Flow cell with swellable resin

Abstract

An example of a flow cell includes a base carrier, a reversibly swellable resin over the base carrier, and a recess defined in the reversibly swellable resin. The reversibly swellable resin includes at least one hydrophilic monomer selected from the group consisting of a poly (ethylene glycol)-based monomer, a poly (propylene glycol)-based monomer, and combinations thereof. The recessed portion has a first opening size when the reversibly swellable resin is in a non-swellable state, and has a second opening size smaller than the first opening size when the reversibly swellable resin is in a swellable state.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 373,610, filed on August 26, 2022, the contents of which are incorporated herein by reference in their entirety.

[0003] References to sequence listings

[0004] This application contains a sequence listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy was created on August 4, 2023, is named ILI246BPCT_IP-2367-PCT_Sequence_Listing.xml, and is 15,631 bytes in size. Background Art

[0005] Various protocols in biological or chemical research involve performing a large number of controlled reactions on a local support surface or within a predefined reaction chamber. The specified reactions can then be observed or detected, and subsequent analysis can help identify or reveal the characteristics of the chemicals involved in the reactions. In some examples, the controlled reactions produce fluorescence, and therefore optical systems can be used for detection. Summary of the invention

[0006] The flow cell disclosed herein includes a reversibly swellable resin having a single-depth recess or multiple-depth recesses separated by gap regions defined therein. The reversibly swellable resin responds to stimuli, such as liquids and / or pH. When exposed to one of these stimuli, the resin swells. Because there is more resin material in the gap region than in the recess, the gap region expands at a greater rate than the recess. The expansion of the gap region causes the opening at each of the recesses to narrow. Removal of the stimulus or application of an orthogonal stimulus causes the resin to deswell or shrink.

[0007] In some examples of flow cells, the reversibly swellable resin is swollen to capture pre-clustered particles or grafted particles for further chemical and / or biochemical manipulation, and deswelled to release the particles at a desired time. In other examples of flow cells, the reversibly swellable resin is swollen prior to nucleic acid template seeding. Smaller well openings minimize multiple seeding events occurring in a single well, thereby reducing polyclonality. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] By referring to the following detailed description and accompanying drawings, the features of the examples of the present disclosure will become apparent, wherein like reference numerals correspond to similar but possibly different parts. For the sake of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with other drawings in which they appear.

[0009] Figure 1 is a top view of an exemplary flow cell;

[0010] Figure 2A is along Figure 1 A cross-sectional view taken along line 2A-2A of , illustrating an architecture within a flow channel of one example of a flow cell disclosed herein, the architecture comprising a single-depth recess defined in a reversibly swellable resin;

[0011] Figure 2B Depicted is the flow of the reversibly swellable resin after the pre-clustered particles have been introduced into the flow channel of the flow cell and the reversibly swellable resin has been exposed to a stimulus. Figure 2A Architecture;

[0012] Figure 3A is along Figure 1 3A-3A, illustrating an architecture within a flow channel of another example of a flow cell disclosed herein, the architecture comprising a single-depth recess defined in a reversibly swellable resin;

[0013] Figure 3B Depicted is the reversible swelling of the resin after the template strand has been introduced into the flow cell and the resin has been exposed to a stimulus. Figure 3A Architecture;

[0014] Figure 4A is along Figure 1 4A-4A, illustrating an architecture within a flow channel of another example of a flow cell disclosed herein, the architecture comprising multiple depth recesses defined in a reversibly swellable resin;

[0015] FIG. 4B to FIG. 4D Each of the schematic diagrams depicts a different stage during the fabrication of the patterned structure. Figure 4A The architecture of Figure 4A Schematic diagram of the architecture in which grafted particles are introduced into a flow cell and the reversibly swellable resin is exposed to a stimulus ( Figure 4B ), where the functionalized layer is incorporated into the flow cell ( Figure 4C ), and where the gap region is cleaned ( Figure 4D );as well as

[0016] Figure 5A , Figure 5B , Figure 5C and Figure 5D Each depicts a schematic diagram of different grafted particles and pre-grafted polymers that can be used together in an example of a flow cell. DETAILED DESCRIPTION

[0017] The flow cell disclosed herein includes a reversibly swellable resin. The reversibly swellable resin has a patterned single-depth recess or multi-depth recess therein. In some examples, each single-depth recess is separated from each other single-depth recess by a gap region, or each multi-depth recess is separated from each other multi-depth recess by a gap region. In other examples, the multi-depth recesses are formed adjacent to each other without a gap region separating the recesses. The reversibly swellable resin swells when exposed to a stimulus, and deswells or shrinks when the stimulus is removed or an orthogonal stimulus is applied. In some examples of the flow cell, the reversibly swellable resin is swollen to capture pre-clustered particles for synthesis, and deswelled to release ordered particles. In other examples of the flow cell, the reversibly swellable resin swells before the nucleic acid template is inoculated. Smaller recess openings minimize multiple inoculation events that occur in a single recess, thereby reducing polyclonality.

[0018] definition

[0019] It should be understood that, unless otherwise indicated, the terms used herein are to be understood to have their ordinary meanings in the relevant art. Several terms used herein and their meanings are listed below.

[0020] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0021] The terms comprise, include, contain and forms of these terms are synonymous with each other and are intended to be equally broad.

[0022] The terms top, bottom, lower, upper, and above are used herein to describe the various components of the flow cell and / or the flow cell. It should be understood that these directional terms are not intended to imply a specific orientation, but are used to specify the relative orientation between components. The use of directional terms should not be interpreted as limiting the examples disclosed herein to any specific orientation.

[0023] The terms first, second, etc. are not intended to imply a particular orientation or order, but are used to distinguish one element from another.

[0024] It should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range, as if such value or sub-range was explicitly listed. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted as including not only the explicitly listed limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. In addition, when "about" and / or "substantially" are used to describe values, they are intended to cover minor variations (up to + / - 10%) from the specified value.

[0025] "Acrylamide monomer" is a monomer with the structure A monomer or a monomer containing an acrylamide group. Examples of monomers containing an acrylamide group include azidoacetamidopentyl acrylamide: And N-isopropylacrylamide: Other acrylamide monomers may be used.

[0026] As used herein, the term "activation" refers to the process of generating reactive groups on the surface of a base support or the outermost layer of a multilayer structure. Activation can be accomplished using silanization and / or plasma ashing. As an example, the surface can have a silane (e.g., norbornene silane) added thereto; or the surface can be plasma ashed to generate hydroxyl groups; or the surface can be plasma ashed and subsequently silanized. Although the accompanying drawings do not depict a separate silanized layer or hydroxyl groups (-OH groups) generated by plasma ashing, it should be understood that activation generates a silanized layer or -OH groups at the surface of the activated support or layer to covalently attach the functionalized layer to the underlying support or layer.

[0027] As used herein, an "aldehyde" is an organic compound containing a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double-bonded to an oxygen), wherein the carbon atom is also bonded to a hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:

[0028] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is completely saturated (i.e., does not contain double bonds and triple bonds). The alkyl group may have 1 to 20 carbon atoms. Typical alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, etc. As an example, the name "C1-C4 alkyl" indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl.

[0029] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. An alkenyl group can have 2 to 20 carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0030] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. An alkynyl group can have 2 to 20 carbon atoms.

[0031] As used herein, "aryl" refers to an aromatic ring or ring system containing only carbon in the ring backbone (i.e., two or more fused rings sharing two adjacent carbon atoms). When aryl is a ring system, each ring in the ring system is aromatic. Aryl groups may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0032] An "amine" or "amino" functional group refers to a -NRaRb group, where Ra and Rb are each independently selected from hydrogen (e.g., ), C1-6 (or C1-C6) alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5- to 10-membered heteroaryl and 5- to 10-membered heterocyclyl, as defined herein.

[0033] As used herein, the term "attachment" refers to the state in which two things are joined, fastened, adhered, connected or combined with each other, directly or indirectly. For example, the bond formed can be covalent or non-covalent. A covalent bond is characterized by the sharing of electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve sharing of electron pairs and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0034] An "azide" or "azido" functional group refers to -Ns.

[0035] The term "base carrier" refers to a structure to which various components of a flow cell (e.g., a reversibly swellable resin) can be added. The base carrier can be a wafer, a panel, a rectangular sheet, a die, or any other suitable configuration. The base carrier is typically rigid and insoluble in aqueous liquids. The base carrier can be inert to the chemicals present in the recessed portion. For example, the base carrier can be inert to chemicals used to attach primers, for sequencing reactions, etc. The base carrier can be a single-layer structure or a multi-layer structure.

[0036] As used herein, "carbocyclyl" means a non-aromatic cyclic ring or ring system containing only carbon atoms in the main chain of the ring system. When the carbocyclyl is a ring system, two or more rings can be joined together in a fused, bridged or spiro-connected manner. The carbocyclyl can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Therefore, the carbocyclyl includes cycloalkyl, cycloalkenyl and cycloalkynyl. The carbocyclic group can have 3 to 20 carbon atoms. Examples of carbocycles include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl and spiro[4.4]nonanyl.

[0037] As used herein, the term "carboxylic acid" or "carboxyl" refers to -COOH.

[0038] As used herein, "cycloalkylene" refers to a fully saturated carbocyclic ring or ring system that is attached to the rest of the molecule through two points of attachment.

[0039] As used herein, "cycloalkenyl" or "cycloalkene" refers to a carbon ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbon ring or ring system having at least one heteroatom in the ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.

[0040] As used herein, "cycloalkynyl" or "cycloalkyne" refers to a carbocyclic ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. One example is cyclooctyne. Another example is bicyclononyne. Also as used herein, "heterocycloalkynyl" or "heterocycloalkyne" means a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, having at least one triple bond, wherein no ring in the ring system is aromatic.

[0041] As used herein, the terms "deep portion" and "shallow portion" refer to the three-dimensional (3D) space within a multi-depth recess. In a multi-depth recess, the deep portion has a greater depth than the shallow portion, for example as measured from the opening of the multi-depth recess.

[0042] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and in some cases, results in modification of surface properties. Generally speaking, deposition may be performed using vapor deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0043] As used herein, the term "recess" refers to a discrete concave feature in a substrate having a surface opening that may be at least partially surrounded by a gap region of the substrate. A recess may have any of a variety of shapes at its opening in the surface, including, for example, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. A cross-section of a recess taken orthogonally to the surface may be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0044] When used in reference to a collection of items, the term "each" is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur if explicitly disclosed or the context clearly dictates otherwise.

[0045] As used herein, the term "epoxy" (also known as a glycidyl or oxirane group) refers to

[0046] As used herein, the term "flow cell" is intended to mean a container having a flow channel in which a reaction can be performed, an inlet for delivering reagents to the flow channel, and an outlet for removing reagents from the flow channel. In some examples, the flow cell enables detection of reactions occurring in the chamber. For example, the flow cell may include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc. within the flow channel.

[0047] As used herein, a "flow channel" or "channel" may be a region defined between two bonded components that can selectively receive a liquid sample. In some examples, a flow channel may be defined between a substrate and a cover, and thus may be in fluid communication with one or more recesses defined in the substrate. A flow channel may also be defined between two substrate surfaces bonded together.

[0048] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent atoms) containing one or more heteroatoms (i.e., elements other than carbon, including but not limited to nitrogen, oxygen, and sulfur) in the ring backbone. When heteroaryl is a ring system, each ring in the ring system is aromatic. A heteroaryl group may have 5-18 ring members.

[0049] As used herein, "heterocycle" means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. The heterocyclic rings may be joined together in a fused, bridged or spiro manner.

[0050] The heterocyclic ring may have any degree of saturation, provided that at least one ring in the ring system is not aromatic. In the ring system, heteroatoms may be present in non-aromatic rings or aromatic rings. The heterocyclic group may have 3 to 20 ring members (i.e., the number of atoms constituting the ring backbone, including carbon atoms and heteroatoms).

[0051] As used herein, the term "hydrazine" or "hydrazine" refers to a -NHNH2 group.

[0052] As used herein, the term "hydrazone" or "hydrazine" refers to A group wherein Ra and Rb are each independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocycle, as defined herein.

[0053] As used herein, "hydroxy" refers to an -OH group.

[0054] As used herein, an "initiator" is a molecule that undergoes a reaction upon absorption of radiation or heat or upon exposure to free radicals to produce a reactive species. An initiator is capable of initiating or catalyzing a chemical reaction that results in a change in the solubility and / or physical properties of a formulation. A "cationic initiator" or "photoacid generator" (PAG) is a molecule that becomes acidic upon exposure to radiation or free radicals. PAGs typically undergo irreversible proton photodissociation. A "free radical initiator" is a molecule that generates free radical species upon exposure to radiation or heat and promotes free radical reactions.

