Method for preparing Guilin traditional chili sauce through lactobacillus fermentation
By selecting advantageous lactic acid bacteria and appropriate emulsifiers during the fermentation process of Guilin chili sauce, and using lactic acid bacteria fermentation method, the problems of poor product quality stability and limited production caused by natural fermentation are solved, and the effects of stable production and fragrance optimization are achieved.
Patent Information
- Application Number
- CN202411782419.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-05
- Publication Date
- 2025-03-18
AI Technical Summary
The existing fermentation and production methods of Guilin chili sauce mainly rely on natural fermentation, resulting in poor product quality stability and limited production.
By selecting the dominant lactic acid bacteria in high-quality traditional Guilin chili sauce, combined with appropriate emulsifiers, the lactic acid bacteria fermentation method is used to accelerate the fermentation process and optimize the product fragrance.
It has achieved stable production of Guilin chili sauce, improved fermentation speed and product fragrance performance, and ensured the stability of product quality.
Smart Images
Figure CN119632217A_ABST
Abstract
Description
Field of the invention:
[0001] The present application belongs to the field of food and fermentation. Specifically, the present application provides a method for preparing traditional Guilin chili sauce by lactic acid bacteria fermentation. Background technology:
[0002] Guilin chili sauce has a unique flavor, fresh and fragrant, spicy and sweet, and is known as the "Three Treasures of Guilin" together with fermented bean curd and Sanhua wine. Guilin chili sauce is not only popular in China, but also exported to many countries in Southeast Asia.
[0003] At present, the fermentation production method of Guilin chili sauce is mainly natural fermentation, and the product quality depends on factors such as natural conditions, equipment and operators, so it is relatively limited in terms of quality stability and production. Designing a fermentation preparation method using pure strains of microorganisms is of great significance for the stable production of Guilin chili sauce. Summary of the invention:
[0004] Through DEEG analysis of high-quality traditional Guilin chili sauce, the applicant selected the dominant lactic acid bacteria and added them to the fermentation raw materials, which effectively accelerated the fermentation process; by adding suitable emulsifiers, the performance of the product in terms of aroma was further optimized.
[0005] In one aspect, the present application provides a method for preparing Guilin traditional chili sauce by lactic acid bacteria fermentation, the method comprising:
[0006] (1) crushing 40-60 parts by weight of red pepper, adding 2-5 parts by weight of salt, mixing evenly, and pickling for one month to obtain pickled red pepper;
[0007] (2) adding 8-11 parts by weight of minced garlic, 7-10 parts by weight of fermented black beans, 7-9 parts by weight of 50-55% Sanhua wine, 2-4 parts by weight of sugar, 3-4 parts by weight of salt, and 0.5-1.5 parts by weight of monosodium glutamate to the pickled red peppers obtained in step (1), mixing well, and then crushing again to obtain a fermentation raw material;
[0008] (3) placing the fermentation raw material obtained in step (2) into a fermentation container, adding 0.2-0.5 parts by weight of an emulsifier, inoculating Lactobacillus acidophilus and Leuconostoc mesenteroides subsp. mesenteroides, mixing evenly, covering, and fermenting under natural conditions for 30-40 days.
[0009] Further, step (1) is: crushing 50 parts by weight of red pepper, adding 3 parts by weight of salt, mixing evenly, and pickling for one month to obtain pickled red pepper;
[0010] Step (2) is: adding 10 parts by weight of minced garlic, 8 parts by weight of fermented black beans, 8 parts by weight of Sanhua wine, 3 parts by weight of white sugar, 3 parts by weight of salt, and 1 part by weight of monosodium glutamate to the pickled red pepper obtained in step (1), mixing well, and then crushing again to obtain a fermentation raw material;
[0011] Furthermore, in step (3), 3×10 Lactobacillus acidophilus were inoculated. 6 CFU / g fermentation raw material and Leuconostoc mesenteroides subsp. mesenteroides 3×10 6 CFU / g fermentation raw material.
[0012] Furthermore, the Lactobacillus acidophilus is the Lactobacillus acidophilus with a CGMCC preservation number of CGMCC No.1.1854, and the Leuconostoc mesenteroides subsp. mesenteroides is the Leuconostoc mesenteroides subsp. mesenteroides with an ATCC number of ATCC 8293.
