[0096] Mixed sample 6: 10% ginseng, 90% American ginseng.

[0097] Mixed sample 7: 0% ginseng, 100% American ginseng.

[0098] Each mixed sample was set up with 3 replicates.

[0099] The linear relationship between adulteration amount and allele frequency was explored based on 7 mixed samples, and the dynamic range was determined.

[0100] (3) Using the mixed sample genomic DNA as a template, PCR amplification was performed using amplification primers PGF1 and PGR1 to obtain amplification product 1. The PCR amplification reaction system and reaction procedure were the same as step (4) of Example 3.

[0101] (4) Perform pyrophosphate sequencing on amplified product 1 using sequencing primer PGS1 to detect the fluorescence signal ratio of base G and base C of SNP1.

[0102] Among the fluorescence signal ratios of SNP1 of the 7 amplified products, the fluorescence signal ratio of base G is basically consistent with the ratio of ginseng in the corresponding mixed sample; there are only ginseng and American ginseng in the mixed sample, so the signal of base C can represent the result of American ginseng quantification, and the fluorescence signal ratio of base C is basically consistent with the ratio of American ginseng in the corresponding mixed sample ( Figure 3 ). A linear regression equation was established based on the proportion of counterfeit incorporation and allele frequency, with an R² value of 0.9979, indicating a strong linear relationship ( Figure 4 ).

[0103] The limit of detection (LOD) and the limit of quantification (LOQ) were evaluated by preparing mixed samples containing 1% and 2% adulteration:

[0104] A mixed sample with a 1% adulteration ratio: 99% ginseng and 1% American ginseng.

[0105] A mixed sample with a 2% adulteration ratio: 98% ginseng and 2% American ginseng.

[0106] Each adulterated ratio of the mixed sample was repeated 20 times, and the LOD and LOQ were determined with stable detection ≥ 95% and relative standard deviation RSD ≤ 25%, respectively.

[0107] The genomic DNA of mixed samples with different adulteration ratios was extracted as a template, and PCR amplification was performed using amplification primers PGF1 and PGR1 to obtain amplification product 1. The PCR amplification reaction system and reaction procedure were the same as step (4) of Example 3. Pyrophosphate sequencing was performed on amplification product 1 using sequencing primer PGS1 to detect the base G fluorescence signal ratio and base C fluorescence signal ratio of SNP1.

[0108] The detection rates of the mixtures containing 1% and 2% adulteration were 80% and 100%, respectively, with RSDs < 25%, respectively. Therefore, the LOD and LOQ were determined to be 2% (see Table 3).

[0109]

[0110] 2. Validation of the method used to quantify the degree of adulteration in mixed ginseng samples

[0111] In order to further verify the accuracy and repeatability of the method, the following mixed samples (mass percentage) were prepared:

[0112] 15%PQ / 85%PG: American ginseng 15%, Panax ginseng 85%.

[0113] 35%PQ / 65%PG: American ginseng 35%, Panax ginseng 65%.

[0114] 45%PQ / 55%PG: American ginseng 45%, Panax ginseng 55%.

[0115] Each mixed sample was set up with 3 replicates.

[0116] Using the genomic DNA of each mixed sample as a template, PCR amplification was performed using amplification primers PGF1 and PGR1 to obtain amplification product 1. The PCR amplification reaction system and reaction procedure were the same as step (4) of Example 3. Pyrophosphate sequencing was performed on amplification product 1 using sequencing primer PGS1 to detect the base G fluorescence signal ratio and base C fluorescence signal ratio of SNP1.

[0117] The frequencies of alleles C and G in SNP of amplified product 1 were basically consistent with the proportions of American ginseng and ginseng in the corresponding mixed samples, and the RSD was much less than 25%, indicating that this method can be used to quantify the degree of adulteration of mixed samples with good repeatability ( Figure 5 ).

[0118] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art, and the application of some basic features can be carried out.

Claims

1. Use of a substance for detecting SNP polymorphism in identifying or assisting in identifying ginseng, characterized in that: The SNPs include SNP1, which is a SNP in the chloroplast genome of a Panax species and is the 71st nucleotide of SEQ ID No. 1 in the sequence list, and the nucleotide is G or C.

2. The use according to claim 1, characterized in that: The substance comprises a substance for detecting SNP1 polymorphism; the substance for detecting SNP1 polymorphism is as follows D1), D2) or D3): D1) containing a PCR primer pair for amplifying a genomic DNA fragment including the SNP1 site; D2) a PCR reagent containing the PCR primer pair described in D1); D3) A kit containing the PCR primer pair described in D1) or the PCR reagent described in D2).