[0055] As used herein, the term "gap region" refers to a region of a substrate that separates recesses, for example. For example, a gap region may separate one recess of an array from another recess of the array. Two recesses that are separated from each other may be discrete, i.e., lack physical contact with each other. In many examples, the gap region is continuous, while the recesses are discrete, for example, as in the case of multiple recesses defined in an otherwise continuous surface. The separation provided by the gap region may be partial separation or complete separation.

[0056] "Lid" refers to a covering that can be attached to a patterned structure to form a flow cell.

[0057] The term "polymer hydrogel" refers to a semi-rigid polymer that is permeable to liquids and gases. A polymer hydrogel can swell when a liquid (e.g., water) is absorbed and can shrink when the liquid is removed, such as by drying. Although a hydrogel can absorb water, it is not water soluble.

[0058] As used herein, "nitrile oxide" means "R a C≡N + O - " group, where R a is defined herein. Examples of the preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloroamide-T or by the action of a base on an imidic chloride [RC(Cl)=NOH] or by reaction between hydroxylamine and an aldehyde.

[0059] As used herein, "nitrone" refers to Group, where R 1 , R 2 and R 3 It can be R as defined in this article a Group and R b Any of the groups, except that R 3 Not hydrogen (H).

[0060] As used herein, "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. Nucleotide is a monomeric unit of a nucleic acid sequence. In ribonucleic acid (RNA), the sugar is ribose, and in deoxyribonucleic acid (DNA), the sugar is deoxyribose, i.e., a sugar lacking a hydroxyl group present at the 2' position of ribose. Nitrogenous heterocyclic bases (i.e., nucleobases) may be purine bases or pyrimidine bases. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to the N-1 of pyrimidine or the N-9 of purine. Nucleic acid analogs may have any of a modified phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0061] The term "orthogonal" when used to describe two stimuli means that the stimuli are different from each other and have different effects on the reversibly swellable resin. One stimulus can be used to induce swelling and another stimulus can be used to reduce swelling, ie induce non-swelling.

[0062] In some examples, the term "over" may mean that one component or material is directly located on another component or material. In other examples, the term "over" may mean that one component or material is indirectly located on another component or material. By indirectly, it means that a gap or another component or material may be located between the two components or materials.

[0063] As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a polyhedral oligomeric silsesquioxane that is a hybrid intermediate between silicon dioxide (SiO2) and organosilicon (R2SiO2). 1.5 ). Examples of polyhedral oligomeric silsesquioxanes may be as described by Kehagias et al. in Microelectronic Engineering 86 (2009) pp. 776-778, which is incorporated by reference in its entirety. In one example, the composition is a composition having the formula [RSiO 3 / 2 ] nThe organosilicon compounds of the present invention are preferably selected from the group consisting of epoxy, azide / azide, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate and / or methacrylate, or other groups such as alkyl, aryl, alkoxy and / or haloalkyl groups.

[0064] As used herein, the term "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers are part of a primer set and are used as the starting point for template amplification and cluster generation. Other primers referred to herein as sequencing primers are used as the starting point for DNA synthesis. The 5' end of each primer in the primer set can be modified to allow coupling reaction with the functional group of the polymer chain. The primer length can be any number of base lengths and can include a variety of non-natural nucleotides. In one example, a sequencing primer is a short chain ranging from 10 to 60 bases, or 20 to 40 bases.

[0065] The term "primer set" refers to a pair of primers that together can amplify a template nucleic acid strand (also referred to herein as a library template). Opposite ends of the template strand include adapters that hybridize to corresponding primers in the set.

[0066] A "thiol" functional group refers to -SH.

[0067] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine may be optionally substituted.

[0068] As used herein, "tetrazole" refers to a five-membered heterocyclic group containing four nitrogen atoms. Tetrazole may be optionally substituted.

[0069] The term "transparent" refers to a material, for example, in the form of a layer, that is capable of transmitting a specific wavelength or range of wavelengths. For example, the material may be transparent to the wavelengths used in the sequencing operation. Transparency can be quantified using transmittance, i.e., the ratio of the light energy falling on a subject to the light energy transmitted through the subject. The transmittance of a transparent layer will depend on the thickness of the layer, the wavelength of the light, and the dose of light to which it is exposed. In the examples disclosed herein, the transmittance of a transparent metal layer may range from 0.1 (10%) to 1 (100%). The material of the transparent metal layer may be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting layer is capable of having the desired transmittance.

[0070] Reversible swelling resin

[0071] Reversibly swellable resins are UV-curable resins that are capable of swelling in the presence of a particular stimulus and deswelling and thereby shrinking when the stimulus is removed or when the resin is exposed to another orthogonal stimulus. The monomer units of the composition used to form the cured resin impart the desired properties to the cured resin, including its swelling properties.

[0072] At least one hydrophilic monomer is included to increase the hydrophilicity of the cured resin surface, which in turn increases the swellability of the cured resin. In one example, the hydrophilic monomer is selected from the group consisting of poly(ethylene glycol) based monomers, poly(propylene glycol) based monomers, acid-containing monomers, and combinations thereof.

[0073] Poly(ethylene glycol)-based monomers are monomers or macromonomers having 2 to about 1,000 ethylene glycol units. In other words, poly(ethylene glycol) has a number average molecular weight in the range of about 300 to about 20,000. In one example, the range of the number average molecular weight is from about 300 to about 5,000. Some specific examples of suitable poly(ethylene glycol)-based monomers include ethylene glycol diglycidyl ether, poly(ethylene glycol) (400) diglycidyl ether, or poly(ethylene glycol) (1000) diglycidyl ether. Poly(propylene glycol)-based monomers are monomers or macromonomers having 2 to about 1,000 ethylene glycol units. In other words, poly(propylene glycol) has a number average molecular weight in the range of about 300 to about 20,000, and in some examples about 300 to about 5,000. Some specific examples of suitable poly(propylene glycol)-based monomers include propylene glycol diglycidyl ether, poly(propylene glycol) (600) diglycidyl ether, or poly(propylene glycol) (1000) diglycidyl ether. The number average molecular weight of poly(ethylene glycol) and / or poly(propylene glycol) can be adjusted to adjust the hydrophilicity and / or swelling properties of the resin. When used in combination, the weight ratio of poly(ethylene glycol) (PEG) and poly(propylene glycol) (PPG) can be adjusted to adjust the hydrophilicity and / or swelling properties of the resin. More PEG will increase swelling, so higher molecular weight PEG should increase the degree of swelling. In contrast, the solubility of PPG in water decreases as the molecular weight increases. Therefore, changing the ratio and / or molecular weight can adjust the swelling properties.

[0074] Acid-containing monomers are monomers that include one or more carboxylic acid / carboxylate or sulfonic acid / sulfonate groups that deprotonate at high pH (eg, about 9 to about 10), making them anionic and swellable.

[0075] In one example, the monomers used to form the reversibly swellable resin consist of hydrophilic monomers. In this example, 100% (by mass) of the monomers polymerized to form the resin composition are hydrophilic monomers. In other examples, the hydrophilic monomer is copolymerized with another monomer or polymer, which may be selected to introduce an attachment functional group or to improve the printability of the resin. When other monomers or polymers are used with the hydrophilic monomer, the resin may contain about 0.5% (by mass) to 50% (by mass) of the hydrophilic monomer based on the total solids of the resin composition. In some cases, the resin composition may contain about 0.5% (by mass) to 20% (by mass) of the hydrophilic monomer based on the total solids of the resin composition. When polishing is not involved in the application of the polymer hydrogel, a higher percentage of hydrophilic monomers, such as about 20% to about 50%, may be particularly suitable.

[0076] In some examples, additional monomers are included in the resin composition to introduce functional groups into the cured resin that are capable of attaching to the polymer hydrogel or primer. When the polymer hydrogel or primer is to be covalently attached to the reversibly swellable resin (see Figure 2A ), the additional monomer copolymerized with the hydrophilic monomer comprises a functional group covalently attached to the polymer hydrogel or primer. In a specific example, the functional group is selected from the group consisting of alkynes, dienes (e.g., in the form of ring-strained olefins), azides, and amines. Examples of monomers that can be used to introduce covalently attachable functional groups include glycidyl propargyl ether: Methyl-5-norbornene-2,3-dicarboxylic anhydride: Bicyclo[2.2.1]hept-5-ene-2,3-dicarboxylic anhydride: 3-Azido-1-propanol: 11-Azido-3,6,9-trioxaundecane-1-amine: Propionic acid and their combinations.

[0077] The polymer hydrogel can non-covalently interact with examples of reversibly swellable resins comprising less than 20 mass % hydrophilic monomers without adding any additional functionality to the polymer hydrogel.

[0078] Each monomer introducing an attachment functional group may be present in an amount ranging from about 2% by mass to about 50% by mass based on the total solid of the resin composition.

[0079] Examples of monomers or polymers that may improve the printability of the resin composition are hydrophobic monomers or polymers containing epoxy groups or acrylate groups.

[0080] Examples of suitable hydrophobic monomers include epoxy-substituted silsesquioxane monomers, such as epoxycyclohexylethyl polysilsesquioxane:

[0081]

[0082] Glycidyl polysilsesquioxane:

[0083]

[0084] And combinations thereof. An example of a resin composition includes epoxy cyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane in a mass ratio ranging from about 3:7 to about 7:3. In a specific example, the mass ratio of epoxy cyclohexylethyl polysilsesquioxane to glycidyl polysilsesquioxane is 1.5:1.

[0085] Examples of suitable hydrophobic polymers include acrylate-substituted polyhedral oligomeric silsesquioxane polymers, such as poly[(propylmethacryloyl-heptaisobutyl-polyhedral oligomeric silsesquioxane)-co-(tert-butyl methacrylate)]:

[0086]

[0087] Each monomer or polymer that improves printability may be included in an amount ranging from about 2% by mass to about 50% by mass based on the total solid of the resin composition.

[0088] Another exemplary monomer that can be copolymerized with the hydrophilic monomer enables the cured resin to be, for example, covalently attached to an underlying base support. An example of such a monomer is a reactive silane, such as an epoxy silane, which can be attached to the base support through an oxygen bond. This type of monomer may be desirable for an acryl-based resin formulation.

[0089] Each monomer capable of attaching to a base carrier may be included in an amount ranging from about 2% by weight to about 50% by weight based on the total solid of the resin composition.

[0090] The resin composition for forming the reversibly swellable resin may further include a photoinitiator, a surface additive, and a solvent.

[0091] The photoinitiator is selected from the group consisting of free radical photoinitiators, cationic photoinitiators, and combinations thereof. Examples of free radical initiators are selected from the group consisting of: 1,1,2,2-tetraphenyl-1,2-ethanediol: Ethyl pyruvate: Thiol; Ethyl-3-methyl-2-oxobutyrate: and combinations thereof. Examples of cationic initiators are selected from the group consisting of: bis(4-methylphenyl)iodonium hexafluorophosphate: Bis[4-(tert-butyl)phenyl]iodonium tetrakis(nonafluorotert-butoxy)aluminate: Tris(4-((4-acetylphenyl)thio)phenyl)sulfoniumtetrakis(perfluorophenyl)borate (PAG 290): Where R is and their combinations.

[0092] In one example of the resin composition, the photoinitiator (or each photoinitiator if a combination is used) is present in an amount ranging from about 0.05 mass % to about 10 mass % based on the total solid content of the resin composition. In another example, the photoinitiator is present in an amount ranging from about 0.2 mass % to about 8 mass %.

[0093] Surface additives can adjust the surface tension of the resin composition, which can improve the coatability of the resin composition, promote film stability and / or improve leveling. Examples of surface additives include polyacrylate polymers (such as those available from BYK -350). The amount of the surface additive may be 5 mass % or less based on the total mass of the resin composition.

[0094] The resin composition disclosed herein may also include a solvent. A solvent may be added to the resin composition to achieve a desired viscosity of the deposition technique for applying the resin composition and to obtain a desired resin layer thickness. Examples of suitable solvents include propylene glycol monomethyl ether acetate (PGMEA), toluene, dimethyl sulfoxide (DMSO), tetrahydrofuran (THF), etc. In some examples, the solvent is PGMEA.

[0095] Once the solvent is added, the total solids concentration of the resin composition can range from about 15% to about 60% by mass (based on the total mass of the resin composition), and the amount of the solvent can range from about 40% to about 85% by mass (based on the mass of the resin composition). The upper limit of the total solids can be higher, depending on the respective solubility of the solid components in the selected solvent. In some examples, the solids content is about 30% or less.