[0013] Furthermore, 0.3 parts by weight of Tween 20 is added in step (3).
[0014] Furthermore, the alcohol content of the Sanhua wine is 52 degrees.
[0015] Furthermore, the natural conditions in step (3) are conditions with a temperature difference between day and night, and the lowest temperature is not less than 10°C.
[0016] Furthermore, the fermentation container is a glass jar or a clay jar.
[0017] The natural conditions described are the tropical and subtropical natural conditions of Guangxi, with a temperature difference between day and night, but the temperature is generally not lower than 10°C.
[0018] In the embodiment, bacterial liquid is used for inoculation, but in actual use, the bacterial strains can also be prepared in the form of bacterial mud, freeze-dried bacterial powder, etc. for easy use and storage.
[0019] In order to obtain comparable data, this application uses the Red Sun variety of pepper produced in Guangxi. In actual use, red peppers of various origins and varieties can be selected based on spiciness, flavor, yield, etc.
[0020] The claims and examples of this application all use a simplified fermentation method with relatively clear steps and ingredients. In actual use, the method can adjust the amount and brand of each ingredient (for example, when using Sanhua wine of different degrees, the amount can be different), and it does not exclude the use of other available raw materials of Guilin traditional chili sauce, such as various seasonings, oils, preservatives, etc., and the fermentation method and device can be appropriately adjusted (for example, temperature, humidity and other conditions; fermentation utensils such as earthenware jars, tile pots, glass jars, metal cans; sterilization, packaging and other steps). Description of the drawings:
[0021] Figure 1 Some DEEG electrophoresis results;
[0022] Figure 2 The pH value in Example 2 changes with the fermentation days;
[0023] Figure 3 The organic acid content in Example 2 changes with the fermentation days;
[0024] Figure 4 This is a statistical chart of the number of volatile components under different fermentation methods and raw materials. Specific implementation method:
[0025] Example 1 Analysis of bacterial flora in Guilin chili sauce
[0026] Several homemade high-quality Guilin chili sauce products and samples of the corresponding early / mid fermentation stages were selected, and the bacterial DNA in the products was extracted using the Bacterial Genomic DNA Extraction Kit of Biolabs; the 16s rDNA V3 portion was amplified using primer pairs 338 (GC hairpin in the 5' segment) and 518, ACTCCTACGGGAGGCAGCAG (SEQ ID NO.1), ATTACCGCGGCTGCTGG (SEQ ID NO.2); and then the 16s rDNA V3 portion was separated using DEEG (denaturing gradient gel electrophoresis, denaturing gel concentration 20-60%). The results are as follows Figure 1 shown.
[0027] Each band was recovered by gel excision, amplified again using a hairpin-free primer pair, and sent to Nanjing GenScript for sequencing. The sequencing results were blasted in NCBI to find highly homologous microbial species.
[0028] The applicant selected from the dozens of identified microorganisms those species that are applicable to food, present in high abundance in multiple high-quality samples, and run throughout the fermentation process as strains for the next step of pure fermentation.
[0029] The selected bacterial species include Lactobacillus plantarum, Lactobacillus delbruechii subsp. bulgaricus, Lactobacillus acidophilus, and Leuconostoc mesenteroides subsp. mesenteroides.
[0030] Considering the factors of bacterial stability and safety, the applicant chose to purchase Lactobacillus plantarum: CGMCC No.1.12732; Lactobacillus delbruechii subsp.bulgaricus: CGMCC No.1.16075; Lactobacillus acidophilus: CGMCC No.1.1854; Leuconostocmesenteroides subsp.mesenteroides: ATCC 8293. For the sake of brevity, Lactobacillus delbruechii subsp.bulgaricus is referred to as "Lactobacillus delbruechii" and "Leuconostocmesenteroides subsp.mesenteroides" is referred to as "Leuconostocmesenteroides" in some of the following diagrams.
[0031] Example 2 Guilin chili sauce pure strain fermentation experiment
[0032] After the bacteria are activated, culture / adjust to a viable count of about 1×10 8 CFU / mL bacterial solution was used for fermentation.