3. The use according to claim 1 or 2, characterized in that: The SNP further includes SNP2, which is a SNP in the chloroplast genome of a Panax species and is the 164th nucleotide of SEQ ID No. 5 in the sequence list, and the nucleotide is C or T.

4. The use according to claim 3, characterized in that: The substance further comprises a substance for detecting SNP2 polymorphism; the substance for detecting SNP2 polymorphism is the following E1), E2) or E3): E1) containing a PCR primer pair for amplifying a genomic DNA fragment including the SNP2 site; E2) a PCR reagent containing the PCR primer pair described in E1); E3) A kit containing the PCR primer pair described in E1) or the PCR reagent described in E2).

5. The product is characterized by: The product comprises the substance for detecting SNP polymorphism as described in any one of claims 1-4.

6. A method for identifying or assisting in identifying ginseng using SNP, characterized in that: The method comprises the steps of detecting the polymorphism of SNP1 in the sample to be tested and determining the ginseng content in the sample to be tested; The SNPs include SNP1, which is a SNP in the chloroplast genome of a Panax species, and is the 71st nucleotide of SEQID No.1 in the sequence list, and the nucleotide is G or C; The judgment criteria are: when the nucleotide of SNP1 is only G, the sample to be tested is ginseng; when the nucleotide of SNP1 is only C, there is no ginseng in the sample to be tested, but there are other species of Panax not ginseng; when the nucleotide of SNP1 has both G and C, there is both ginseng and other species of Panax not ginseng in the sample to be tested.

7. The method according to claim 6, characterized in that: The method for detecting the polymorphism of SNP1 in the sample to be tested is to use the genomic DNA of the sample to be tested as a template, perform PCR amplification with a primer pair consisting of the single-stranded DNA shown in SEQ ID No.2 in the sequence list and the single-stranded DNA shown in SEQ ID No.3 in the sequence list, and then perform pyrophosphate sequencing with the single-stranded DNA shown in SEQ ID No.4 in the sequence list as a primer; the 5' end of the single-stranded DNA shown in SEQ ID No.3 in the sequence list is labeled with biotin.

8. The method according to claim 6 or 7, characterized in that: For the sample to be tested whose nucleotide of SNP1 contains C, the method further comprises the steps of detecting the polymorphism of SNP2 in the sample to be tested and determining the content of American ginseng in the sample to be tested; The SNP2 is a SNP in the chloroplast genome of a Panax species, which is the 164th nucleotide of SEQ ID No. 5 in the sequence list, and the nucleotide is C or T; The judgment criteria are: when the nucleotide of SNP2 is only C, the sample to be tested is American ginseng; when the nucleotide of SNP2 is only T, there is no American ginseng in the sample to be tested, but there are other species of Panax ginseng other than American ginseng; when the nucleotide of SNP2 has both C and T, there is both American ginseng and other species of Panax ginseng other than American ginseng in the sample to be tested.

9. The method according to claim 8, characterized in that: The method for detecting the polymorphism of SNP2 in the sample to be tested is to use the genomic DNA of the sample to be tested as a template, perform PCR amplification with a primer pair consisting of the single-stranded DNA shown in SEQ ID No.6 in the sequence list and the single-stranded DNA shown in SEQ ID No.7 in the sequence list, and then perform pyrophosphate sequencing with the single-stranded DNA shown in SEQ ID No.8 in the sequence list as a primer; the 5' end of the single-stranded DNA shown in SEQ ID No.7 in the sequence list is labeled with biotin.

10. A method for quantifying ginseng in a sample, characterized in that: The method comprises the following steps: using the genomic DNA of the sample to be tested as a template, performing PCR amplification using a primer pair consisting of the single-stranded DNA shown in SEQ ID No.2 in the sequence list and the single-stranded DNA shown in SEQ ID No.3 in the sequence list, and then performing pyrophosphate sequencing using the single-stranded DNA shown in SEQ ID No.4 in the sequence list as a primer, detecting the base G fluorescence signal ratio of SNP1, and obtaining the mass percentage of ginseng in the sample to be tested; the 5' end of the single-stranded DNA shown in SEQ ID No.3 in the sequence list is labeled with biotin; the SNP1 is a SNP in the chloroplast genome of a Panax genus species, which is the 71st nucleotide of SEQ ID No.1 in the sequence list, and the nucleotide is G or C.

Images