[0096] To produce the resin composition, the various components can be mixed together in any desired order.One example of a method for preparing any example of the resin composition disclosed herein includes mixing monomers (eg, at least hydrophilic monomers) with an initiator and a surface additive, and dissolving the mixture in a solvent.

[0097] The resin composition is UV curable. In one example, a 365 nm UV light source can be used to cure the resin composition to form a reversibly swellable resin.

[0098] Flow Cells and Methods

[0099] The reversibly swellable resins disclosed herein can be incorporated into patterned structures for forming flow cells. Figure 2A and Figure 2B , Figure 3A and Figure 3B as well as 4A to 4D Various examples of patterned structures are shown and described.

[0100] A top view of each exemplary flow cell 10 is shown in FIG. Figure 1 . The flow cell 10 can be an open wafer (i.e., without a cover or a second patterned structure), or can include two patterned structures bonded together, or can include one patterned structure bonded to a cover. The two patterned structures or one patterned structure and the cover can be attached to each other by a spacer (not shown). The spacer can be any material that seals portions of the patterned structures together or seals portions of the patterned structure with the cover. As an example, the spacer can be an adhesive, a radiation absorbing material that facilitates bonding, and the like. In some examples, the spacer is a radiation absorbing material, such as The patterned structure or the patterned structure and the cover may be bonded using any suitable technique such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art.

[0101] When a cover is used, the cover can be any material that is transparent to the excitation light used in sequencing. In an optical detection system, the cover can also be transparent to the emissions generated by the reactions occurring within the flow cell 10. As an example, the cover can include glass (e.g., borosilicate, fused silica, etc.) or a transparent polymer. A commercially available example of a suitable borosilicate glass is D Commercially available examples of suitable polymeric materials (ie, cycloolefin polymers) are available from Zeon Chemicals LP. product.

[0102] The flow channel 12 is located between two patterned structures or between a patterned structure and a cover. In the example of a wafer with an opening, the flow channel 12 can be defined in a base carrier 16, and a patterned resin (e.g., resin 18) can be located in the flow channel. In this example, the flow channel 12 is not closed, but open. Figure 1The example shown includes eight flow channels 12. Although eight flow channels 12 are shown, it should be understood that any number of flow channels 12 (e.g., a single flow channel 12, four flow channels 12, etc.) may be included in the flow cell 10. When multiple flow channels 12 are included, each flow channel 12 may be separated from each other flow channel 12 so that fluid introduced into one flow channel 12 does not flow into an adjacent flow channel 12. Some examples of fluids introduced into the flow channels 12 may introduce reaction components (e.g., DNA samples, polymerases, sequencing primers, nucleotides, etc.), washing solutions, deblocking agents, etc.

[0103] The flow channel 12 can have any desired shape. In one example, the flow channel 12 has a substantially rectangular configuration. The length of the flow channel 12 depends in part on the size of the base carrier of the patterned structure. The width of the flow channel 12 depends in part on the size of the base carrier of the patterned structure, the desired number of flow channels 12, the desired spacing between adjacent channels 12, and the desired spacing at the periphery of the patterned structure.

[0104] When microcontact, aerosol or inkjet printing is used to deposit a separate material defining the wall of flow channel 12, the height of flow channel 12 can be as small as a single layer thick. As other examples, the height of flow channel 12 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm or more. In one example, the height may be in the range of about 10 μm to about 100 μm. In another example, the height may be in the range of about 10 μm to about 30 μm. In another example, the height is about 5 μm or less. It should be understood that the height of flow channel 12 may be greater than, less than, or between the values ​​specified above.

[0105] Each flow channel 12 is in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 12 may be positioned at opposite ends of the flow cell 10. The inlet and outlet of the respective flow channel 12 may alternatively be positioned at any position along the length and width of the flow channel 12 that enables the desired fluid flow.

[0106] The inlet allows fluid to be introduced into the flow channel 12, and the outlet allows fluid to be withdrawn from the flow channel 12. Each of the inlet and outlet is fluidly connected to a fluid control system (including, for example, a reservoir, pump, valve, waste container, etc.) that controls fluid introduction and discharge.

[0107] Figure 2A , Figure 3A and Figure 4D Different examples of patterned structures 14 , 14 ′, 14 ″, and thus different examples of architectures within the flow channel 12 of the flow cell 10 , are depicted.

[0108] First Exemplary Flow Cell and Method

[0109] The patterned structure 14 in the first example of the flow cell 10 includes a base carrier 16; a reversibly swellable resin 18 located above the base carrier; and a recessed portion 20 defined in the reversibly swellable resin 18, the recessed portion 20 having a first opening size D1 ( Figure 2A ), and has a second opening size D2 ( D1 ) smaller than the first opening size D1 when the reversibly swellable resin 18 is in a swollen state. Figure 2B ).

[0110] Examples of base carrier 16 include epoxysilicone, glass, modified or functionalized glass, plastics (including acrylic, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as available from Chemours ), cycloolefins / cycloolefin polymers (COP) (such as those available from Zeon ), polyimide, nylon (polyamide), etc.), ceramic / ceramic oxides, silicon dioxide, fused silicon dioxide or silicon dioxide-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metal, inorganic glass, etc.

[0111] Any example of the resin composition disclosed herein is deposited on the base carrier 16 and patterned to form the reversibly swellable resin 18. The resin composition can be deposited on the base carrier 16 using any suitable application technique that can be manual or automatic. As an example, the deposition of the resin composition can be performed using a vapor deposition technique, a coating technique, a grafting technique, etc. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping dispensing, aerosol printing, screen printing, microcontact printing, inkjet printing, etc. In one example, spin coating is used.

[0112] After the resin composition is deposited, the resin composition may be soft-baked to remove excess solvent and / or improve resin layer / substrate adhesion. When performed, the soft bake may be performed after the resin composition is deposited and before the imprinting device (e.g., a working stamp or other template) is positioned in the resin composition, and at a relatively low temperature in the range of about 50° C. to about 150° C. for a time greater than 0 seconds to about 3 minutes. In one example, the soft bake time is in the range of about 30 seconds to about 2.5 minutes.

[0113] The deposited resin composition is then patterned using any suitable patterning technique. In one example, the resin composition is patterned using nanoimprint lithography. Using nanoimprint lithography, an imprinting device is pressed against or rolled on a layer of the resin composition to produce an indentation on the resin composition. The imprinting device includes a template that will transfer the desired pattern to the resin composition.

[0114] To produce Figure 2A In the pattern shown, the imprinting device includes protrusions that are negative replicas of the recesses 20 to be formed in the resin composition.

[0115] Many different patterns of recesses 20 are contemplated, including regular, repeating, and irregular patterns. In one example, the recesses 20 are arranged in a hexagonal grid to achieve close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be an xy format of recesses 20 in the form of rows and columns. In some other examples, the layout or pattern may be a repeated arrangement of recesses 20 separated by gap areas 28.

[0116] The layout or pattern of the recesses 20 may be characterized with respect to the density of the recesses 20 (ie, the number of recesses 20) in a defined area. For example, the recesses 20 may be approximately 2 million / mm 2 The density can be adjusted to different densities, including, for example, about 100 / mm 2 , about 1,000 pieces / mm 2 , about 100,000 / mm 2 , about 1 million pieces / mm 2 , about 2 million pieces / mm 2 , about 5 million pieces / mm 2 , about 10 million / mm 2 , about 50 million / mm 2 Or a greater or lesser density. It should also be understood that the density of the recesses 20 can be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. As an example, a high-density array can be characterized as having recesses 20 separated by less than about 100nm, a medium-density array can be characterized as having recesses 20 separated by about 400nm to about 1μm, and a low-density array can be characterized as having recesses 20 separated by more than about 1μm. Although exemplary densities have been provided, it should be understood that any suitable density can be used. In some cases, it is desired that the spacing between the recesses 20 is even greater than the examples listed herein.

[0117] The layout or pattern of the recessed portion 20 may also be characterized according to or alternatively according to an average pitch, or the spacing from the center of one recessed portion 20 to the center of an adjacent recessed portion 20 (center-to-center spacing) or the spacing from the left edge of one recessed portion 20 to the right edge of an adjacent recessed portion 20 (edge-to-edge spacing). The pattern may be regular, so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or greater or less. The average pitch of a particular pattern of recessed portions 20 may be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. In one example, the recessed portion 20 has a pitch of about 1.5 μm (center-to-center spacing). Although exemplary average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0118] The size of each recess 20 may be characterized by its volume, opening area, depth and / or diameter or length and width. As an example, the volume may be about 1×10 -3 μm 3 About 1×104μm 3 The area of ​​each recessed opening may be about 1×10 -3 μm 2 About 1×10 3 μm 2 The depth of each concave portion 20 may be in the range of about 0.1 μm to about 1×10 3 The diameter or length and width of each concave portion 20 may be in the range of about 50 nm to about 1×10 3 μm range.

[0119] Referring again to the method for forming the reversibly swellable resin 18, the deposited resin composition can then be cured in place with an imprinting device, which forms a reversibly swellable resin 18 including a recessed portion 20 defined therein. Curing can be accomplished by exposing the resin composition (with the imprinting device pressed therein) to incident light of a suitable energy dose (e.g., in the range of about 0.5 J to about 10 J) for 60 seconds or less. The incident light can be actinic radiation, such as ultraviolet (UV) radiation. In one example, most of the emitted UV radiation can have a wavelength of about 365 nm. In this example, a 365 nm ultraviolet (UV) light source can be used to perform curing; and the deposited resin composition is exposed to the UV light for a time in the range of about 3 seconds to about 30 seconds. In this example, the 365 nm UV light source can be a 330 mW / cm 2 Power output (measured at sample level) of a light emitting diode (LED).

[0120] In the examples disclosed herein, light energy exposure initiates polymerization and cross-linking of monomers in the resin composition. The curing process may include a single UV exposure stage or a single heating event.

[0121] After curing, the imprinting device may be removed. After releasing the imprinting device, topographical features, such as recesses 20 , are defined in the cured reversibly swellable resin 18 .

[0122] Figure 2A The patterned structure 14 shown may be used as an opening wafer, or may be bonded to a second patterned structure 14 or a cover (not shown) to form a wafer with a plurality of openings in each flow channel 12. Figure 2A The architecture of the flow cell 10 is shown.

[0123] The exemplary flow cell 10 and the pre-clustered particles 22 ( Figure 2B ) and will now be described.

[0124] Each of the pre-clustered particles 22 includes a particle core 24 and a plurality of amplicons 26 attached to the particle core 24. In order to generate the pre-clustered particles 22, grafted particles are used in the flow-through cell amplification technique. The grafted particles include a particle core 24 and a primer set attached to the core 24 (an example of a grafted particle 36 is shown in FIG. Figure 4B middle).

[0125] In some examples, particle core 24 is formed of a polymer hydrogel. As an example, the polymer hydrogel material can be poly (N- (5-azidoacetamidopentyl) acrylamide-co-acrylamide) (PAZAM) or another acrylamide copolymer disclosed herein, PEG-acrylate, PEG-diacrylate, PEG-amine, PEG-carboxylate, PEG-dithiol, PEG-epoxide, PEG-isocyanate, PEG-maleimide, cross-linked poly (methyl methacrylate) (PMMA), polyvinyl pyrrolidone (PVPON), polyvinyl alcohol (PVA), polyethylene oxide-polypropylene oxide block copolymer (PEO-PPO), poly (hydroxyethyl methacrylate) (PHEMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid)-poly(ethylene glycol) block copolymers, poly(ethylene glycol)-poly(lactic acid-co-glycolic acid) block copolymers, poly(acrylic acid-co-vinyl sulfonic acid), poly(acrylamide-co-vinyl sulfonic acid), poly(L-aspartic acid), poly(asparagine), adipic acid dihydrazide-modified or aldehyde-modified poly(L-glutamic acid), bisacrylamide), or hydrogels based on one or more of polylysine, starch, agar, agarose, heparin, alginate, alginate sulfate, dextran sulfate, hyaluronic acid, pectin, carrageenan, gelatin, chitosan, cellulose and collagen, or combinations or mixtures thereof.

[0126] In some of the examples disclosed herein, the polymer hydrogel is a copolymer comprising at least one acrylamide monomer unit, and is a linear polymer hydrogel or a branched polymer hydrogel (eg, a dendrimer).