[0033] The raw materials and processes for processing Guilin chili sauce vary greatly from place to place. For the sake of standardization, the following preparation method is uniformly used in the examples (if not separately stated in the method, the parts are all weight parts; the raw materials used in the example experiments are from the same batch):
[0034] (1) 50 parts of red peppers (produced in Guangxi, Red Sun) are removed from the stems, washed, drained, and crushed; 3 parts of salt are added, mixed evenly, and pickled for one month to obtain pickled red peppers;
[0035] (2) adding 10 parts of minced garlic (Cangshan garlic produced in Shandong), 8 parts of Yangjiang fermented black beans ("Pearl River Bridge Brand"), 8 parts of Sanhua Liquor ("Guilin Brand", 52% alcohol), 3 parts of sugar, 3 parts of salt, and 1 part of monosodium glutamate to the pickled red pepper obtained in step (1), mixing well, and then crushing again to obtain a fermentation raw material;
[0036] (3) The fermentation raw material obtained in step (2) was placed in a glass jar, 3% v / w of bacterial solution (the inoculation amount verified by a preliminary experiment not shown) was added, mixed evenly, covered, and fermented under natural conditions for 60 days.
[0037] pH and total acid determination:
[0038] Use a pH meter and the titration method of GB / T 12456 to measure pH and total acid. The results are as follows: Figure 2 and Figure 3As shown, the results showed that the addition of lactic acid bacteria increased the fermentation speed to a certain extent and could increase the peak of acid production by about 10 days.
[0039] Color determination:
[0040] Samples were taken from three locations on the product surface, and the L value and a value of the samples were detected using a spectrophotometer (Triplex, CR-10). The samples at each location were measured three times, and the average of the nine measured values was taken.
[0041] Nitrite determination:
[0042] In the preliminary experiment, the sample was further minced and then measured using the Beijing Zhiyunda Nitrite Detection Kit (designed with reference to the colorimetric method of GB / T 5009.33); the test was repeated three times, and if the results were consistent, that value was taken as the value; if the results were inconsistent, the sample was re-measured (the colorimetric card of the kit only provides integer values of 0.25, 1, 2.5, 5, and 10 mg / kg).
[0043] In subsequent experiments, the samples were further minced and the standard curve was set according to the colorimetric method of GB / T 5009.33 to accurately detect the nitrite content.
[0044] The product color and nitrite determination results are shown in Table 1:
[0045] Table 1 Results of product color and nitrite content after inoculation with different strains
[0046]
[0047]
[0048] The results showed that, except for Lactobacillus delbrueckii subsp. bulgaricus, the other three lactic acid bacteria all had the effect of inhibiting the production of nitrite, and Leuconostoc mesenteroides subsp. mesenteroides also had the effect of maintaining the bright color of the product.
[0049] Further, the applicant tried the combination of Lactobacillus acidophilus (3%) + Lactobacillus plantarum (3%), and Lactobacillus acidophilus (3%) + Leuconostoc mesenteroides (3%). The fermentation time of both was not significantly different from that of using a single strain (pH and total acid were basically reached in 30-40 days), while in terms of color protection and nitrite reduction, the combination of Lactobacillus acidophilus and Leuconostoc mesenteroides achieved an effect that was significantly better than the other combination and a single strain, as shown in Table 2:
[0050] Table 2 Results of product color and nitrite content after inoculation with different bacterial strain combinations
[0051]
[0052] In summary, the combination of Lactobacillus acidophilus and Leuconostoc mesenteroides was selected for pure strain fermentation, and the inoculation amount of both was 3×10 6 CFU / g fermentation raw material.
[0053] Example 3 Guilin chili sauce pure strain fermentation flavor optimization experiment
[0054] After actual tasting, although the products inoculated with Lactobacillus and Leuconostoc mesenteroides for 30-40 days are not inferior to or even better than the naturally fermented ones in terms of total acid, nitrite, amino acid nitrogen and other indicators, according to the evaluation of many tasters, they are still lacking in aroma compared to the products naturally fermented for 60 days.