[0127] The linear or branched polymer hydrogel may comprise a first repeating unit of formula (I): in:

[0128] R 1 is selected from the group consisting of: -H, halogen, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocycle, and optionally substituted variants thereof;

[0129] R 2 is selected from the group consisting of: an azido group, an optionally substituted amino group, an optionally substituted alkenyl group, an optionally substituted alkyne group, a halogen group, an optionally substituted hydrazone group, an optionally substituted hydrazine group, a carboxyl group, a hydroxyl group, an optionally substituted tetrazole group, an optionally substituted tetrazine group, a nitrile oxide group, a nitrone group, a sulfate group, and a thiol group; each (CH2) p may be optionally substituted; and p is an integer from 1 to 50;

[0130] The second repeating unit of formula (II): Where: R 3 , R3 '、R 4 , R 4 Each of ' is independently selected from the group consisting of: -H, R 5 、-OR 5 、-C(O)OR 5 、-C(O)R 5 、-OC(O)R 5 、-C(O)NR 6 R 7 and-NR 6 R 7 ; R 5 is selected from the group consisting of -H, -OH, alkyl, cycloalkyl, hydroxyalkyl, aryl, heteroaryl, heterocycle, and optionally substituted variants thereof; and R 6 and R 7 Each of is independently selected from the group consisting of -H and alkyl.

[0131] In an example of a polymer hydrogel, R 1 -H; R 2 is an azido group; R 3 '、R 4 and R 4 Each of ' is -H; R 3 -C(O)NR 6 R 7 , where R 6 and R 7 Each of is -H; and p is 5. The polymer hydrogel is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide, or PAZAM. In one variation of PAZAM, R 1 -H; R 2 is an azido group; R 3 '、R 4 and R 4 Each of ' is -H; R 3 -C(O)NR 6 R 7 , where R 6 and R 7 Each of is a C1-C6 alkyl group (eg, -CH3); and p is 5.

[0132] In some examples, R of some of the repeating units of formula (I) 2 is replaced by tetramethylethylenediamine (TEMED). TEMED is a reaction promoter that can be introduced during copolymerization. Due to side reactions, TEMED replaces azide (N3) or other R 2 Although this reaction reduces the azide (or other R2 Example) content, but also introduces branching sites. Branching sites can provide locations where copolymer chains can branch off from each other.

[0133] In other examples, a third repeating unit of formula (II) may be included, provided that the second and third repeating units are different. For example, in the second repeating unit, R 3 '、R 4 and R 4 Each of ' is -H; R 3 -C(O)NR 6 R 7 , where R 6 and R 7 Each of is -H, and in the third repeating unit, R 3 '、R 4 and R 4 Each of ' is -H; R 3 Yes-C(O)NR 6 R 7 , where R 6 and R 7 Each of is a C1-C6 alkyl group.

[0134] The number of first repeating units (Formula (I)) may be an integer in the range of 2 to 50,000, and the number of second repeating units (Formula (II)) may be an integer in the range of 2 to 100,000. When a third repeating unit is included, the number of such units may be an integer in the range of 1 to 100,000. It will be appreciated that the incorporation of the individual units may be statistical, random or block, and may depend on the method used to synthesize the polymer hydrogel.

[0135] In other examples of polymer hydrogels, the first repeating unit of formula (I) may be replaced by a heterocyclic azide group of formula (III):

[0136]

[0137] Where R 8 is H or C1-C6 alkyl; R 9 is H or C1-C6 alkyl; L is a linker including a straight chain having 2 to 20 atoms selected from the group consisting of carbon, oxygen and nitrogen atoms and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a straight chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen atoms and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide having H or C1-C4 alkyl attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl or pyrimidinyl.

[0138] In one example of the polymer hydrogel, formula (III) is the first repeating unit and formula (II) is the second repeating unit. In another example, formula (III) is the first repeating unit, an example of formula (II) is the second repeating unit, and a different example of formula (III) is the third repeating unit.

[0139] It should be understood that other hydrogel materials may be used for the polymer hydrogel of the particle core 24, so long as they are functionalized to graft the oligonucleotide primers of the primer set thereto.

[0140] Other examples of other suitable polymer hydrogels include functionalized polysilanes, such as norbornene silane, azido silane, alkyne functionalized silane, amine functionalized silane, maleimide silane, or any other polysilane with a functional group to which an oligonucleotide primer can be attached. Other examples of suitable polymer hydrogels include those with colloidal structures, such as agarose; or those with polymer mesh structures, such as gelatin; or those with cross-linked polymer structures, such as polyacrylamide polymers and copolymers, acrylamide (SFA) or an azidized version of SFA without silane. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing vinyl groups, or from monomers forming a [2+2] photocycloaddition reaction. Other examples of suitable polymer hydrogel materials include mixed copolymers of acrylamide and acrylate. A variety of polymer architectures containing acrylic monomers (e.g., acrylamide, acrylate, etc.) can be used in the examples disclosed herein, such as highly branched polymers, including dendritic polymers. For example, monomers (eg, acrylamide, etc.) can be incorporated into the branches (arms) of the dendrimers randomly or in blocks.

[0141] Examples of dendritic polymer hydrogel materials include a dendritic core having repeating units of formula (II) and (III) in the arms extending from the core. The dendritic core may have any number of arms between 3 arms and 30 arms.

[0142] The dendritic core can be any multifunctional component capable of achieving a controlled polymerization mechanism that results in defined arm lengths within the polymer structure and at least substantially uniform arm lengths between polymer structures. In one example, the arms of the dendritic core are identical to one another.

[0143] The central molecule / compound of the dendritic core can be any multifunctional molecule, such as a macrocycle (e.g., cyclodextrin, porphyrin, etc.), an extended π system (e.g., perylene, fullerene, etc.), a metal-ligand complex, a polymer core, etc. Some specific examples of the central molecule / compound of the dendritic core include phenyl groups, benzoic acid, pentaerythritol, phosphazene groups, etc.

[0144] The dendritic core includes arms extending from a central molecule / compound. Each arm may include a group that enables incorporation of monomers of formula (II) and (III). In one example, a thiocarbonyl group is included in each arm and thus includes a reversible addition-fragmentation chain transfer agent (RAFT agent). In another example, the dendritic core may include an atom transfer radical polymerization (ATRP) initiator in each arm. In another example, the dendritic core includes a nitroxide (aminooxy) mediated polymerization (NMP) initiator in each arm.

[0145] It should be understood that the functional groups in one or more of the repeating units of the polymer hydrogel of the particle core 24 are capable of attaching primers ( Figure 2B These functional groups (for example, R 2 , NH2, N3, etc.) can be located in the side chains of a linear or branched polymer hydrogel material. As noted, one example of a branched polymer hydrogel is a dendron, and in one example, the primer grafted functional groups are located in each of the arms of the dendron. These functional groups can be introduced as part of the monomers used in the copolymerization. To control the number of primer anchoring points, the monomers with functional groups can be increased or decreased. These functional groups can also be introduced after the copolymerization.

[0146] In other examples, the particle core 24 is a multilayer particle that includes a core material coated with any example of a polymer hydrogel disclosed herein. In these examples, the core material is generally rigid and insoluble in aqueous liquids. Examples of suitable core materials include magnetic materials (e.g., magnetic FeO x , silica-coated FeO x ), plastics (e.g., polytetrafluoroethylene (PTFE), some polyacrylics, polypropylene, polyethylene, polybutylene, polyurethane, polystyrene and other styrene copolymers, nylon (i.e., polyamide), etc.), polycaprolactone (PCL), nitrocellulose, silica (SiO2), silica-based materials (e.g., functionalized SiO2), carbon or metal. In these examples, the polymer hydrogel coats the core material. The thickness of the polymer hydrogel on the core material ranges from about 10 nm to about 200 nm.

[0147] As mentioned, the grafted particles used to generate the pre-clustered particles 22 include a primer set attached to the core particle 24. In this example, the primer set includes two different primers for sequential paired-end sequencing. In sequential paired-end sequencing, the corresponding forward strands generated are sequenced and removed, and then the corresponding reverse strands generated are sequenced and removed.

[0148] As an example, the primer set may include a P5 primer and a P7 primer, a P15 primer and a P7 primer, or any combination of PA primers, PB primers, PC primers, and PD primers described herein. As an example, the primer set may include any two PA, PB, PC, and PD primers, or any combination of a PA primer and a PB, PC, or PD primer, or any combination of a PB primer and a PC or PD primer, or any combination of a PC primer and a PD primer. Examples of P5 primers and P7 primers are used on the surface of commercial flow cells sold by Illumina Inc., for example, in HISEQ TM HISEQX TM MISEQ TM MISEQDX TM MINISEQ TM 、NEXTSEQ TM 、NEXTSEQDX TM 、NOVASEQ TM 、ISEQ TM 、GENOME ANALYZER TM The P5 and P7 primers have universal sequences for seeding and / or amplification purposes.

[0149] The P5 primers are:

[0150] P5:5'→3'

[0151] AATGATACGGCGACCACCGAGAUCTACAC(SEQ.ID.NO.1)

[0152] The P7 primer can be any of the following:

[0153] P7#1: 5' → 3'

[0154] CAAGCAGAAGACGGCATACGAnAT(SEQ.ID.NO.2)

[0155] P7#2: 5' → 3'

[0156] CAAGCAGAAGACGGCATACnAGAT(SEQ.ID.NO.3)

[0157] P7#3: 5' → 3'

[0158] CAAGCAGAAGACGGCATACnAnAT(SEQ.ID.NO.4)

[0159] where "n" is the number of 8-oxoguanines in each sequence.

[0160] P15 cycle:

[0161] P15:5'→3

[0162] AATGATACGGCGACCACCGAGAnCTACAC(SEQ.ID.NO.5)

[0163] The “n” type is 🺺-T.

[0164] Promotion of the People's Republic of China (PA-PD):

[0165] PA 5'→3

[0166] GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG(SEQ.ID.NO.6)

[0167] cPA(PA')5'→3'

[0168] CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC(SEQ.ID.NO.7)

[0169] PB 5'→3'

[0170] CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT(SEQ.ID.NO.8)

[0171] cPB(PB')5'→3'

[0172] AGTTCATATCCACCGAAGCGCCATGGCAGACGACG(SEQ.ID.NO.9)

[0173] PC 5'→3'

[0174] ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT(SEQ.ID.NO.10)

[0175] cPC(PC')5'→3'

[0176] AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT(SEQ.ID.NO.11)

[0177] PD 5'→3'

[0178] GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC(SEQ.ID.NO.12)

[0179] cPD(PD')5'→3'

[0180] GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC(SEQ.ID.NO.13)

[0181] Although not shown in the exemplary sequence of PA-PD, it is understood that any of these primers may include a cleavage site at any point in the chain, such as uracil, 8-oxoguanine, allyl-T, diol, etc.

[0182] It should be understood that the cleavage sites of the primers in the primer set of the grafted particle are orthogonal to each other (i.e., one cleavage site is insensitive to the cleavage agent used for the other cleavage site) so that after amplification, either the forward strand or the reverse strand can be cleaved, leaving the other of the reverse strand or the forward strand for sequencing.

[0183] Each of the primers disclosed herein may also include a polyT sequence at the 5' end of the primer sequence. In some examples, the polyT region includes 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7 or 10 T bases.

[0184] The 5' end of each primer may also include a linker. Any linker comprising a terminal alkyne group or another suitable terminal functional group that can be attached to a surface functional group of the polymer hydrogel (of the particle core 24) may be used. In one example, the primer is 5' terminated with a hexynyl group.

[0185] Immobilization of the primer can be achieved by covalent attachment at a single point at the 5' end of the primer. In this example, the attachment will depend in part on the functional groups of the polymer hydrogel of the particle core 24. Examples of end-capped primers that can be used include alkyne-terminated primers, tetrazine-terminated primers, azide-terminated primers, amino-terminated primers, epoxy- or glycidyl-terminated primers, phosphorothioate-terminated primers, thiol-terminated primers, aldehyde-terminated primers, hydrazine-terminated primers, phosphoramidite-terminated primers, and triazolinedione-terminated primers. In some specific examples, a succinimide (NHS) ester-terminated primer may react with an amine of a polymer hydrogel, an aldehyde-terminated primer may react with a hydrazine of a polymer hydrogel, or an alkyne-terminated primer may react with an azide of a polymer hydrogel, or an azide-terminated primer may react with an alkyne or DBCO (dibenzocyclooctyne) or bicyclononyne (BCN) of a polymer hydrogel, or an amino-terminated primer may react with an activated carboxylic acid group or NHS ester of a polymer hydrogel, or a thiol-terminated primer may react with an alkylating reactant (e.g., iodoacetamide or maleimide) of a polymer hydrogel, or a phosphoramidite-terminated primer may react with a thioether of a polymer hydrogel. Although several examples have been provided, it should be understood that any functional group that can be attached to a primer and can be attached to a functional group of a polymer hydrogel can be used.

[0186] The grafted particles disclosed herein are used in a flow-through cell amplification process to produce amplicons 26 (ie, template nucleic acid strands) attached to particle cores 24. This forms pre-clustered particles 22, which can be used to include Figure 2A In the first exemplary flow cell 10 of the patterned structure 14 .

[0187] At the beginning of the formation of amplicon 26, a library template can be prepared from any nucleic acid sample (e.g., a DNA sample or an RNA sample). DNA nucleic acid samples can be fragmented into single-stranded, similar-sized (e.g., <1000bp) DNA fragments. RNA nucleic acid samples can be used to synthesize complementary DNA (cDNA), and cDNA can be fragmented into single-stranded, similar-sized (e.g., <1000bp) cDNA fragments. During preparation, a joint can be added to the end of any fragment. By reducing cyclic amplification, different motifs can be introduced in the adapter, such as sequencing primer binding sites, indexes, and regions complementary to primers on grafted particles. In some examples, fragments from a single nucleic acid sample have the same joint added thereto. The final library template includes a DNA or cDNA fragment and joints at both ends. The DNA or cDNA fragment represents the portion to be sequenced of the final library template.

[0188] A plurality of library templates can be introduced into a suspension comprising a liquid carrier and grafted particles. Examples of liquid carriers include water or buffers (e.g., Tris-HCl buffer or 0.5× sodium citrate saline (SSC) buffer). Surfactants / dispersants such as sodium dodecyl sulfate (SDS), (CTAB) can also be included.

[0189] Within the suspension, one or more library templates hybridize to, for example, one of two types of primers in a primer set immobilized to the grafted particle.

[0190] Amplification of the template nucleic acid strands on the grafted particles can be initiated to form clusters of template strands (i.e., amplicons 26) across the particle surface. This produces pre-clustered particles 22 ( Figure 2B ). In one example, amplification involves cluster generation. In one example of cluster generation, a high-fidelity DNA polymerase is used to copy the library template from the hybridized primer by 3' extension. The original library template is denatured, thereby fixing the copy around the grafted particle. Isothermal bridge amplification or some other form of amplification can be used to amplify the fixed copy. For example, the copied template loops back to hybridize with an adjacent complementary primer, and the polymerase copies the copied template to form a double-stranded bridge, denaturing these double-stranded bridges to form two single strands. These two chains loop back and hybridize with adjacent complementary primers, and extend again to form two new double-stranded loops. The process is repeated for each template copy through isothermal denaturation and amplification cycles, thereby generating dense clonal clusters on the grafted particles. Each cluster of double-stranded bridges is denatured. In one example, the antisense strand is removed by specific base cutting, leaving the forward template strand. Clustering results in the formation of pre-clustered particles 22, which include several template strands / amplicons 26 fixed on the particle core 24. This example of clustering is called bridge amplification and is an example of an executable amplification. It will be appreciated that other amplification techniques may be used, such as exclusion amplification.

[0191] The pre-clustered particles 22 may be washed to remove unreacted library templates, etc., and suspended in a fresh liquid carrier to form a pre-clustered particle solution. Any of the examples of liquid carriers may be used.

[0192] An exemplary method involves introducing a pre-clustered particle solution into a flow cell 10 comprising a patterned structure 14; allowing the pre-clustered particle solution to incubate in the flow cell 10, whereby the pre-clustered particles 22 settle into the recesses 20; exposing the reversibly swellable resin 18 to a stimulus, thereby causing the first opening size D1 to decrease to the second opening size D2 and trapping the pre-clustered particles 22 in the recesses 20; washing out untrapped pre-clustered particles 22; and maintaining stimulus exposure at least until an analysis involving the trapped pre-clustered particles 22 is performed.

[0193] The pre-clustered particles 22 can be used to sequence the flow cell 10 including the patterned structure 14. After off-plate amplification and cluster generation, the pre-clustered particle solution is introduced into the flow cell 10. The solution can be allowed to incubate in the flow cell 10 for a predetermined time to allow the pre-clustered particles 22 to settle into the recesses 20, respectively. In one example, the incubation period can be in the range of about 0.1 seconds to about 30 minutes.

[0194] During or after the incubation period, the reversibly swellable resin 18 may be exposed to a stimulus that causes the resin to swell, thereby reducing the first opening size D1 to the second opening size D2 and trapping the corresponding pre-clustered particles 22 in at least some of the recesses in the recesses 20. The stimulus is selected from a group consisting of a predetermined liquid or a liquid having a predetermined pH. Examples of predetermined liquids for swelling the resin 18 include water, alcohols (e.g., methanol, ethanol, propanol, ethylene glycol, propylene glycol, etc.) or ionic liquids. The predetermined pH that can be used as a stimulus for swelling the resin 18 may be in the range of about 4 to about 12. The liquid with the desired pH may be a buffer, such as KPi, any phosphate buffer, or any other buffer having a pH suitable for triggering a reversibly swellable resin response. Salts (NaCl, KCI, etc.) may be added to further increase the ionic strength of the buffer.

[0195] After incubation, a wash cycle may be performed to remove any unentrapped pre-clustered particles 22 and the liquid carrier of the suspension.

[0196] Sequencing primers can then be introduced into the flow cell 10. The sequencing primers hybridize to complementary portions of the sequence of the amplicons 26 attached to the pre-clustered particles 22, which are now trapped in the wells 20. These sequencing primers prepare the amplicons 26 for sequencing.

[0197] The spike-in mixture containing the labeled nucleotides can then be introduced into the flow cell 10 via the input port. In addition to the labeled nucleotides, the spike-in mixture can also include water, a buffer, and a polymerase capable of incorporating nucleotides. When the spike-in mixture is introduced into the flow cell 10, the mixture enters the flow channel 12 and contacts the captured pre-clustered particles 22 that are ready for sequencing.

[0198] The incorporation mixture is allowed to incubate in the flow cell 20, and the labeled nucleotides (including the optical label) are incorporated into nascent chains along the amplicons 26 on each of the pre-clustered particles 22 by the corresponding polymerase. During incorporation, one of the labeled nucleotides is incorporated into a nascent chain that extends a sequencing primer and is complementary to one of the amplicons 26 by the corresponding polymerase. The incorporation occurs in a template strand-dependent manner, and thus detection of the order and type of labeled nucleotides added to the nascent chain can be used to determine the sequence of the amplicon 26. Incorporation occurs in at least some of the amplicons 26 of the pre-clustered particles 22 during a single sequencing cycle.

[0199] Due to the presence of the 3'OH capping group, the incorporated labeled nucleotides may include a reversible termination property that terminates further sequencing primer extension once the labeled nucleotides are added. After the desired time of incubation and incorporation, the incorporation mixture including unincorporated labeled nucleotides may be removed from the circulation pool 10 during a wash cycle. The wash cycle may involve a flow-through technique in which a wash solution (e.g., a buffer) is directed into, through, and subsequently out of the flow channel 12 (e.g., by a pump or other suitable mechanism).

[0200] In the absence of further incorporation, the most recently incorporated labeled nucleotide can be detected by an imaging event.

[0201] During an imaging event, the illumination system can provide excitation light to the flow cell 10. The optical labels of the incorporated labeled nucleotides emit light signals in response to the excitation light.

[0202] After imaging is performed, a cleavage mixture may then be introduced into the flow cell 10. In an example, the cleavage mixture is capable of i) removing the 3'OH capping group from the incorporated nucleotide and ii) cleaving the optical label from the incorporated nucleotide. Examples of 3'OH blocking groups and suitable deblocking agents / components in the cleavage mixture may include: ester moieties that can be removed by alkaline hydrolysis; allyl moieties that can be removed by Nal, trimethylsilyl chloride and Na2S2O3 or by acetone / water solution of Hg(II); azidomethyl groups that can be cleaved by phosphines such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP); acetals that can be cleaved by acidic conditions, such as tert-butoxy-ethoxy; MOM (—CH2OCH3) moieties that can be cleaved by LiBF4 and CH3CN / H2O; 2,4-dinitrobenzenesulfenyl groups that can be cleaved by nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ethers that can be cleaved by Ag(I) or Hg(II); and 3' phosphates that can be cleaved by phosphatases (e.g., polynucleotide kinases). Examples of suitable optical labeling cleaving agents / components in the cleavage mixture may include: sodium periodate, which can cleave vicinal diols; phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP), which can cleave azidomethyl bonds; palladium and THP, which can cleave allyl groups; bases, which can cleave ester moieties; or any other suitable cleaving agent.

[0203] Additional sequencing cycles can then be performed until amplicon 26 is sequenced.

[0204] Throughout the analysis process (e.g., all sequencing cycles), the stimulus is applied so that the reversibly swellable resin 18 remains in a swollen state, so that the opening size remains at a narrower or smaller position. As an example, when water is the stimulus, the wash fluid, the sequencing primer fluid, the spiked mixture, and the lysis mixture may each contain water, so that the reversibly swellable resin 18 is always exposed to the aqueous stimulus. As another example, when pH is the stimulus, the pH of the wash fluid, the pH of the sequencing primer fluid, the pH of the spiked mixture, and the pH of the lysis mixture may each be a suitable pH, so that the reversibly swellable resin 18 is always exposed to the pH stimulus.

[0205] After analysis, the stimulus may be removed or an orthogonal stimulus may be applied to deswell and thereby shrink the reversibly swellable resin 18. Removal of the stimulus or application of the orthogonal stimulus causes the reversibly swellable resin 18 to return to a non-swollen state, wherein the recess 20 has a first (larger) opening size D1. In other words, removal of the stimulus or application of the orthogonal stimulus after analysis causes the reversibly swellable resin 18 to shrink, causing the second opening size D2 to increase to the first opening size D1. This releases the now sequenced particles, allowing them to be washed out of the flow cell 10. This example of a flow cell can be used again for fresh pre-clustered particles 22.

[0206] In another specific example of the method, the stimulus is a liquid having a predetermined pH; the reversibly swellable resin 18 is exposed to the stimulus when the pre-clustered particle solution is introduced into the flow cell 10; and maintaining the stimulus exposure involves introducing at least one aqueous reagent having a predetermined pH during analysis.

[0207] Second Exemplary Flow Cell and Method

[0208] The patterned structure 14' in the second example of the flow cell 10 includes: a base carrier 16; a reversibly swellable resin 18 located above the base carrier 16; a recessed portion 20 defined in the reversibly swellable resin 18, the recessed portion 20 having a first opening size D1 ( Figure 3A ), and has a second opening size D2 ( D1 ) smaller than the first opening size D1 when the reversibly swellable resin 18 is in a swollen state. Figure 3B ); a polymer hydrogel 30 attached to the reversibly swellable resin 18 in each of the recessed portions 20; and a single primer group (including primers 32A, 32B) grafted to the polymer hydrogel 30.

[0209] In the patterned structure 14 ′, the base carrier 16 can be any of the examples described herein.

[0210] Any of the examples of resin compositions disclosed herein can be used in this example, the resin composition forming a reversibly swellable resin 18 that swells at a predetermined pH when exposed to water, alcohols, ionic liquids, or another liquid. The resin composition is deposited on a base carrier 16 and patterned to form a reversibly swellable resin 18 having a recessed portion 20 defined therein. Figure 2A and Figure 2B The formation of the cured and patterned reversibly swellable resin 18 is completed.

[0211] In this example of patterned structure 14', any example of polymer hydrogel 30 may be deposited on reversibly swellable resin 18, including in recesses 20 and on interstitial regions 28. It should be understood that any example of polymer hydrogel described herein for pre-clustered particles 22 may be used in patterned structure 14'.

[0212] In order to introduce the polymer hydrogel 30 into the recessed portion 20, a mixture of the polymer hydrogel 30 may be produced and then applied to the reversibly swellable resin 18. In one example, any example of the polymer hydrogel 30 disclosed herein may be present in a mixture (e.g., a mixture with water or a mixture with ethanol and water). The mixture may then be applied to the surface of the reversibly swellable resin 18 using spin coating or dipping or dip coating or a material flow under positive or negative pressure or another suitable technique. These types of techniques blanket deposit the polymer hydrogel 30 in the recessed portion 20 and on the gap region 28. Other selective deposition techniques (e.g., involving masks, controlled printing techniques, etc.) may be used to specifically deposit the polymer hydrogel 30 in the recessed portion 20 rather than on the gap region 28.