[0055] Considering that a large amount of oily components and alcohol components are introduced into fermented black beans, garlic, and wine, the presence of these components may hinder the bacteria from utilizing many components in the fermentation raw materials. Therefore, based on the 40-day pure strain fermentation of Lactobacillus acidophilus and Leuconostoc mesenteroides in Example 2, three different types of edible surfactants were tried to be added to the fermentation raw materials (considering the use and dosage regulations in the food additive standards): Tween 20 (0.3 parts by weight), propylene glycol alginate (0.5 parts by weight), maltitol (0.5 parts by weight)
[0056] GC / MS analysis:
[0057] 150g of product sample was added to 500mL of double distilled water, and the extract was collected with 50mL of ether. The ether was placed at 4°C overnight, filtered, and rotary evaporated to about one-tenth of the volume for GC / MS analysis (EXPEC 5231GC / MS instrument; DB-1 capillary column; injection temperature: 230°C; injection volume: 1μL; helium carrier gas; ionization mode: EI, ionization voltage 80eV).
[0058] Results The NIST spectral library was analyzed to determine the types of volatile components and divide them into esters, alcohols, phenols, aldehydes / ketones, hydrocarbons, and others.
[0059] The results are as follows Figure 4 As shown in the figure, the results are the same as those of the tasting. Except for the number of hydrocarbon species, which is basically the same in each group, the types of esters, alcohols, and phenols, which are generally believed to bring flavor to sauces, are significantly less in pure fermentation products than in natural fermentation. The addition of ester and sugar alcohol surfactants does not significantly increase the types of volatile components, while the addition of Tween 20 can effectively increase the types of volatile components after 40 days of pure fermentation. The types and abundances of several high-abundance main flavor substances, such as ethanol, linalool, phenylethanol, ethyl acetate, methyl salicylate, ethyl palmitate, and 4-ethyl-2-methoxyphenol, are also close to those in natural fermentation.
Claims
1. A method for preparing Guilin traditional chili sauce by lactic acid bacteria fermentation, characterized in that: The method comprises: (1) crushing 40-60 parts by weight of red pepper, adding 2-5 parts by weight of salt, mixing evenly, and pickling for one month to obtain pickled red pepper; (2) adding 8-11 parts by weight of minced garlic, 7-10 parts by weight of fermented black beans, 7-9 parts by weight of 50-55% Sanhua wine, 2-4 parts by weight of sugar, 3-4 parts by weight of salt, and 0.5-1.5 parts by weight of monosodium glutamate to the pickled red peppers obtained in step (1), mixing well, and then crushing again to obtain a fermentation raw material; (3) placing the fermentation raw material obtained in step (2) into a fermentation container, adding 0.2-0.5 parts by weight of an emulsifier, inoculating Lactobacillus acidophilus and Leuconostoc mesenteroides subsp. mesenteroides, mixing evenly, covering, and fermenting under natural conditions for 30-40 days.
2. The method according to claim 1, wherein step (1) comprises crushing 50 parts by weight of red pepper, adding 3 parts by weight of salt, mixing evenly, and pickling for one month to obtain pickled red pepper.
3. The method according to claim 1, step (2) is: adding 10 parts by weight of minced garlic, 8 parts by weight of fermented black beans, 8 parts by weight of Sanhua wine, 3 parts by weight of white sugar, 3 parts by weight of salt, and 1 part by weight of monosodium glutamate to the pickled red peppers obtained in step (1), mixing well and then crushing again to obtain the fermentation raw material.
4. The method according to claim 1, wherein in step (3), 3×10 Lactobacillus acidophilus is inoculated 6 CFU / g fermentation raw material and Leuconostoc mesenteroides subsp. mesenteroides 3×10 6 CFU / g fermentation raw material.
5. The method according to claim 4, wherein the Lactobacillus acidophilus is a Lactobacillus acidophilus having a CGMCC preservation number of CGMCC No.1.1854, and the Leuconostoc mesenteroides subsp. mesenteroides is a Leuconostoc mesenteroides subsp. mesenteroides having an ATCC number of ATCC 8293.
6. The method according to any one of claims 1 to 5, wherein 0.3 parts by weight of Tween 20 is added in step (3).
7. The method according to claim 1, wherein the alcohol content of the Sanhua wine is 52 degrees.
8. The method according to claim 1, wherein the natural condition in step (3) is a condition with a temperature difference between day and night, and a minimum temperature not lower than 10°C.
9. The method according to claim 1, wherein the fermentation in step (3) is carried out under natural conditions for 40 days.
10. The method according to claim 1, wherein the red pepper in step (1) is a red pepper of the Red Sun variety, and / or the fermentation container in step (3) is a glass jar or a clay jar.