[0213] In some examples, the reversibly swellable resin 18 may include functional groups that can be covalently or non-covalently attached to the polymer hydrogel 30. As an example, the azide of the polymer hydrogel 30 may react with the alkyne or DBCO (dibenzocyclooctyne) or bicyclononyne (BCN) of the reversibly swellable resin 18, and the amino group of the reversibly swellable resin 18 may react with the activated carboxylate group or N-hydroxysuccinimide (NHS) ester of the polymer hydrogel 30. The aldehyde of the polymer hydrogel 30 may react with the aldehyde of the reversibly swellable resin 18.

[0214] Alternatively, the surface of the reversibly swellable resin 18 (including the recessed portion 20) may be activated, and then the mixture (including the polymer hydrogel 30) may be applied thereto. In one example, a silane or silane derivative (e.g., norbornene silane) may be deposited on the surface of the reversibly swellable resin 18 using vapor deposition, spin coating, or other deposition methods. In another example, the surface of the reversibly swellable resin 18 may be exposed to plasma ashing to produce a surfactant (e.g., -OH group) that can attach to the polymer hydrogel 30. In other examples, ashing followed by silanization is used to activate the reversibly swellable resin 18.

[0215] The applied mixture may be exposed to a curing process depending on the chemistry of the polymer hydrogel 30. In an example, curing may be performed at a temperature ranging from room temperature (eg, about 25°C) to about 95°C for a time ranging from about 1 millisecond to about several days.

[0216] When a blanket deposition technique is used, polishing may then be performed to remove the polymer hydrogel 30 from the interstitial regions 28 while leaving the polymer hydrogel 30 on the surface in the recesses 20 at least substantially intact.

[0217] The polishing process may be performed with a chemical slurry (including, for example, an abrasive, a buffer, a chelating agent, a surfactant, and / or a dispersant) that can remove the polymer hydrogel 30 from the interstitial regions 28 without adversely affecting the underlying reversibly swellable resin 18 at these regions 28. Alternatively, polishing may be performed using a solution that does not include abrasive particles.

[0218] The chemical slurry can be used in a chemical mechanical polishing system to polish the surface of the gap region 28. The polishing head / polishing pad or other polishing tool is capable of polishing the polymer hydrogel 30 that may be present above the gap region 28 while leaving the polymer hydrogel 30 at least substantially intact in the recessed portion 20. As an example, the polishing head can be a Strasbaugh ViPRR II polishing head.

[0219] Cleaning and drying processes may be performed after polishing. The cleaning process may utilize a water bath and ultrasonic treatment. The water bath may be maintained at a relatively low temperature in the range of about 22° C. to about 30° C. The drying process may include spin drying, or drying by another suitable technique.

[0220] In the example of the patterned structure 14', a primer set is grafted to the polymer hydrogel 30. The primer set includes two different primers 32A, 32B for sequential paired end sequencing. Primers 32A, 32B can be referenced herein. Figure 2A and Figure 2B Any of the examples described, such as P5 and P7 primers, P15 and P7 primers, or any combination of PA primers, PB primers, PC primers, and PD primers.

[0221] Primers 32A, 32B may be grafted to polymer hydrogel 30 before or after polymer hydrogel 30 is introduced into recess 20. Grafting may be accomplished by flow-through deposition (e.g., using a temporary or permanently bonded cap), bubble coating, spray coating, whipping dispensing, or by another suitable method. Each of these exemplary techniques may utilize a primer solution or mixture that may include primers 32A, 32B, water, a buffer, and a catalyst. Using any of the grafting methods, primers 32A, 32B are attached to the reactive groups of polymer hydrogel 30 and do not react with gap region 28.

[0222] Figure 3A The patterned structure 14 shown may be used as an opening wafer, or may be bonded to a second patterned structure 14 or a cover (not shown) to form a wafer with a plurality of openings in each flow channel 12. Figure 3A The architecture of the flow cell is represented.

[0223] In this exemplary flow cell 10, amplicons are generated within the recess 20 ( Figure 3A or Figure 3B ), and subsequently analyzed (e.g., sequenced). In this example, the reversibly swellable resin 18 is used to minimize or prevent the incidence of multiple seeding events occurring in a single well 20, thereby reducing or eliminating polyclonality (i.e., seeding and amplifying two or more different template strands within a single well 20).

[0224] An exemplary method involves introducing a predetermined liquid into a flow cell 10 including a patterned structure 14'; allowing the predetermined liquid to be incubated in the flow cell 10, thereby swelling the reversibly swellable resin 18 so that the first opening size D1 is reduced to the second opening size D2; and while swelling the reversibly swellable resin 18, introducing a template chain solution into the flow cell 10.

[0225] At the beginning of the method, a predetermined liquid is introduced into the circulation cell 10 and allowed to incubate in the circulation cell 10 to induce swelling of the reversibly swellable resin 18. An example of a predetermined liquid is an aqueous solution that includes water alone or as part of a buffer (e.g., Tris-HCl buffer or 0.5× sodium citrate saline (SSC) buffer). Other examples of predetermined liquids include alcohols or ionic liquids. Another example is a liquid having a pH in the range of about 4 to about 12. The predetermined liquid acts as a stimulus for swelling the reversibly swellable resin 18 and causes the first opening size D1 to decrease to the second opening size D2. In one example, the predetermined liquid can be allowed to incubate for a period of time in the range of about 5 seconds to about 5 minutes before the template chain solution is introduced into the circulation cell.

[0226] The template strand solution includes the library template dispersed in the liquid carrier.Any example of the liquid carrier described herein can be used in the template strand solution.The template strand (library template) present in the template strand solution can be prepared from any nucleic acid sample (e.g., DNA sample or RNA sample) as described herein.

[0227] Introduce the template strand solution into the flow cell. Figure 3B As depicted, the template strand hybridizes with one of the two types of primers 32A, 32B immobilized in the recess 20. The inoculated template strand is Figure 3B The narrower opening of the well 20 and the amplification rate help reduce the incidence of more than one template strand 33 , 33 ′ hybridizing (ie, seeding) within a single well 20 .

[0228] Amplification of the template nucleic acid strands 33, 33' seeded in the recess 20 can be initiated to form corresponding clusters of the template strands 33, 33' seeded across the recess 20. In one example, amplification involves cluster generation. In one example of cluster generation, a high-fidelity DNA polymerase is used to replicate the seeded library templates 33, 33' from the hybridization primers by 3' extension. The initial seeded library templates 33, 33' are denatured, retaining the copies fixed in the recess 20. Isothermal bridge amplification or some other form of amplification can be used to amplify the fixed copies. For example, the replicated template loops back to hybridize with adjacent complementary primers, and the polymerase replicates the replicated template to form double-stranded bridges, denaturing these double-stranded bridges to form two single strands. These two chains loop back and hybridize with adjacent complementary primers, and extend again to form two new double-stranded loops. The process is repeated for each template copy by isothermal denaturation and amplification cycles, thereby generating dense clonal clusters on the functionalized particles. Each cluster of double-stranded bridges is denatured. In one example, the antisense strand is removed by specific base cleavage, leaving the forward template strand. Clustering primarily results in the formation of clusters of specific template strands 33, 33', which include several template strand copies / amplicons fixed in corresponding recesses 20. This example of clustering is called bridge amplification and is an example of an amplification that can be performed. It should be understood that other amplification techniques, such as exclusion amplification, can be used.

[0229] The flow cell 10 may be washed to remove unreacted library template. Figure 2B Sequencing analysis was performed as described.

[0230] Throughout this method, it should be understood that the template strand solution, wash fluids, and sequencing reagents (e.g., sequencing primer fluids, spike-in mixture, and cleavage mixture) maintain aqueous conditions within the flow cell 10 and thus keep the reversibly swellable resin 18 in a swollen state throughout the analysis.

[0231] After analysis, the aqueous fluid and thus the stimulus may be removed to deswell and thus shrink the reversibly swellable resin 18 .

[0232] Although in Figure 3A and Figure 3B In the example of FIG. 1 , the polymer hydrogel 30 is shown, but it should be understood that if the reversibly swellable resin 18 includes surface functional groups that can be directly attached to the 5' ends of the primers 32A, 32B, the patterned structure 14' may not include the polymer hydrogel 30. In this particular example, the gap regions 28 can be masked during primer grafting so that they remain free of primers 32A, 32B. This example can achieve smaller recesses and brighter signals.

[0233] Third exemplary flow cell and method

[0234] 4A to 4D Shown for manufacturing Figure 4D Another example of a method for forming a patterned structure 14" is shown. The patterned structure 14" can be used in a third example of a flow cell 10, which includes: a base carrier 16; a reversibly swellable resin 18 located above the base carrier 16; a multi-depth recessed portion 20' defined in the reversibly swellable resin 18, wherein the multi-depth recessed portion 20' includes a deep portion 52 and a shallow portion 54 adjacent to the deep portion 52, and wherein the deep portion 52 has a first opening size D1 ( Figure 4A ), and has a second opening size D2 ( D1 ) smaller than the first opening size D1 when the reversibly swellable resin 18 is in a swollen state. Figure 4B ); a grafted particle 50 defined within the deep portion 52, the grafted particle 50 having a first primer group grafted to the core particle 24 (including as FIG. 5A to FIG. 5D and a pre-grafted polymer 56 on a surface 58 at a shallow portion 54, the pre-grafted polymer 56 having a second primer group (including as shown) orthogonal to the first primer group and grafted to the polymer hydrogel 30 FIG. 5A to FIG. 5D Primers 38, 40 or 38', 40') as shown.

[0235] In the patterned structure 14 ″, the base carrier 16 can be any of the examples described herein.

[0236] Any of the examples of resin compositions disclosed herein may be used in this example, the resin composition forming a reversibly swellable resin 18 that swells when exposed to water. The resin composition is deposited on a base carrier 16 and patterned to form a reversibly swellable resin 18 having multi-depth recesses 20' defined therein. The formation of the cured and patterned reversibly swellable resin 18 may be as described with reference to Figure 2A and Figure 2B This is accomplished as described above, except that the embossing device has a negative replica of the multi-depth recess 20'.

[0237] For each multi-depth recessed portion 20', it should be understood that the depth of the deep portion 52 and the depth of the shallow portion 54 are each within the ranges provided for the recessed portion 20, provided that the depth of the deep portion 52 is greater than the depth of the shallow portion 54. It should be understood that the height of the inner wall 60 will vary according to the different depths of the deep portion 52 and the shallow portion 54.

[0238] The exemplary flow cell 10 is used with the grafted particles 50 and the pre-grafted polymer 56 and will now be referred to FIG. 5A to FIG. 5DDescribe its example. Grafted particle 50 includes a first primer set and pre-grafted polymer 56 includes a second primer set, and the first primer set and the second primer set enable paired end sequencing to be performed simultaneously. As will be described in more detail below, the primer set can be controlled so that the cleavage (linearization) chemical substances of the primers of the grafted particle 50 are orthogonal to the primers of the pre-grafted polymer 56. In these examples, the orthogonal cleavage chemical composition can be achieved by attaching to the same cleavage site of different primers in different groups or by attaching to different cleavage sites of different primers in different groups. This enables, for example, clusters of forward chains to be generated on particle 50, and clusters of reverse chains to be generated on polymer 56. Particle 50 and polymer 56 are different parts of the multi-depth recess 20', and the forward chain and reverse chain thus generated are spatially independent, which separates the fluorescent signal from the two readings while allowing base recognition to be performed simultaneously for each reading.

[0239] The primer set attached to grafted particles 50A, 50B, 50C and 50D includes a non-cleavable first primer 34 or 34' and a cleavable second primer 36 or 36'; and the primer set attached to pre-grafted polymers 56A, 56B, 56C and 56D includes a non-cleavable first primer 38 or 38' and a cleavable second primer 40 or 40'.

[0240] The non-cleavable first primer 34 or 34' and the cleavable second primer 36 or 36' are an oligonucleotide pair, for example, wherein the non-cleavable first primer 34 or 34' is a forward amplification primer and the cleavable second primer 36 or 36' is a reverse amplification primer, or wherein the cleavable second primer 36 or 36' is a forward amplification primer and the non-cleavable first primer 34 or 34' is a reverse amplification primer. In each example of the primer set attached to the grafted particles 50A, 50B, 50C and 50D, the cleavable second primer 36 or 36' includes a cleavage site 42, while the non-cleavable first primer 34 or 34' does not include a cleavage site 42.

[0241] The cleavable first primer 38 or 38' and the non-cleavable second primer 40 or 40' are also oligonucleotide pairs, for example, wherein the cleavable first primer 38 or 38' is a forward amplification primer and the non-cleavable second primer 40 or 40' is a reverse amplification primer, or wherein the non-cleavable second primer 40 or 40' is a forward amplification primer and the cleavable first primer 38 or 38' is a reverse amplification primer. In each example of the primer set attached to the pre-grafted polymer 56A, 56B, 56C and 56D, the cleavable first primer 38 or 38' includes a cleavage site 42' or 44, while the non-cleavable second primer 40 or 40' does not include a cleavage site 42' or 44.

[0242] It should be understood that the non-cleavable first primer 34 or 34' of the primer set attached to the grafted particles 50A, 50B, 50C and 50D and the cleavable first primer 38 or 38' of the primer set attached to the pre-grafted polymers 56A, 56B, 56C and 56D have the same nucleotide sequence (e.g., both are forward amplification primers), except that the cleavable first primer 38 or 38' includes a cleavage site 42' or 44 integrated into the nucleotide sequence or integrated into a linker 46' attached to the nucleotide sequence. Similarly, the cleavable second primer 36 or 36' of the primer set attached to the grafted particles 50A, 50B, 50C and 50D and the non-cleavable second primer 40 or 40' of the primer set attached to the pre-grafted polymers 56A, 56B, 56C and 56D have the same nucleotide sequence (e.g., both are reverse amplification primers), except that the cleavable second primer 36 or 36' includes a cleavage site 42 integrated into the nucleotide sequence or integrated into a linker 46 attached to the nucleotide sequence.

[0243] It should be understood that when the first primers 34 and 38 or 34' and 38' are forward amplification primers, the second primers 36 and 40 or 36' and 40' are reverse primers, and vice versa.

[0244] The non-cleavable primers 34, 40 or 34', 40' can be any primers with a universal sequence for capture and / or amplification purposes, such as P5 primers or P15 primers and P7 primers or any combination of PA primers, PB primers, PC primers, PD primers (e.g., PA and PB, or PA and PD, etc.), provided that uracil, 8-oxoguanine or other cleavage sites are not included in the sequence. These primers 34, 40 or 34', 40' are non-cleavable primers 34, 40 or 34', 40' because they do not include cleavage sites 42, 42', 44.

[0245] Examples of cleavable primers 36, 38 or 36', 38' include P5 primers, P15 primers and P7 primers or other universal sequence primers (e.g., PA primers, PB primers, PC primers, PD primers), wherein the corresponding cleavage sites 42, 42', 44 are incorporated into the corresponding nucleic acid sequence (e.g., Figure 5A 53C), or incorporated into a linker 46', 46 that attaches a cleavable primer 36, 38 or 36', 38' to a core particle 24 or polymer 30 ( Figure 5B and Figure 5D). Examples of suitable cleavage sites 42, 42', 44 include enzymatically cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., linkers between nucleobases), as described herein. Some specific examples of cleavage sites 42, 42', 44 include uracil, 8-oxoguanine, allyl-T. Cleavage sites 42, 42', 44 can be incorporated at any point in the chain.

[0246] An example of a primer set including primers 34, 36 or 34', 36' attached to a particle core 24 described herein, and an example of a primer set including primers 38, 40 or 38', 40' attached to a polymer hydrogel 30 disclosed herein. In this example, the particle core 24 includes a functional group to which the 5' end of the primers 34, 36 or 34', 36' can be attached, and the polymer hydrogel 30 includes a functional group to which the 5' end of the primers 38, 40 or 38', 40' can be attached.

[0247] FIG. 5A to FIG. 5D Different configurations of primer sets attached to particle core 24 and polymer hydrogel 30, respectively, are depicted. More specifically, FIG. 5A to FIG. 5D Depicted are different configurations of primers 34, 36 or 34', 36' and 38, 40 or 38', 40' that may be used.

[0248] exist Figure 5A In the example shown, primers 34, 36 and 38, 40 are attached to the particle core 24 and the polymer hydrogel 30, respectively and directly, e.g., without linkers 46, 46'. The particle core 24 has surface functional groups capable of fixing terminal groups at the 5' ends of the primers 34, 36. Similarly, the polymer hydrogel 30 has surface functional groups capable of fixing terminal groups at the 5' ends of the primers 38, 40. Because the corresponding primers 34, 36 and 38, 40 are pre-grafted (i.e., grafted before the particle 50 or polymer 56 is incorporated into the flow cell 10), the fixing chemistry between the particle core 24 and the primers 34, 36 and the fixing chemistry between the polymer hydrogel 30 and the primers 38, 40 can be the same or different.

[0249] In addition, Figure 5AIn the example shown, the cleavage site 42, 42' of each of the cleavable primers 36, 38 is incorporated into the sequence of the primer. In this example, the same type of cleavage site 42, 42' is used in the cleavable primers 36, 38 of the corresponding primer set. As an example, the cleavage site 42, 42' is a uracil base, and the cleavable primers 36, 38 are P5U and P7U (wherein uracil replaces 8-oxoguanine and is incorporated into any of the P7 sequences described herein). Uracil bases or other cleavage sites can also be incorporated into any of the PA, PB, PC and PD primers to generate cleavable primers 36, 38. In this example, the non-cleavable primer 34 of the oligonucleotide pair 34, 36 can be P7 (no cleavage site, such as SEQ.ID.NOS.2-4, no 8-oxoguanine), and the non-cleavable primer 40 of the oligonucleotide pair 38, 40 can be P5 (no cleavage site, such as SEQ.ID.NO.1, no uracil). Therefore, in this example, the primer set of the grafted particle 50A includes P7, P5U, and the primer set of the pre-grafted polymer 56A includes P5, P7U. The primer sets of the grafted particle 50A and the pre-grafted polymer 56A have opposite linearization chemistries, which, after amplification, cluster generation and linearization, allow the forward template strand to be formed on the particle 50A, and the reverse strand to be formed on the polymer 56A.

[0250] exist Figure 5B In the example shown, primers 34', 36' and 38', 40' are attached to the particle core 24 and the polymer hydrogel 30, respectively, for example, through the linkers 46, 46'. The particle core 24 and the polymer hydrogel 30 include corresponding functional groups, and the ends of the corresponding linkers 46, 46' can be covalently attached to the corresponding functional groups. Therefore, the particle core 24 includes a surface functional group that can fix the linker 46 at the 5' end of the primers 34', 36'. Similarly, the polymer hydrogel 30 includes a surface functional group that can fix the linker 46' at the 5' end of the primers 38', 40'. Because the corresponding primers 34, 36 and 38, 40 are pre-grafted, the fixing chemical between the particle core 24 and the linker 46 and the fixing chemical between the polymer hydrogel 30 and the linker 46' can be the same or different.

[0251] Examples of suitable linkers 46, 46' can include nucleic acid linkers (e.g., 10 nucleotides or less), or non-nucleic acid linkers, such as polyethylene glycol chains, alkyl groups or carbon chains, aliphatic linkers with vicinal diols, peptide linkers, and the like. An example of a nucleic acid linker is a poly-T spacer, but other nucleotides can also be used. In one example, the spacer is a 6T to 10T spacer. The following are some examples of nucleotides, including non-nucleic acid linkers with terminal alkyne groups (where B is a nucleobase and the "oligonucleotide" is a primer):

[0252]

[0253] exist Figure 5B In the example shown, primers 34', 38' have the same sequence (e.g., P5 without uracil bases). Primer 34' is non-cleavable (i.e., does not include any cleavage site), while primer 38' includes a cleavage site 42' incorporated into a linker 46'. Also in this example, primers 36', 40' have the same sequence (e.g., P7 without 8-oxoguanine). Primer 40' is non-cleavable (i.e., does not include any cleavage site), and primer 36' includes a cleavage site 42 incorporated into a linker 46. The same type of cleavage site 42, 42' is used in the linkers 46, 46' of the cleavable primers 36', 38', respectively. As an example, the cleavage sites 42, 42' can be uracil bases incorporated into nucleic acid linkers 46, 46'. The primer sets for particle 50B and polymer 56B have opposite linearization chemistries, which, after amplification, clustering, and linearization, allow the formation of the forward template strand on particle 50B and the reverse strand on polymer 56B.

[0254] Figure 5C The example shown is similar to Figure 5A In the examples shown, different types of cleavage sites 42, 44 are used in the cleavable primers 36, 38 of the particle 50C and the polymer 56C. For example, two different enzymatic cleavable sites can be used, two different chemical cleavable sites can be used, or one enzymatic cleavable site and one chemical cleavable site can be used. Examples of different cleavage sites 42, 44 that can be used in the respective cleavable primers 36, 38 include any combination of the following: vicinal diols, uracil, allyl ethers, disulfides, restriction enzyme sites, and 8-oxoguanine.

[0255] Figure 5D The example shown is similar to Figure 5B The examples shown, however, differ in that different types of cleavage sites 42, 44 are used in the linkers 46, 46' of the cleavable primers 36', 38' attached to the particle 50C and polymer 56C. Examples of different cleavage sites 42, 44 that can be used in the respective linkers 46, 46' attached to the cleavable primers 36', 38' include any combination of the following: vicinal diols, uracil, allyl ethers, disulfides, restriction enzyme sites, and 8-oxoguanine.

[0256] exist FIG. 5A to FIG. 5DIn any of the examples shown, attachment of primers 34, 36 and 38, 40 or 34', 36' and 38', 40' to particle core 24 and polymer hydrogel 30 leaves the template-specific portions of primers 34, 36 and 38, 40 or 34', 36' and 38', 40' free to anneal to their cognate templates, while the 3' hydroxyl group is free for primer extension.

[0257] Re-reference 4A to 4D , the exemplary method starts with a precursor structure 62, which includes a base carrier 16; and a reversibly swellable resin 18 located above the base carrier 16 and having a multi-depth recess 20' defined therein. The method includes: exposing the precursor structure 62 to a grafted particle solution; allowing the grafted particle solution to incubate in the precursor structure 62, whereby the grafted particles 50 (e.g., 50A, 50B, 50C, 50D) settle into the deep portion 52; introducing a predetermined liquid to swell the reversibly swellable resin 18, so that the first opening size D1 is reduced to the second opening size D2, and the grafted particles 50 are captured in the deep portion 52; washing out the uncaptured grafted particles; and selectively introducing a polymer hydrogel (e.g., a pre-grafted polymer 56) to the surface 58 at the shallow portion 54 of the multi-depth recess 20' while the grafted particles 50 are present in the deep portion 52.

[0258] The grafted particle solution includes any example of grafted particles 50 (e.g., 50A, 50B, 50C, or 50D) disclosed herein dispersed or suspended in a liquid carrier that does not swell the resin 18. The liquid carrier of the grafted particle solution is any organic solvent to which the grafted particles are inert. In this example, the grafted particle solution is a source of grafted particles 50.

[0259] Once the grafted particle solution and the precursor structure 62 are placed in contact with each other, the grafted particle solution is allowed to incubate. In one example, the grafted particle solution can be allowed to incubate for a period of time in the range of about 5 seconds to about 5 minutes. During the incubation period, at least some of the grafted particles 50 settle into the deep portions 52 of at least some of the multi-depth recesses 20'.

[0260] Then, a predetermined liquid such as water, alcohol, ionic liquid or a buffer having a suitable pH is introduced. During this incubation, the reversibly swellable resin 18 swells, causing the first opening size D1 of the deep portion 52 to decrease to the second opening size D2. The swollen resin 18 captures the grafted particles 50 that have settled in the deep portion 52.

[0261] It should be understood that the overall opening size of the multi-depth recess 20' may also be narrowed due to swelling. However, because the opening of the multi-depth recess 20' extends over both the deep portion 52 and the shallow portion 54, any grafted particles 50 covering the particles 50 trapped in the deep portion 52 or covering the shallow portion 54 may be removed during a wash cycle. In other words, the diameter of the grafted particles 50 is smaller than the narrow opening of the multi-depth recess 20', and therefore these particles 50 may be removed. Therefore, a wash cycle may be performed to remove untrapped grafted particles 50 from the precursor structure 62. The structure is Figure 4B Shown in.

[0262] like Figure 4C As shown, the method then includes selectively introducing a pre-grafted polymer 56 to the surface 58 at the shallow portion 54 of the multi-depth recess 20', while the grafted particles 50 are trapped in the deep portion 52. In this example, any example of the pre-grafted polymer 56 (e.g., 56A, 56B, 56C, 56D) can be applied under high ionic strength conditions (e.g., in the presence of 10×PBS, NaCl, KCl, etc.) using any suitable deposition technique. A curing process as described herein can be performed after deposition. When the deposition of the pre-grafted polymer 56 is performed under high ionic strength, the pre-grafted polymer 56 will not be deposited or attached to the grafted particles 50. Therefore, the pre-grafted polymer 56 will not contaminate the grafted particles 50.

[0263] The pre-grafted polymer 56 can then be removed from the gap regions 28 using an example of a polishing process described herein. The resulting patterned structure 14" is Figure 4D In some cases, polishing may be performed to remove at least some of the pre-grafted polymer 56 from the sidewalls of the multi-depth recess 20 ′ without removing it from the surface 58 at the shallow portion 54 . Figure 4D The patterned structure 14" shown can be used in the sequencing operation shown (e.g., as an opening wafer), or it can be bonded to a cover (not shown) to form a patterned structure 14" in each flow channel 12. Figure 4D Flow cell 10 of the illustrated architecture. In this example, patterned structure 14" may be exposed to sufficient aqueous solution or another suitable stimulus during the bonding process to ensure that particles 50 are not released.

[0264] exist 4A to 4D Throughout the method shown, the structure 62, 14" is exposed to an aqueous stimulus or another suitable stimulus to ensure that the resin 18 remains in a swollen state and the grafted particles 50 remain captured.

[0265] Although the pre-grafted polymer 56 (which includes any of 56A, 56B, 56C or 56D) has been described, 4A to 4D, but it will be appreciated that the polymer hydrogel 30 (without the primer 38, 40 or 38', 40' grafted thereto) may be selectively applied to the surface 58 in the shallow portion 54 of the gap region 28 and each porous recess 20' and subsequently polished from the gap region 28. Then, in this example, the primer 38, 40 or 38', 40' is grafted after the polymer hydrogel 30 is applied and polished from the gap region 28. Because the grafted particle 50 is already in place in the deep portion 52, the grafting of the primer 38, 40 or 38', 40' may be performed as long as the following conditions are met: i) the polymer hydrogel 30 has a different functional group (compared to the particle core 24) for attaching the primer 38, 40 or 38', 40', or ii) any unreacted functional group of the particle core 24 has been quenched, for example, by reduction using a Staudinger reaction to produce an amine or by an addition click reaction with a passive molecule such as hexynoic acid.

[0266] The flow cell 10 formed with the patterned structure 14" can be used for simultaneous paired-end sequencing.

[0267] For this analysis, the template strand solution including the library template dispersed in the liquid carrier is introduced into the circulation cell.Any example of the liquid carrier described herein can be used in the template strand solution.The template strand (library template) present in the template strand solution can be prepared from any nucleic acid sample (e.g., DNA sample or RNA sample) as described herein.

[0268] The template strand is hybridized with one of the primers 34, 36, 38, 40 or 34', 36', 38', 40' fixed in the multi-depth recess 20'. Amplification of the seeded template strand in the recess 20' can be initiated to form a seeded template strand cluster spanning both the grafted particle 50 and the (pre) grafted polymer 56. Because the primer sets of the grafted particle 50 and the (pre) grafted polymer 56 include orthogonally cleavable oligonucleotide pairs, amplification can span both the grafted particle 50 and the (pre) grafted polymer 56. In one example, the grafted particle 50 may have an indestructible first template (e.g., forward) strand and a destructible second template (reverse) strand attached thereto, while the (pre) grafted polymer 56 may have a destructible first template (e.g., forward) strand and an indestructible second template (reverse) strand attached thereto. The destructible first template strand and the second template strand can then be removed by introducing a chemical reagent or an enzyme cleavage agent according to the cleavage site 42 and 42' or 44. After cleavage, the uncleavable first template (e.g., forward) strand remains on the particle 50, and the uncleavable second template (e.g., reverse) strand remains on the polymer 56. Thus, one type of template strand (e.g., forward strand) is clustered on the particle 50, and the other type of template strand (e.g., reverse strand) is clustered on the polymer 56. This enables distinguishable read 1 and read 2 signals to be obtained simultaneously.

[0269] Throughout this method, it should be understood that the template strand solution, wash fluids, and sequencing reagents (e.g., sequencing primer fluids, spike-in mixture, and cleavage mixture) maintain aqueous conditions within the flow cell and thus keep the reversibly swellable resin 18 in a swollen state throughout the analysis.

[0270] After analysis, the stimulus may be removed or an orthogonal stimulus may be applied to deswell and thereby shrink the reversibly swellable resin 18. Removal of the stimulus or application of the orthogonal stimulus causes the reversibly swellable resin 18 to return to a non-swollen state, wherein the deep portion 52 of the multi-depth recess 20' has a first (larger) opening size D1. In other words, removal of the stimulus or application of the orthogonal stimulus after analysis causes the reversibly swellable resin 18 to shrink, causing the second opening size D2 to increase to the first opening size D1. This releases the now sequenced particles so that they can be washed out of the flow cell 10. For example, when the polymer 56 includes biotin, the exemplary flow cell 10 can be reused because the streptavidin-bound primers 34, 36, 38, 40 or 34', 36', 38', 40' can be released and replenished.

[0271] In any of the examples disclosed herein, it should be understood that the first opening dimension D1 corresponds to any of the recess dimensions described herein (e.g., opening area, depth, or diameter, or length and width), and the second opening dimension D2 is smaller than the first opening dimension D1. The second opening dimension D2 can vary from one swelling event to another, depending in part on the stimulus used.

[0272] In order to further illustrate the present disclosure, examples are given herein. It should be understood that these examples are provided for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

[0273] Non-limiting working examples

[0274] Example 1

[0275] Examples of reversibly swellable resins were prepared with poly(ethylene glycol) diglycidyl ether, epoxycyclohexylethyl polysilsesquioxane, and glycidyl polysilsesquioxane. The monomers and surface additives were dissolved in a solvent. The resin composition was applied to a glass substrate and imprinted with a working stamp. When the working stamp was in place, the resin composition was UV cured. Several imprinted films were prepared.

[0276] The increased surface energy of the imprinted films was measured by recording the contact angle. The contact angle for each film was about 75°, which was reduced when compared to a similar resin composition prepared without poly(ethylene glycol) diglycidyl ether (contact angle >85°). When exposed to high humidity or water, the imprinted films showed an instantaneous (<1 s) color change, which corresponds to a change in film thickness characteristics.

[0277] Additional Notes

[0278] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (assuming such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms explicitly adopted herein that may also appear in any disclosure incorporated by reference should be given a meaning most consistent with the specific concepts disclosed herein.

[0279] The references to "one example", "another example", "an example", etc. throughout this specification mean that the specific elements (e.g., features, structures, and / or characteristics) described in conjunction with the example are included in at least one example described herein, and may or may not be present in other examples. In addition, it should be understood that the elements used in any example may be combined in various examples in any suitable manner, unless the context clearly indicates otherwise.

[0280] While several examples have been described in detail, it is to be understood that modifications may be made to the disclosed examples. Therefore, the above description should be considered non-limiting.

Claims

1. A circulation cell, comprising: Base carrier; a reversibly swellable resin disposed above the base support, the reversibly swellable resin comprising at least one hydrophilic monomer selected from the group consisting of poly(ethylene glycol)-based monomers, poly(propylene glycol)-based monomers, acid-containing monomers, and combinations thereof; and A recessed portion is defined in the reversibly swellable resin, the recessed portion having a first opening size when the reversibly swellable resin is in a non-swollen state and having a second opening size smaller than the first opening size when the reversibly swellable resin is in a swollen state. 2 . The flow cell according to claim 1 , wherein the reversibly swellable resin comprises 0.5% to 20% of the hydrophilic monomer. 3 . The flow cell according to claim 1 , wherein the reversibly swellable resin comprises at least one epoxy polyhedral oligomeric silsesquioxane monomer copolymerized with the hydrophilic monomer.

4. The flow cell according to one of claims 1 to 3, further comprising a polymer hydrogel covalently attached to the reversibly swellable resin, wherein the reversibly swellable resin comprises at least one additional monomer copolymerized with the hydrophilic monomer, and wherein the at least one additional monomer comprises a functional group covalently attached to the polymer hydrogel.

5. The flow cell of claim 4, wherein the functional group is selected from the group consisting of alkynes, dienes, azides and amines.

6. The flow cell according to one of claims 4 or 5, further comprising a single primer set grafted to the polymer hydrogel.

7. The flow cell according to one of claims 1 to 3, further comprising a polymer hydrogel non-covalently attached to the reversibly swellable resin.

8. The flow cell according to one of claims 1 to 7, wherein the recessed portion is a multi-depth recessed portion including a deep portion and a shallow portion adjacent to the deep portion.

9. The flow cell according to claim 8, further comprising: a grafted particle defined within the deep portion, the grafted particle having a first primer set grafted to a core particle; as well as A pre-grafted polymer located on the surface at the shallow portion has a second primer set orthogonal to the first primer set grafted to the polymer hydrogel.

10. A method comprising: The pre-clustered particle solution is introduced into a flow cell comprising: Base carrier; a reversibly swellable resin disposed above the base support, the reversibly swellable resin comprising at least one hydrophilic monomer selected from the group consisting of poly(ethylene glycol)-based monomers, poly(propylene glycol)-based monomers, and combinations thereof; and a recessed portion defined in the reversibly swellable resin, the recessed portion having a first opening size when the pre-clustered particle solution is introduced; allowing the pre-clustered particle solution to incubate in the flow cell, whereby the pre-clustered particles settle into the recesses; exposing the reversibly swellable resin to a stimulus, thereby causing the first opening size to decrease to a second opening size and trapping the pre-clustered particles in the recesses; washing out untrapped pre-clustered particles; and maintaining stimulus exposure at least until analysis involving the trapped pre-clustered particles is performed; Wherein the stimulus is optionally selected from the group consisting of a predetermined liquid and a liquid having a predetermined pH.

11. The method according to claim 10, wherein: i) the stimulus is the predetermined liquid; The predetermined liquid is water, alcohol or ionic liquid; exposing the reversibly swellable resin to the stimulus occurs when the pre-clustered particle solution is introduced into the flow cell; and Maintaining said stimulus exposure involves introducing at least one aqueous reagent during said analysis; or ii) the stimulus is the liquid having the predetermined pH; exposing the reversibly swellable resin to the stimulus occurs when the pre-clustered particle solution is introduced into the flow cell; and Maintaining the stimulus exposure involves introducing at least one aqueous reagent having the predetermined pH during the assay.

12. The method of one of claims 10 or 11, further comprising removing the stimulus after the analyzing, whereby the reversibly swellable resin shrinks such that the second opening size increases to the first opening size.

13. A method comprising: A predetermined liquid is introduced into a flow cell, the flow cell comprising: Base carrier; a reversibly swellable resin positioned above the base support, the reversibly swellable resin comprising at least one hydrophilic monomer selected from the group consisting of poly(ethylene glycol)-based monomers, poly(propylene glycol)-based monomers, and combinations thereof; a recessed portion defined in the reversibly swellable resin, the recessed portion having a first opening size when the predetermined liquid is introduced; a polymer hydrogel located in the recess; and a single primer set attached to the polymer hydrogel; allowing the predetermined liquid to incubate in the flow cell, whereby the reversibly swellable resin swells, causing the first opening size to decrease to a second opening size; and The template strand solution is introduced into the flow cell while the reversibly swellable resin is swollen.

14. A method comprising: Exposing a precursor structure to a grafting particle solution, the precursor structure comprising: Base carrier; a reversibly swellable resin disposed above the base support, the reversibly swellable resin comprising at least one hydrophilic monomer selected from the group consisting of poly(ethylene glycol)-based monomers, poly(propylene glycol)-based monomers, and combinations thereof; and defining a multi-depth recess in the reversibly swellable resin, the multi-depth recess comprising a deep portion and a shallow portion adjacent to the deep portion, the deep portion having a first opening size when the grafted particle solution is introduced; allowing the grafted particle solution to incubate in the precursor structure, whereby the grafted particles settle into the deep portion; exposing the precursor structure to a predetermined liquid, thereby swelling the reversibly swellable resin, causing the first opening size to decrease to a second opening size, and the grafted particles to be trapped in the deep portion; washing out uncaptured grafted particles; and A polymer hydrogel is selectively introduced to the surface at the shallow portion of the multiple recesses while the grafted particles are present in the deep portion.

15. The method according to claim 14, wherein: The polymer hydrogel is a pre-grafted polymer hydrogel; and The first primer set of the grafted particle is orthogonal to the second primer set of the pre-grafted polymer hydrogel.

16. The method of claim 14, further comprising grafting a first primer set to the selectively introduced polymer hydrogel, wherein the first primer set is orthogonal to a second primer set of the grafted particle.

Images